zr small rna page recovery kit  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    ZR small RNA PAGE Recovery Kit
    Description:
    The ZR small RNA PAGE Recovery Kit provides an easy and efficient method for the extraction of high quality small RNAs from polyacrylamide gels native and or denatured The ZR small RNA PAGE Recovery Kit is a refinement of the crush and soak method that incorporates a unique buffer system together with Zymo Spin column technologies for improved recovery and added convenience The recovered RNA can be concentrated into volumes as small as 6 µl making it ideal for many downstream enzymatic reactions and manipulations
    Catalog Number:
    r1070
    Price:
    None
    Applications:
    PAGE Gel Clean-up
    Size:
    20 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research zr small rna page recovery kit
    ZR small RNA PAGE Recovery Kit
    The ZR small RNA PAGE Recovery Kit provides an easy and efficient method for the extraction of high quality small RNAs from polyacrylamide gels native and or denatured The ZR small RNA PAGE Recovery Kit is a refinement of the crush and soak method that incorporates a unique buffer system together with Zymo Spin column technologies for improved recovery and added convenience The recovered RNA can be concentrated into volumes as small as 6 µl making it ideal for many downstream enzymatic reactions and manipulations
    https://www.bioz.com/result/zr small rna page recovery kit/product/Zymo Research
    Average 95 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    zr small rna page recovery kit - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Artificial “ping-pong” cascade of PIWI-interacting RNA in silkworm cells
    Article Snippet: Small RNAs were recovered using the ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. Small RNA libraries were constructed using the small RNA Cloning Kit (TaKaRa).

    Amplification:

    Article Title: A high-throughput, quantitative cell-based screen for efficient tailoring of RNA device activity
    Article Snippet: In vitro transcription and purification of ribozyme-based devices Selected ribozyme-based devices and ribozyme and noncleaving controls were PCR amplified to include an upstream T7 promoter site and spacer sequence and downstream spacer sequence using forward and reverse primers T7-L1-2-fwd (5′-TTCTAATACGACTCACTATAGGGA CCTAGGAAACAAACAAAGCTGTCACC) and L1-2-rev (5′-GGCTCGAGTTTTTATTTTTCTTTTTGCTGTTTCG), respectively. .. Uncleaved transcripts were gel extracted and recovered with the ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA) according to manufacturer’s instructions.

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. The ligation product was then used for 5′ adaptor ligation at 25 °C for 1 h, product of which was used as a template for reverse transcription at 50 °C for 1 h. The cDNA was then amplified using primers that contain indexes.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Antagonistic roles of Nibbler and Hen1 in modulating piRNA 3′ ends in Drosophila
    Article Snippet: .. Small RNA of ∼20-29 nt was sliced from the gel and recovered using the ZR Small-RNA PAGE Recovery Kit (Zymo Research). ..

    Article Title: Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix
    Article Snippet: .. For Northern blot analysis using the vsRNA probe, the LMW RNA sample was separated by 6 M urea–15% polyacrylamide gel electrophoresis, from which an approximately 18- to 26-nt fraction (estimated using 14 to 30 ssRNA markers [TaKaRa Bio]) was recovered using a ZR small-RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions. .. The recovered 2 μg of 18- to 26-nt RNAs were directly labeled with digoxin using a Label IT digoxin labeling kit (TaKaRa Bio) according to the manufacturer's instructions.

    Article Title: Switching the activity of Cas12a using guide RNA strand displacement circuits
    Article Snippet: .. The gel slice was then purified using a ZR small-RNA PAGE Recovery kit (Zymo Research) according to the manufacturer’s instructions. .. For RNAs with no significant bands of incorrect length, the RNA was phenol-chloroform purified using Phase Lock Gel Heavy (VWR) tubes.

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: .. Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). ..

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: .. The labeled RNA was recovered from the gel using a ZR Small-RNA PAGE Recovery Kit. .. 5′-32 P-labeled RNA (5 pmol) was mixed with 30 pmol ASO in annealing buffer (1×: 10 mM Tris [pH 7.5], 50 mM NaCl, 1 mM EDTA).

    Article Title: Heavy Chronic Intermittent Ethanol Exposure Alters Small Noncoding RNAs in Mouse Sperm and Epididymosomes
    Article Snippet: .. Ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) analysis of sperm small noncoding RNA modifications Sperm total RNA was pooled from 4 to 8 mice (3 pooled samples/group), loaded (~1 μg/lane) on Novex TBE-Urea 15% polyacrylamide gels (Thermo Fisher) and electrophoresed at 180 V for 1 h. Under UV light, the ~30–40 nt band of RNA was recovered using ZR small-RNA PAGE Recovery Kit (Zymo Research). .. For each sample, 100 ng of the recovered small RNA was digested and prepared for UHPLC-MS/MS at the University at Albany RNA Mass Spectrometry Core (Albany, NY) using established methods (Basanta-Sanchez et al., ).

    Article Title: Heavy Chronic Intermittent Ethanol Exposure Alters Small Noncoding RNAs in Mouse Sperm and Epididymosomes
    Article Snippet: .. Sperm total RNA was pooled from 4 to 8 mice (3 pooled samples/group), loaded (~1 μg/lane) on Novex TBE-Urea 15% polyacrylamide gels (Thermo Fisher) and electrophoresed at 180 V for 1 h. Under UV light, the ~30–40 nt band of RNA was recovered using ZR small-RNA PAGE Recovery Kit (Zymo Research). .. For each sample, 100 ng of the recovered small RNA was digested and prepared for UHPLC-MS/MS at the University at Albany RNA Mass Spectrometry Core (Albany, NY) using established methods (Basanta-Sanchez et al., ).

