quick rna plus kit  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Quick RNA Miniprep Plus Kit
    Description:
    The Quick RNA Miniprep Plus Kit is an innovative and versatile product designed for the easy reliable and rapid isolation of DNA free RNA from cells all tissue types whole blood and biological fluids The provided DNA RNA Shield stabilizes samples allowing them to be stored without the need for immediate freezing or processing for up to one month Furthermore DNA RNA Shield inactivates RNases as well as microbial pathogens viruses bacteria etc The procedure combines a unique buffer system with Zymo Spin Column technology to yield high quality total RNA including small RNAs 17 200 nt Simply add DNA RNA Shield and Proteinase K to extract total RNA from any tissue then purify the RNA using the Zymo Spin Column The result is highly concentrated DNA free RNA that is suitable for RT PCR hybridization sequencing etc In addition the kit can be used for the enrichment of small and large RNAs in two separate fractions
    Catalog Number:
    r1057t
    Price:
    None
    Applications:
    RNA Purification
    Size:
    50 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research quick rna plus kit
    Quick RNA Miniprep Plus Kit
    The Quick RNA Miniprep Plus Kit is an innovative and versatile product designed for the easy reliable and rapid isolation of DNA free RNA from cells all tissue types whole blood and biological fluids The provided DNA RNA Shield stabilizes samples allowing them to be stored without the need for immediate freezing or processing for up to one month Furthermore DNA RNA Shield inactivates RNases as well as microbial pathogens viruses bacteria etc The procedure combines a unique buffer system with Zymo Spin Column technology to yield high quality total RNA including small RNAs 17 200 nt Simply add DNA RNA Shield and Proteinase K to extract total RNA from any tissue then purify the RNA using the Zymo Spin Column The result is highly concentrated DNA free RNA that is suitable for RT PCR hybridization sequencing etc In addition the kit can be used for the enrichment of small and large RNAs in two separate fractions
    https://www.bioz.com/result/quick rna plus kit/product/Zymo Research
    Average 95 stars, based on 401 article reviews
    Price from $9.99 to $1999.99
    quick rna plus kit - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Evolved Cas9 variants with broad PAM compatibility and high DNA specificity"

    Article Title: Evolved Cas9 variants with broad PAM compatibility and high DNA specificity

    Journal: Nature

    doi: 10.1038/nature26155

    Negative controls lacking guide RNA for nuclease and base editing experiments To verify genomic DNA cleavage and base editing results, the same sites were sequenced after treatment with SpCas9 nuclease, SpCas9-BE3, or SpCas9-ABE but without any sgRNA. a , Indel rates at endogenous target sites 5 days after treatment of HEK293T cells with SpCas9. b , Target C•G to T•A conversion 3 days after treatment of HEK293T cells with SpCas9-BE3. c, Target A•T to G•C base conversion 5 days after treatment of HEK293T cells with SpCas9-ABE. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Complete HTS results across the protospacer are provided in Supplementary Table 14 .
    Figure Legend Snippet: Negative controls lacking guide RNA for nuclease and base editing experiments To verify genomic DNA cleavage and base editing results, the same sites were sequenced after treatment with SpCas9 nuclease, SpCas9-BE3, or SpCas9-ABE but without any sgRNA. a , Indel rates at endogenous target sites 5 days after treatment of HEK293T cells with SpCas9. b , Target C•G to T•A conversion 3 days after treatment of HEK293T cells with SpCas9-BE3. c, Target A•T to G•C base conversion 5 days after treatment of HEK293T cells with SpCas9-ABE. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Complete HTS results across the protospacer are provided in Supplementary Table 14 .