    Article Title: Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity
    Article Snippet: .. The in vitro transcription products were purified on 7% urea-PAGE using a ZR small-RNA PAGE Recovery Kit (Zymo Research), and the concentrations were determined using NanoDrop ND-100 Spectrophotometer. .. All in vitro transcribed RNAs were 3′-end biotinylated using a 3′-End Biotinylation Kit (Pierce, Thermo Scientific).

    Article Title: A high-throughput, quantitative cell-based screen for efficient tailoring of RNA device activity
    Article Snippet: .. Uncleaved transcripts were gel extracted and recovered with the ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA) according to manufacturer’s instructions. ..

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: .. All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research). .. Recovered RNA was diluted in 1× annealing buffer (10 mM Tris-HCl [pH 7.8] and 100 mM NaCl) and reannealed at low concentration in a PCR machine by heating to 95°C for 5 min and cooling to 4°C at 0.1°C/s.

    Article Title: Interplay and Targetome of the Two Conserved Cyanobacterial sRNAs Yfr1 and Yfr2 in Prochlorococcus MED4
    Article Snippet: .. For the primer extension assay, if required, in vitro -transcribed RNA was separated on 7 M urea-10% polyacrylamide gels or on 2% non-denaturing agarose gels, and full length fragments were excised and purified using either a ZR small-RNA PAGE Recovery Kit (Zymo Research) or a NucleoSpin Gel and PCR-Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions. .. For biotinylation, two volumes of KIO4 (6 mM) were added to 1.5 nmol of RNA and was incubated at room temperature, in the dark for one hour.

    Article Title: Artificial “ping-pong” cascade of PIWI-interacting RNA in silkworm cells
    Article Snippet: .. Small RNAs were recovered using the ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. Small RNA libraries were constructed using the small RNA Cloning Kit (TaKaRa).

    Article Title: Detecting RNA-RNA interactions in E. coli using a modified CLASH method
    Article Snippet: .. The bands corresponding to 40-100 nt were cut out and recovered using a ZR small-RNA PAGE recovery kit (Zymo research). .. RNA dephosphorylation The recovered RNAs were incubated in a dephosphorylation mixture containing 8 U FastAP thermosensitive alkaline phosphatase (Thermo Scientific, EF0651) and 40 U RNase inhibitors in polynucleotide kinase (PNK) buffer for 45 min at 20 °C.

    Article Title: Reversible perturbations of gene regulation after genome editing in Drosophila cells
    Article Snippet: .. However, the ZR small RNA PAGE Recovery Kit (Zymo Research, USA) was used after PAGE-purification of the small RNAs. .. Deep sequencing was performed on an Illumina HiSeq instrument by LAFUGA (Gene Center, LMU Munich, Germany) and the sequences were analyzed using custom Galaxy, bowtie, perl and R scripts (available upon request).

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: .. Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. Small-RNA libraries were prepared using NEB Next Multiplex Small RNA Library Prep Set (New England Biolabs).

    Synthesized:

    Article Title: Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix
    Article Snippet: To analyze the detection efficacy of each RNA probe, dot blot analyses of in vitro -synthesized RNA complementary to each probe were carried out. .. For Northern blot analysis using the vsRNA probe, the LMW RNA sample was separated by 6 M urea–15% polyacrylamide gel electrophoresis, from which an approximately 18- to 26-nt fraction (estimated using 14 to 30 ssRNA markers [TaKaRa Bio]) was recovered using a ZR small-RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions.

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: Reagents ASOs used in this study were designed and synthesized by AUM LifeTech (Philadelphia, PA, USA). .. Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA).

    Article Title: Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity
    Article Snippet: RNA Probe Preparation The Pentaprobes (PP) library developed by that comprises twelve 100-bp oligonucleotides encompassing 1,024 possible 5-nucleotide sequence combinations was synthesized by Sangon (Shanghai, China). .. The in vitro transcription products were purified on 7% urea-PAGE using a ZR small-RNA PAGE Recovery Kit (Zymo Research), and the concentrations were determined using NanoDrop ND-100 Spectrophotometer.

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: .. All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research). .. Recovered RNA was diluted in 1× annealing buffer (10 mM Tris-HCl [pH 7.8] and 100 mM NaCl) and reannealed at low concentration in a PCR machine by heating to 95°C for 5 min and cooling to 4°C at 0.1°C/s.

    Quantitative RT-PCR:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: .. Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). ..

    SYBR Green Assay:

    Article Title: Switching the activity of Cas12a using guide RNA strand displacement circuits
    Article Snippet: The RNA was run on an 8 M urea denaturing TBE 12% polyacrylamide (29:1 acrylamide/bis-acrylamide) gel at 120 V for 45 min, stained with SYBR Green II (ThermoFisher), and excised on a UV table. .. The gel slice was then purified using a ZR small-RNA PAGE Recovery kit (Zymo Research) according to the manufacturer’s instructions.

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: .. Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). ..

    Primer Extension Assay:

    Article Title: Interplay and Targetome of the Two Conserved Cyanobacterial sRNAs Yfr1 and Yfr2 in Prochlorococcus MED4
    Article Snippet: .. For the primer extension assay, if required, in vitro -transcribed RNA was separated on 7 M urea-10% polyacrylamide gels or on 2% non-denaturing agarose gels, and full length fragments were excised and purified using either a ZR small-RNA PAGE Recovery Kit (Zymo Research) or a NucleoSpin Gel and PCR-Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions. .. For biotinylation, two volumes of KIO4 (6 mM) were added to 1.5 nmol of RNA and was incubated at room temperature, in the dark for one hour.

    Incubation:

    Article Title: Switching the activity of Cas12a using guide RNA strand displacement circuits
    Article Snippet: The transcription mix was incubated at 37 °C for 4 h. For very impure transcriptions (cf. .. The gel slice was then purified using a ZR small-RNA PAGE Recovery kit (Zymo Research) according to the manufacturer’s instructions.

    Article Title: A high-throughput, quantitative cell-based screen for efficient tailoring of RNA device activity
    Article Snippet: After incubation at 37°C for 2 h, NucAway Spin Columns (Ambion, Austin, TX) were used to remove unincorporated nucleotides from the transcription reactions according to manufacturer’s instructions. .. Uncleaved transcripts were gel extracted and recovered with the ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA) according to manufacturer’s instructions.

    Article Title: Interplay and Targetome of the Two Conserved Cyanobacterial sRNAs Yfr1 and Yfr2 in Prochlorococcus MED4
    Article Snippet: For the primer extension assay, if required, in vitro -transcribed RNA was separated on 7 M urea-10% polyacrylamide gels or on 2% non-denaturing agarose gels, and full length fragments were excised and purified using either a ZR small-RNA PAGE Recovery Kit (Zymo Research) or a NucleoSpin Gel and PCR-Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions. .. For biotinylation, two volumes of KIO4 (6 mM) were added to 1.5 nmol of RNA and was incubated at room temperature, in the dark for one hour.

    Mass Spectrometry:

    Article Title: Heavy Chronic Intermittent Ethanol Exposure Alters Small Noncoding RNAs in Mouse Sperm and Epididymosomes
    Article Snippet: .. Ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) analysis of sperm small noncoding RNA modifications Sperm total RNA was pooled from 4 to 8 mice (3 pooled samples/group), loaded (~1 μg/lane) on Novex TBE-Urea 15% polyacrylamide gels (Thermo Fisher) and electrophoresed at 180 V for 1 h. Under UV light, the ~30–40 nt band of RNA was recovered using ZR small-RNA PAGE Recovery Kit (Zymo Research). .. For each sample, 100 ng of the recovered small RNA was digested and prepared for UHPLC-MS/MS at the University at Albany RNA Mass Spectrometry Core (Albany, NY) using established methods (Basanta-Sanchez et al., ).

    Article Title: Heavy Chronic Intermittent Ethanol Exposure Alters Small Noncoding RNAs in Mouse Sperm and Epididymosomes
    Article Snippet: Paragraph title: Ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) analysis of sperm small noncoding RNA modifications ... Sperm total RNA was pooled from 4 to 8 mice (3 pooled samples/group), loaded (~1 μg/lane) on Novex TBE-Urea 15% polyacrylamide gels (Thermo Fisher) and electrophoresed at 180 V for 1 h. Under UV light, the ~30–40 nt band of RNA was recovered using ZR small-RNA PAGE Recovery Kit (Zymo Research).

    Modification:

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: The DNA templates (sequences are available upon request) were modified with C-2′-methoxyls at the last two nucleotides of the 5′ termini and PAGE purified (Sigma) to ensure defined 3′ ends of the RNA products ( ). .. All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research).

    Hybridization:

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. Purified small RNAs were ligated to the 3′ adaptor at 25 °C for 1 h, followed by hybridization with RT Primer at 75 °C for 5 min.

    Countercurrent Chromatography:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). .. Primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA): GAPDH forward primer: 5′-CAT TGA CCT CAA CTA CAT G-3′; GAPDH reverse primer: 5′-TCT CCA TGG TGA AGA C-3′; HPRT forward primer: 5′-TGA CAC TGG CAA AAC AAT GCA-3′; HPRT reverse primer: 5′-GGT CCT TTT CAC CAG CAA GCT-3′; primers for 5′-RACE PCR: pNL4-3UTR-1: 5′-AGT CGC CCC TCG CCT CTT G-3′; 5′-cDNA primer: 5′-GGA CAC TGA CAT GGA CTG AAG GAG TA-3′; pNL4-3UTR-2: 5′-AGG GAT GGT TGT AGC TGT CCC AGT AT-3′; forward primer for HIV RNA transcript (T7pNL4-3_FP): 5′- TAA TAC GAC TCA CTA TAG GG T CTC TCT GGT TAG-3′ (the T7 promoter is underlined); reverse primer for HIV RNA transcript (pNL4-3-gag_RP): 5′-GCT TAA TAC CGA CGC TCT C-3′.

    Ligation:

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. The ligation product was then used for 5′ adaptor ligation at 25 °C for 1 h, product of which was used as a template for reverse transcription at 50 °C for 1 h. The cDNA was then amplified using primers that contain indexes.