    Techniques Used:

    Transcriptional activation with xCas9 3.7 on all 64 NNN PAM sites and endogenous gene activation in human cells a–d, The transcriptional activator dxCas9(3.7)–VPR was tested on the R1 protospacer ( Extended Data Fig. 3 and Supplementary Table 8 ) with each of the 64 possible NNN PAMs (NAN, NCN, NGN, and NTN) in HEK293T cells. e, Endogenous gene activation was tested using both dSpCas9–VPR and dxCas9(3.7)–VPR to activate expression of the NEUROD1, ASCL1, MIAT, or RHOXF2 at six total sites. RNA expression as measured by RT-qPCR was compared to background expression levels for each gene (measured in the control with no sgRNA) and was normalized to ACTB expression. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Target sites are in Supplementary Table 9 .
    Figure Legend Snippet: Transcriptional activation with xCas9 3.7 on all 64 NNN PAM sites and endogenous gene activation in human cells a–d, The transcriptional activator dxCas9(3.7)–VPR was tested on the R1 protospacer ( Extended Data Fig. 3 and Supplementary Table 8 ) with each of the 64 possible NNN PAMs (NAN, NCN, NGN, and NTN) in HEK293T cells. e, Endogenous gene activation was tested using both dSpCas9–VPR and dxCas9(3.7)–VPR to activate expression of the NEUROD1, ASCL1, MIAT, or RHOXF2 at six total sites. RNA expression as measured by RT-qPCR was compared to background expression levels for each gene (measured in the control with no sgRNA) and was normalized to ACTB expression. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Target sites are in Supplementary Table 9 .

    Techniques Used: Activation Assay, Expressing, RNA Expression, Quantitative RT-PCR

    2) Product Images from "TET enzymes control antibody production and shape the mutational landscape in germinal centre B cells"

    Article Title: TET enzymes control antibody production and shape the mutational landscape in germinal centre B cells

    Journal: The Febs Journal

    doi: 10.1111/febs.14934

    mRNA expression of TET 2 and TET 3 in B cells ex vivo . B‐cell populations were FACS ‐sorted from bone marrow and spleens of 8‐wk‐young wild type mice (Development and Mature; n = 3) or spleens from 9‐wk‐young wild type mice that has been immunized with sheep RBC 7 days before (Antigen activated; n = 3), and RNA was isolated for qRT ‐ PCR analysis for (A) TET 2 and (B) TET 3 expression. HPRT was used as reference gene. Bone marrow: pro B cells, large and small pre B cells and immature IgM + B cells. Spleen: transitional 1 (T1) B cells, transitional 2 (T2) B cells, mature follicular ( FO ) B cells, marginal zone ( MZ ) B cells, germinal centre ( GC ) B cells and plasmablasts/plasma cells ( PC ). GC B cells were further divided into dark zone centroblasts ( CB ) and light zone centrocytes ( CC ). Data are shown as mean ± SD.
    Figure Legend Snippet: mRNA expression of TET 2 and TET 3 in B cells ex vivo . B‐cell populations were FACS ‐sorted from bone marrow and spleens of 8‐wk‐young wild type mice (Development and Mature; n = 3) or spleens from 9‐wk‐young wild type mice that has been immunized with sheep RBC 7 days before (Antigen activated; n = 3), and RNA was isolated for qRT ‐ PCR analysis for (A) TET 2 and (B) TET 3 expression. HPRT was used as reference gene. Bone marrow: pro B cells, large and small pre B cells and immature IgM + B cells. Spleen: transitional 1 (T1) B cells, transitional 2 (T2) B cells, mature follicular ( FO ) B cells, marginal zone ( MZ ) B cells, germinal centre ( GC ) B cells and plasmablasts/plasma cells ( PC ). GC B cells were further divided into dark zone centroblasts ( CB ) and light zone centrocytes ( CC ). Data are shown as mean ± SD.

    Techniques Used: Expressing, Ex Vivo, FACS, Mouse Assay, Isolation, Quantitative RT-PCR

    3) Product Images from "The Cat Flea ( Ctenocephalides felis) Immune Deficiency Signaling Pathway Regulates Rickettsia typhi Infection"

    Article Title: The Cat Flea ( Ctenocephalides felis) Immune Deficiency Signaling Pathway Regulates Rickettsia typhi Infection

    Journal: Infection and Immunity

    doi: 10.1128/IAI.00562-17

    R. typhi elicits an immune response in Drosophila cells. Shown are results of a PCR array analysis of transcripts in uninfected and R. typhi -infected KC167 cells. RNA was extracted from KC167 cells infected with R. typhi for 0 or 4 h, and cDNA was used in the Fruit Fly Signal Transduction PathwayFinder PCR array.
    Figure Legend Snippet: R. typhi elicits an immune response in Drosophila cells. Shown are results of a PCR array analysis of transcripts in uninfected and R. typhi -infected KC167 cells. RNA was extracted from KC167 cells infected with R. typhi for 0 or 4 h, and cDNA was used in the Fruit Fly Signal Transduction PathwayFinder PCR array.

    Techniques Used: Polymerase Chain Reaction, Infection, Transduction

    4) Product Images from "p53 Regulates the Expression of LRP1 and Apoptosis through a Stress Intensity-Dependent MicroRNA Feedback Loop"

    Article Title: p53 Regulates the Expression of LRP1 and Apoptosis through a Stress Intensity-Dependent MicroRNA Feedback Loop

    Journal: Cell reports

    doi: 10.1016/j.celrep.2018.07.010

    Lethal Dox Suppresses LRP1 Protein Translation through the p53-Regulated miRNAs MiR-103 and MiR-107 (A) HCT116 cells were treated with the indicated dose of Dox (nanomolar) for 24 hr, after which RNA was collected and subjected to qRT-PCR analysis. Data represent at least two biological replicates, each performed in triplicate. (B) HCT116 cells were treated with the indicated dose of Dox for 24 hr, after which cells were subjected to ChIP analysis using anti-p53 antibody and non-specific IgG. Data represent at least two biological replicates, each performed in triplicate. (C) HCT116 cells were treated with the indicated stress for 24 hr, after which vehicle, MG132 (MG), or CQ was added to the cells for an additional 8 hr. After MG or CQ treatment, lysates were collected and subjected to western blot analysis. Data represent at least two biological replicates. (D) HCT116 cells were treated with the indicated course of Dox for 24 hr, after which cells were labeled with 35 S-Met/Cys for 30 min, chased with complete DMEM for another 30 min, and then subjected to LRP1 immunoprecipitation. Data represent at least two biological replicates.
    Figure Legend Snippet: Lethal Dox Suppresses LRP1 Protein Translation through the p53-Regulated miRNAs MiR-103 and MiR-107 (A) HCT116 cells were treated with the indicated dose of Dox (nanomolar) for 24 hr, after which RNA was collected and subjected to qRT-PCR analysis. Data represent at least two biological replicates, each performed in triplicate. (B) HCT116 cells were treated with the indicated dose of Dox for 24 hr, after which cells were subjected to ChIP analysis using anti-p53 antibody and non-specific IgG. Data represent at least two biological replicates, each performed in triplicate. (C) HCT116 cells were treated with the indicated stress for 24 hr, after which vehicle, MG132 (MG), or CQ was added to the cells for an additional 8 hr. After MG or CQ treatment, lysates were collected and subjected to western blot analysis. Data represent at least two biological replicates. (D) HCT116 cells were treated with the indicated course of Dox for 24 hr, after which cells were labeled with 35 S-Met/Cys for 30 min, chased with complete DMEM for another 30 min, and then subjected to LRP1 immunoprecipitation. Data represent at least two biological replicates.