    Northern Blot:

    Article Title: Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix
    Article Snippet: .. For Northern blot analysis using the vsRNA probe, the LMW RNA sample was separated by 6 M urea–15% polyacrylamide gel electrophoresis, from which an approximately 18- to 26-nt fraction (estimated using 14 to 30 ssRNA markers [TaKaRa Bio]) was recovered using a ZR small-RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions. .. The recovered 2 μg of 18- to 26-nt RNAs were directly labeled with digoxin using a Label IT digoxin labeling kit (TaKaRa Bio) according to the manufacturer's instructions.

    Cell Culture:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: Unless otherwise noted, all chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA), all restriction enzymes were obtained from New England BioLabs (NEB, Ipswich, MA, USA), and all cell culture products were purchased from GIBCO (Thermo Fisher Scientific, Waltham, MA, USA). .. Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA).

    Generated:

    Article Title: Interplay and Targetome of the Two Conserved Cyanobacterial sRNAs Yfr1 and Yfr2 in Prochlorococcus MED4
    Article Snippet: In vitro RNA synthesis and biotinylation of RNA Transcript templates for in vitro RNA synthesis were generated from purified PCR products or annealed complementary oligonucleotides using primers #4–13 (Table ). .. For the primer extension assay, if required, in vitro -transcribed RNA was separated on 7 M urea-10% polyacrylamide gels or on 2% non-denaturing agarose gels, and full length fragments were excised and purified using either a ZR small-RNA PAGE Recovery Kit (Zymo Research) or a NucleoSpin Gel and PCR-Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions.

    Article Title: Reversible perturbations of gene regulation after genome editing in Drosophila cells
    Article Snippet: Library generation, deep sequencing and data analysis sRNA libraries were generated essentially as previously described [ ]. .. However, the ZR small RNA PAGE Recovery Kit (Zymo Research, USA) was used after PAGE-purification of the small RNAs.

    DNA Sequencing:

    Article Title: Artificial “ping-pong” cascade of PIWI-interacting RNA in silkworm cells
    Article Snippet: Small RNAs were recovered using the ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. DNA sequencing was performed using the Illumina HiSeq 2500 platform.

    Polymerase Chain Reaction:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). .. Primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA): GAPDH forward primer: 5′-CAT TGA CCT CAA CTA CAT G-3′; GAPDH reverse primer: 5′-TCT CCA TGG TGA AGA C-3′; HPRT forward primer: 5′-TGA CAC TGG CAA AAC AAT GCA-3′; HPRT reverse primer: 5′-GGT CCT TTT CAC CAG CAA GCT-3′; primers for 5′-RACE PCR: pNL4-3UTR-1: 5′-AGT CGC CCC TCG CCT CTT G-3′; 5′-cDNA primer: 5′-GGA CAC TGA CAT GGA CTG AAG GAG TA-3′; pNL4-3UTR-2: 5′-AGG GAT GGT TGT AGC TGT CCC AGT AT-3′; forward primer for HIV RNA transcript (T7pNL4-3_FP): 5′- TAA TAC GAC TCA CTA TAG GG T CTC TCT GGT TAG-3′ (the T7 promoter is underlined); reverse primer for HIV RNA transcript (pNL4-3-gag_RP): 5′-GCT TAA TAC CGA CGC TCT C-3′.

    Article Title: A high-throughput, quantitative cell-based screen for efficient tailoring of RNA device activity
    Article Snippet: A total of 1–2 µg of PCR product was transcribed in a 25 µl reaction, consisting of the following components: 1×RNA Pol Reaction Buffer (New England Biolabs), 2.5 mM rATP, 2.5 mM rCTP, 2.5 mM rUTP, 0.25 mM rGTP, 1 µl RNaseOUT (Invitrogen), 10 mM MgCl2 , 1 µl T7 Polymerase (New England Biolabs) and 0.5 µCi α-32 P-GTP (MP Biomedicals, Solon, OH). .. Uncleaved transcripts were gel extracted and recovered with the ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA) according to manufacturer’s instructions.

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research). .. Recovered RNA was diluted in 1× annealing buffer (10 mM Tris-HCl [pH 7.8] and 100 mM NaCl) and reannealed at low concentration in a PCR machine by heating to 95°C for 5 min and cooling to 4°C at 0.1°C/s.

    Article Title: Interplay and Targetome of the Two Conserved Cyanobacterial sRNAs Yfr1 and Yfr2 in Prochlorococcus MED4
    Article Snippet: .. For the primer extension assay, if required, in vitro -transcribed RNA was separated on 7 M urea-10% polyacrylamide gels or on 2% non-denaturing agarose gels, and full length fragments were excised and purified using either a ZR small-RNA PAGE Recovery Kit (Zymo Research) or a NucleoSpin Gel and PCR-Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions. .. For biotinylation, two volumes of KIO4 (6 mM) were added to 1.5 nmol of RNA and was incubated at room temperature, in the dark for one hour.

    Gel Purification:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: .. Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). ..

    Cellular Antioxidant Activity Assay:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). .. Primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA): GAPDH forward primer: 5′-CAT TGA CCT CAA CTA CAT G-3′; GAPDH reverse primer: 5′-TCT CCA TGG TGA AGA C-3′; HPRT forward primer: 5′-TGA CAC TGG CAA AAC AAT GCA-3′; HPRT reverse primer: 5′-GGT CCT TTT CAC CAG CAA GCT-3′; primers for 5′-RACE PCR: pNL4-3UTR-1: 5′-AGT CGC CCC TCG CCT CTT G-3′; 5′-cDNA primer: 5′-GGA CAC TGA CAT GGA CTG AAG GAG TA-3′; pNL4-3UTR-2: 5′-AGG GAT GGT TGT AGC TGT CCC AGT AT-3′; forward primer for HIV RNA transcript (T7pNL4-3_FP): 5′- TAA TAC GAC TCA CTA TAG GG T CTC TCT GGT TAG-3′ (the T7 promoter is underlined); reverse primer for HIV RNA transcript (pNL4-3-gag_RP): 5′-GCT TAA TAC CGA CGC TCT C-3′.

    RNA Sequencing Assay:

    Article Title: Antagonistic roles of Nibbler and Hen1 in modulating piRNA 3′ ends in Drosophila
    Article Snippet: Paragraph title: Small RNA sequencing ... Small RNA of ∼20-29 nt was sliced from the gel and recovered using the ZR Small-RNA PAGE Recovery Kit (Zymo Research).

    Isolation:

    Article Title: Antagonistic roles of Nibbler and Hen1 in modulating piRNA 3′ ends in Drosophila
    Article Snippet: Small RNA sequencing Fly tissues were dissected in ice-cold 1× phosphate buffered saline solution (Sangon Biotech), and total RNA was isolated using Trizol according to the manufacturer's instructions (Life Technologies). .. Small RNA of ∼20-29 nt was sliced from the gel and recovered using the ZR Small-RNA PAGE Recovery Kit (Zymo Research).

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: Total RNA extraction was isolated using TRIzol reagent (Invitrogen). .. Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research).

    RNA Extraction:

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: Total RNA extraction was isolated using TRIzol reagent (Invitrogen). .. Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research).

    Labeling:

    Article Title: Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix
    Article Snippet: For Northern blot analysis using the vsRNA probe, the LMW RNA sample was separated by 6 M urea–15% polyacrylamide gel electrophoresis, from which an approximately 18- to 26-nt fraction (estimated using 14 to 30 ssRNA markers [TaKaRa Bio]) was recovered using a ZR small-RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions. .. The recovered 2 μg of 18- to 26-nt RNAs were directly labeled with digoxin using a Label IT digoxin labeling kit (TaKaRa Bio) according to the manufacturer's instructions.

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: .. The labeled RNA was recovered from the gel using a ZR Small-RNA PAGE Recovery Kit. .. 5′-32 P-labeled RNA (5 pmol) was mixed with 30 pmol ASO in annealing buffer (1×: 10 mM Tris [pH 7.5], 50 mM NaCl, 1 mM EDTA).

    Purification:

    Article Title: Switching the activity of Cas12a using guide RNA strand displacement circuits
    Article Snippet: .. The gel slice was then purified using a ZR small-RNA PAGE Recovery kit (Zymo Research) according to the manufacturer’s instructions. .. For RNAs with no significant bands of incorrect length, the RNA was phenol-chloroform purified using Phase Lock Gel Heavy (VWR) tubes.

    Article Title: Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity
    Article Snippet: .. The in vitro transcription products were purified on 7% urea-PAGE using a ZR small-RNA PAGE Recovery Kit (Zymo Research), and the concentrations were determined using NanoDrop ND-100 Spectrophotometer. .. All in vitro transcribed RNAs were 3′-end biotinylated using a 3′-End Biotinylation Kit (Pierce, Thermo Scientific).

    Article Title: A high-throughput, quantitative cell-based screen for efficient tailoring of RNA device activity
    Article Snippet: Paragraph title: In vitro transcription and purification of ribozyme-based devices ... Uncleaved transcripts were gel extracted and recovered with the ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA) according to manufacturer’s instructions.

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: .. All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research). .. Recovered RNA was diluted in 1× annealing buffer (10 mM Tris-HCl [pH 7.8] and 100 mM NaCl) and reannealed at low concentration in a PCR machine by heating to 95°C for 5 min and cooling to 4°C at 0.1°C/s.

    Article Title: Interplay and Targetome of the Two Conserved Cyanobacterial sRNAs Yfr1 and Yfr2 in Prochlorococcus MED4
    Article Snippet: .. For the primer extension assay, if required, in vitro -transcribed RNA was separated on 7 M urea-10% polyacrylamide gels or on 2% non-denaturing agarose gels, and full length fragments were excised and purified using either a ZR small-RNA PAGE Recovery Kit (Zymo Research) or a NucleoSpin Gel and PCR-Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions. .. For biotinylation, two volumes of KIO4 (6 mM) were added to 1.5 nmol of RNA and was incubated at room temperature, in the dark for one hour.

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. Purified small RNAs were ligated to the 3′ adaptor at 25 °C for 1 h, followed by hybridization with RT Primer at 75 °C for 5 min.

    Dot Blot:

    Article Title: Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix
    Article Snippet: The exposure times showing similar signal strengths among the dot blot analyses were determined and were used for each vsRNA Northern blot analysis. .. For Northern blot analysis using the vsRNA probe, the LMW RNA sample was separated by 6 M urea–15% polyacrylamide gel electrophoresis, from which an approximately 18- to 26-nt fraction (estimated using 14 to 30 ssRNA markers [TaKaRa Bio]) was recovered using a ZR small-RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions.