    Techniques Used: Quantitative RT-PCR, Chromatin Immunoprecipitation, Western Blot, Labeling, Immunoprecipitation

    5) Product Images from "Evolved Cas9 variants with broad PAM compatibility and high DNA specificity"

    Article Title: Evolved Cas9 variants with broad PAM compatibility and high DNA specificity

    Journal: Nature

    doi: 10.1038/nature26155

    Transcriptional activation with xCas9 3.7 on all 64 NNN PAM sites and endogenous gene activation in human cells a–d, ) with each of the 64 possible NNN PAMs (NAN, NCN, NGN, and NTN) in HEK293T cells. e, Endogenous gene activation was tested using both dSpCas9–VPR and dxCas9(3.7)–VPR to activate expression of the NEUROD1, ASCL1, MIAT, or RHOXF2 at six total sites. RNA expression as measured by RT-qPCR was compared to background expression levels for each gene (measured in the control with no sgRNA) and was normalized to ACTB . Extended Data Fig. 3
    Figure Legend Snippet: Transcriptional activation with xCas9 3.7 on all 64 NNN PAM sites and endogenous gene activation in human cells a–d, ) with each of the 64 possible NNN PAMs (NAN, NCN, NGN, and NTN) in HEK293T cells. e, Endogenous gene activation was tested using both dSpCas9–VPR and dxCas9(3.7)–VPR to activate expression of the NEUROD1, ASCL1, MIAT, or RHOXF2 at six total sites. RNA expression as measured by RT-qPCR was compared to background expression levels for each gene (measured in the control with no sgRNA) and was normalized to ACTB . Extended Data Fig. 3

    Techniques Used: Activation Assay, Expressing, RNA Expression, Quantitative RT-PCR

    Negative controls lacking guide RNA for nuclease and base editing experiments To verify genomic DNA cleavage and base editing results, the same sites were sequenced after treatment with SpCas9 nuclease, SpCas9-BE3, or SpCas9-ABE but without any sgRNA. a , Indel rates at endogenous target sites 5 days after treatment of HEK293T cells with SpCas9. b , Target C•G to T•A conversion 3 days after treatment of HEK293T cells with SpCas9-BE3. c, .
    Figure Legend Snippet: Negative controls lacking guide RNA for nuclease and base editing experiments To verify genomic DNA cleavage and base editing results, the same sites were sequenced after treatment with SpCas9 nuclease, SpCas9-BE3, or SpCas9-ABE but without any sgRNA. a , Indel rates at endogenous target sites 5 days after treatment of HEK293T cells with SpCas9. b , Target C•G to T•A conversion 3 days after treatment of HEK293T cells with SpCas9-BE3. c, .

    Techniques Used:

    Related Articles

    Clone Assay:

    Article Title: HEK293T cell lines defective for O-linked glycosylation
    Article Snippet: 2.7 Sequencing RNA was purified from mutant cell lines using the Quick-RNA Miniprep Plus Kit (Zymo Research). .. Bands of the correct length were gel purified using the Zymo Gel DNA Recovery Kit (Zymo Research) and blunt-end ligated into a sequencing vector using the Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher).

    Amplification:

    Article Title: HEK293T cell lines defective for O-linked glycosylation
    Article Snippet: 2.7 Sequencing RNA was purified from mutant cell lines using the Quick-RNA Miniprep Plus Kit (Zymo Research). .. Genes of interested were PCR amplified from cDNA using gene specific primers designed to flank areas just outside target gRNA sites and the Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Fisher) according to manufacturer’s specified protocol.

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: Wild-type DFNA5 exon 8 (193 base pairs) plus 88 and 83 nucleotides from the 3′ and 5′ flanking sequences, respectively, was PCR amplified with gene-specific primers that contained either Sall or SacII restriction enzyme sites. .. Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol.

    Positive Control:

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol. .. As positive control and negative controls, the previously described c.991-2A > G mutation and the snp rs138980048:G > A was used to test and confirm the functionality of the designed mini-gene, respectively.

    Synthesized:

    Article Title: Characterization of the endogenous retrovirus insertion in CYP19A1 associated with henny feathering in chicken
    Article Snippet: Quantitative real-time RT-PCR Total RNA was extracted using Quick-RNA Miniprep Plus Kit (Zymo Research). .. First-strand cDNA was synthesized using SuperScript™ IV VILO™ Master Mix (Invitrogen). qPCRs were conducted with PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) according to the manufacturer’s protocol.