    Sequencing:

    Article Title: Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity
    Article Snippet: RNA Probe Preparation The Pentaprobes (PP) library developed by that comprises twelve 100-bp oligonucleotides encompassing 1,024 possible 5-nucleotide sequence combinations was synthesized by Sangon (Shanghai, China). .. The in vitro transcription products were purified on 7% urea-PAGE using a ZR small-RNA PAGE Recovery Kit (Zymo Research), and the concentrations were determined using NanoDrop ND-100 Spectrophotometer.

    Article Title: A high-throughput, quantitative cell-based screen for efficient tailoring of RNA device activity
    Article Snippet: In vitro transcription and purification of ribozyme-based devices Selected ribozyme-based devices and ribozyme and noncleaving controls were PCR amplified to include an upstream T7 promoter site and spacer sequence and downstream spacer sequence using forward and reverse primers T7-L1-2-fwd (5′-TTCTAATACGACTCACTATAGGGA CCTAGGAAACAAACAAAGCTGTCACC) and L1-2-rev (5′-GGCTCGAGTTTTTATTTTTCTTTTTGCTGTTTCG), respectively. .. Uncleaved transcripts were gel extracted and recovered with the ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA) according to manufacturer’s instructions.

    Article Title: Reversible perturbations of gene regulation after genome editing in Drosophila cells
    Article Snippet: Paragraph title: Library generation, deep sequencing and data analysis ... However, the ZR small RNA PAGE Recovery Kit (Zymo Research, USA) was used after PAGE-purification of the small RNAs.

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: Paragraph title: sRNA Sequencing. ... Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research).

    shRNA:

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: In vitro transcription (IVT) of short hairpin RNA mimicking the authentic IAV panhandle structure and its variants was performed using the MEGAshortscript T7 transcription kit (Ambion) per the manufacturer's instructions. .. All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research).

    Construct:

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: .. All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research). .. Recovered RNA was diluted in 1× annealing buffer (10 mM Tris-HCl [pH 7.8] and 100 mM NaCl) and reannealed at low concentration in a PCR machine by heating to 95°C for 5 min and cooling to 4°C at 0.1°C/s.

    Article Title: Artificial “ping-pong” cascade of PIWI-interacting RNA in silkworm cells
    Article Snippet: Small RNAs were recovered using the ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. Small RNA libraries were constructed using the small RNA Cloning Kit (TaKaRa).

    De-Phosphorylation Assay:

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research). .. Dephosphorylation of viral RNA was carried out using calf intestinal alkaline phosphatase (CIAP; New England BioLabs [NEB]).

    IA:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). .. Primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA): GAPDH forward primer: 5′-CAT TGA CCT CAA CTA CAT G-3′; GAPDH reverse primer: 5′-TCT CCA TGG TGA AGA C-3′; HPRT forward primer: 5′-TGA CAC TGG CAA AAC AAT GCA-3′; HPRT reverse primer: 5′-GGT CCT TTT CAC CAG CAA GCT-3′; primers for 5′-RACE PCR: pNL4-3UTR-1: 5′-AGT CGC CCC TCG CCT CTT G-3′; 5′-cDNA primer: 5′-GGA CAC TGA CAT GGA CTG AAG GAG TA-3′; pNL4-3UTR-2: 5′-AGG GAT GGT TGT AGC TGT CCC AGT AT-3′; forward primer for HIV RNA transcript (T7pNL4-3_FP): 5′- TAA TAC GAC TCA CTA TAG GG T CTC TCT GGT TAG-3′ (the T7 promoter is underlined); reverse primer for HIV RNA transcript (pNL4-3-gag_RP): 5′-GCT TAA TAC CGA CGC TCT C-3′.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). .. Primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA): GAPDH forward primer: 5′-CAT TGA CCT CAA CTA CAT G-3′; GAPDH reverse primer: 5′-TCT CCA TGG TGA AGA C-3′; HPRT forward primer: 5′-TGA CAC TGG CAA AAC AAT GCA-3′; HPRT reverse primer: 5′-GGT CCT TTT CAC CAG CAA GCT-3′; primers for 5′-RACE PCR: pNL4-3UTR-1: 5′-AGT CGC CCC TCG CCT CTT G-3′; 5′-cDNA primer: 5′-GGA CAC TGA CAT GGA CTG AAG GAG TA-3′; pNL4-3UTR-2: 5′-AGG GAT GGT TGT AGC TGT CCC AGT AT-3′; forward primer for HIV RNA transcript (T7pNL4-3_FP): 5′- TAA TAC GAC TCA CTA TAG GG T CTC TCT GGT TAG-3′ (the T7 promoter is underlined); reverse primer for HIV RNA transcript (pNL4-3-gag_RP): 5′-GCT TAA TAC CGA CGC TCT C-3′.

    Mouse Assay:

    Article Title: Heavy Chronic Intermittent Ethanol Exposure Alters Small Noncoding RNAs in Mouse Sperm and Epididymosomes
    Article Snippet: .. Ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) analysis of sperm small noncoding RNA modifications Sperm total RNA was pooled from 4 to 8 mice (3 pooled samples/group), loaded (~1 μg/lane) on Novex TBE-Urea 15% polyacrylamide gels (Thermo Fisher) and electrophoresed at 180 V for 1 h. Under UV light, the ~30–40 nt band of RNA was recovered using ZR small-RNA PAGE Recovery Kit (Zymo Research). .. For each sample, 100 ng of the recovered small RNA was digested and prepared for UHPLC-MS/MS at the University at Albany RNA Mass Spectrometry Core (Albany, NY) using established methods (Basanta-Sanchez et al., ).

    Article Title: Heavy Chronic Intermittent Ethanol Exposure Alters Small Noncoding RNAs in Mouse Sperm and Epididymosomes
    Article Snippet: .. Sperm total RNA was pooled from 4 to 8 mice (3 pooled samples/group), loaded (~1 μg/lane) on Novex TBE-Urea 15% polyacrylamide gels (Thermo Fisher) and electrophoresed at 180 V for 1 h. Under UV light, the ~30–40 nt band of RNA was recovered using ZR small-RNA PAGE Recovery Kit (Zymo Research). .. For each sample, 100 ng of the recovered small RNA was digested and prepared for UHPLC-MS/MS at the University at Albany RNA Mass Spectrometry Core (Albany, NY) using established methods (Basanta-Sanchez et al., ).

    Liquid Chromatography:

    Article Title: Heavy Chronic Intermittent Ethanol Exposure Alters Small Noncoding RNAs in Mouse Sperm and Epididymosomes
    Article Snippet: .. Ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) analysis of sperm small noncoding RNA modifications Sperm total RNA was pooled from 4 to 8 mice (3 pooled samples/group), loaded (~1 μg/lane) on Novex TBE-Urea 15% polyacrylamide gels (Thermo Fisher) and electrophoresed at 180 V for 1 h. Under UV light, the ~30–40 nt band of RNA was recovered using ZR small-RNA PAGE Recovery Kit (Zymo Research). .. For each sample, 100 ng of the recovered small RNA was digested and prepared for UHPLC-MS/MS at the University at Albany RNA Mass Spectrometry Core (Albany, NY) using established methods (Basanta-Sanchez et al., ).

    Article Title: Heavy Chronic Intermittent Ethanol Exposure Alters Small Noncoding RNAs in Mouse Sperm and Epididymosomes
    Article Snippet: Paragraph title: Ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) analysis of sperm small noncoding RNA modifications ... Sperm total RNA was pooled from 4 to 8 mice (3 pooled samples/group), loaded (~1 μg/lane) on Novex TBE-Urea 15% polyacrylamide gels (Thermo Fisher) and electrophoresed at 180 V for 1 h. Under UV light, the ~30–40 nt band of RNA was recovered using ZR small-RNA PAGE Recovery Kit (Zymo Research).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: .. Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). ..

    Multiplex Assay:

    Article Title: A virus-targeted plant receptor-like kinase promotes cell-to-cell spread of RNAi
    Article Snippet: Small RNAs that are 14–30 nt in length were recovered using ZR small-RNA PAGE Recovery Kit (ZYMO Research). .. Small-RNA libraries were prepared using NEB Next Multiplex Small RNA Library Prep Set (New England Biolabs).

    Selection:

    Article Title: Detecting RNA-RNA interactions in E. coli using a modified CLASH method
    Article Snippet: Paragraph title: RNA size selection ... The bands corresponding to 40-100 nt were cut out and recovered using a ZR small-RNA PAGE recovery kit (Zymo research).

    In Vitro:

    Article Title: Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix
    Article Snippet: To analyze the detection efficacy of each RNA probe, dot blot analyses of in vitro -synthesized RNA complementary to each probe were carried out. .. For Northern blot analysis using the vsRNA probe, the LMW RNA sample was separated by 6 M urea–15% polyacrylamide gel electrophoresis, from which an approximately 18- to 26-nt fraction (estimated using 14 to 30 ssRNA markers [TaKaRa Bio]) was recovered using a ZR small-RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions.

    Article Title: Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity
    Article Snippet: .. The in vitro transcription products were purified on 7% urea-PAGE using a ZR small-RNA PAGE Recovery Kit (Zymo Research), and the concentrations were determined using NanoDrop ND-100 Spectrophotometer. .. All in vitro transcribed RNAs were 3′-end biotinylated using a 3′-End Biotinylation Kit (Pierce, Thermo Scientific).

    Article Title: A high-throughput, quantitative cell-based screen for efficient tailoring of RNA device activity
    Article Snippet: Paragraph title: In vitro transcription and purification of ribozyme-based devices ... Uncleaved transcripts were gel extracted and recovered with the ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA) according to manufacturer’s instructions.

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: In vitro transcription (IVT) of short hairpin RNA mimicking the authentic IAV panhandle structure and its variants was performed using the MEGAshortscript T7 transcription kit (Ambion) per the manufacturer's instructions. .. All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research).

    Article Title: Interplay and Targetome of the Two Conserved Cyanobacterial sRNAs Yfr1 and Yfr2 in Prochlorococcus MED4
    Article Snippet: .. For the primer extension assay, if required, in vitro -transcribed RNA was separated on 7 M urea-10% polyacrylamide gels or on 2% non-denaturing agarose gels, and full length fragments were excised and purified using either a ZR small-RNA PAGE Recovery Kit (Zymo Research) or a NucleoSpin Gel and PCR-Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions. .. For biotinylation, two volumes of KIO4 (6 mM) were added to 1.5 nmol of RNA and was incubated at room temperature, in the dark for one hour.

    Electrophoresis:

    Article Title: Artificial “ping-pong” cascade of PIWI-interacting RNA in silkworm cells
    Article Snippet: Ten micrograms of total RNA was loaded onto 15% denaturing polyacrylamide gels containing 10 M urea, separated by electrophoresis, and then stained with SYBRGold (Invitrogen). .. Small RNAs were recovered using the ZR small-RNA PAGE Recovery Kit (ZYMO Research).

    Ethanol Precipitation:

    Article Title: Interplay and Targetome of the Two Conserved Cyanobacterial sRNAs Yfr1 and Yfr2 in Prochlorococcus MED4
    Article Snippet: RNA was purified and concentrated by phenol-chloroform extraction and ethanol precipitation or using RNA Clean & Concentrator columns (Zymo Research) following the manufacturer’s instructions. .. For the primer extension assay, if required, in vitro -transcribed RNA was separated on 7 M urea-10% polyacrylamide gels or on 2% non-denaturing agarose gels, and full length fragments were excised and purified using either a ZR small-RNA PAGE Recovery Kit (Zymo Research) or a NucleoSpin Gel and PCR-Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions.

    Spectrophotometry:

    Article Title: Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity
    Article Snippet: .. The in vitro transcription products were purified on 7% urea-PAGE using a ZR small-RNA PAGE Recovery Kit (Zymo Research), and the concentrations were determined using NanoDrop ND-100 Spectrophotometer. .. All in vitro transcribed RNAs were 3′-end biotinylated using a 3′-End Biotinylation Kit (Pierce, Thermo Scientific).

    Concentration Assay:

    Article Title: Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction
    Article Snippet: All synthesized RNA constructs were purified on 20% denaturing polyacrylamide gels and recovered by using a ZR small RNA PAGE recovery kit (Zymo Research). .. Recovered RNA was diluted in 1× annealing buffer (10 mM Tris-HCl [pH 7.8] and 100 mM NaCl) and reannealed at low concentration in a PCR machine by heating to 95°C for 5 min and cooling to 4°C at 0.1°C/s.

    CTG Assay:

    Article Title: Dual Mechanisms of Action of Self-Delivering, Anti-HIV-1 FANA Oligonucleotides as a Potential New Approach to HIV Therapy
    Article Snippet: Sources for the other reagents were: Dynabeads CD8 (Thermo Fisher Scientific); iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA); SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories); RNeasy mini kit (QIAGEN, Germantown, MD, USA); RNase-free DNase Set (QIAGEN, Germantown, MD, USA); QIAquick Gel Purification Kit (QIAGEN, Germantown, MD, USA); Hoechst 33342 (Thermo Fisher Scientific); DAPI (Thermo Fisher Scientific); MEGAscript T7 Transcription Kit (Thermo Fisher Scientific); Bio-Spin 30 Columns (Bio-Rad Laboratories); Alliance HIV-1 P24 antigen ELISA kit (PerkinElmer, Waltham, MA, USA); Human IFN-α ELISA kit (R & D Systems, Minneapolis, MN, USA); IL-6 ELISA kit (Thermo Fisher Scientific); human RNase H1 (Abcam, Cambridge, UK); ZR Small-RNA PAGE Recovery Kit (Zymo Research, Irvine, CA, USA); and STAT-60 (TEL-TEST, Friendswood, TX, USA). .. Primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA): GAPDH forward primer: 5′-CAT TGA CCT CAA CTA CAT G-3′; GAPDH reverse primer: 5′-TCT CCA TGG TGA AGA C-3′; HPRT forward primer: 5′-TGA CAC TGG CAA AAC AAT GCA-3′; HPRT reverse primer: 5′-GGT CCT TTT CAC CAG CAA GCT-3′; primers for 5′-RACE PCR: pNL4-3UTR-1: 5′-AGT CGC CCC TCG CCT CTT G-3′; 5′-cDNA primer: 5′-GGA CAC TGA CAT GGA CTG AAG GAG TA-3′; pNL4-3UTR-2: 5′-AGG GAT GGT TGT AGC TGT CCC AGT AT-3′; forward primer for HIV RNA transcript (T7pNL4-3_FP): 5′- TAA TAC GAC TCA CTA TAG GG T CTC TCT GGT TAG-3′ (the T7 promoter is underlined); reverse primer for HIV RNA transcript (pNL4-3-gag_RP): 5′-GCT TAA TAC CGA CGC TCT C-3′.

    Staining:

    Article Title: Switching the activity of Cas12a using guide RNA strand displacement circuits
    Article Snippet: The RNA was run on an 8 M urea denaturing TBE 12% polyacrylamide (29:1 acrylamide/bis-acrylamide) gel at 120 V for 45 min, stained with SYBR Green II (ThermoFisher), and excised on a UV table. .. The gel slice was then purified using a ZR small-RNA PAGE Recovery kit (Zymo Research) according to the manufacturer’s instructions.

    Article Title: Artificial “ping-pong” cascade of PIWI-interacting RNA in silkworm cells
    Article Snippet: Ten micrograms of total RNA was loaded onto 15% denaturing polyacrylamide gels containing 10 M urea, separated by electrophoresis, and then stained with SYBRGold (Invitrogen). .. Small RNAs were recovered using the ZR small-RNA PAGE Recovery Kit (ZYMO Research).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Zymo Research zr small rna page recovery kit
    Zr Small Rna Page Recovery Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zr small rna page recovery kit/product/Zymo Research
    Average 95 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    zr small rna page recovery kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results