    Article Title: HEK293T cell lines defective for O-linked glycosylation
    Article Snippet: 2.7 Sequencing RNA was purified from mutant cell lines using the Quick-RNA Miniprep Plus Kit (Zymo Research). .. First-strand complementary DNA (cDNA) was synthesized by priming with oligo-DT and reverse transcribed using the Super Script IV Reverse Transcriptase (Thermo Fisher) according to manufacturer’s specified protocol.

    Quantitative RT-PCR:

    Article Title: Arylfluorosulfates Inactivate Intracellular Lipid Binding Protein(s) through Chemoselective SuFEx Reaction with a Binding-site Tyr Residue
    Article Snippet: Paragraph title: Quantitative RT-PCR (qPCR) ... Cells were treated with retinoic acid (100 nM) and compound 4 as described at 37 °C, washed with Dulbecco’s phosphate-buffered saline, and RNA was extracted using the Quick-RNA MiniPrep Plus Kit (Zymo Research). qPCR reactions were performed on cDNA prepared from 500 ng of total cellular RNA using the QuantiTect Reverse Transcription Kit (Qiagen).

    Article Title: Hypoxia potentiates monocyte-derived dendritic cells for release of tumor necrosis factor α via MAP3K8
    Article Snippet: Expression levels were quantitated with real-time quantitative PCR (RT-qPCR) using validated primers for MAP3K8 (GAGCGTTCTAAGTCTCTGCTG and GCAAGCAAATCCTCCACAGTTC), TBP (GAGCCAAGAGTGAAGAACAGTC and GCTCCCCACCATATTCTGAATCT) and GUSB (GACACGCTAGAGCATGAGGG and GGGTGAGTGTGTTGTTGATGG). .. Briefly, mRNA was isolated from DCs using a Quick-RNA MiniPrep Plus kit (Zymo Research, Irvine, U.S.A.) and cDNA was generated in a standard reverse transcriptase reaction. qPCRs were done on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, U.S.A.), using FastStart SYBR Green Master mix (Hoffmann-La Roche, Basel, Switzerland) and analyzed in CFX Manager software version 3.1 (Bio-Rad, Hercules, U.S.A.).

    Article Title: CNS-Wide over Expression of Fractalkine Improves Cognitive Functioning in a Tauopathy Model
    Article Snippet: RNA Isolation and Real-Time PCR RNA was isolated from posterior cortex using the Zymo Quick-RNA Miniprep Plus kit (Zymo Research, Irvine, CA, USA; cat. no. R1057) per the manufacturer’s recommended protocol. .. EXPRESS One-Step Superscript qRT-PCR Kit (cat. no. 11718200) and TaqMan Gene Expression Assays were purchased from ThermoFisher (Walthman, MA, USA).

    Article Title: Characterization of the endogenous retrovirus insertion in CYP19A1 associated with henny feathering in chicken
    Article Snippet: .. Quantitative real-time RT-PCR Total RNA was extracted using Quick-RNA Miniprep Plus Kit (Zymo Research). .. First-strand cDNA was synthesized using SuperScript™ IV VILO™ Master Mix (Invitrogen). qPCRs were conducted with PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) according to the manufacturer’s protocol.

    SYBR Green Assay:

    Article Title: Arylfluorosulfates Inactivate Intracellular Lipid Binding Protein(s) through Chemoselective SuFEx Reaction with a Binding-site Tyr Residue
    Article Snippet: Cells were treated with retinoic acid (100 nM) and compound 4 as described at 37 °C, washed with Dulbecco’s phosphate-buffered saline, and RNA was extracted using the Quick-RNA MiniPrep Plus Kit (Zymo Research). qPCR reactions were performed on cDNA prepared from 500 ng of total cellular RNA using the QuantiTect Reverse Transcription Kit (Qiagen). .. The 2× Fast SYBR Green qPCR Master Mix (Biotool), cDNA, and appropriate human primers ( CRBP1 ; ctccagtcactccccgaaat and cgtcctgcacgatctctttg; FABP5 : tggccaagccagattgtatc and ctgccatcagctgtggtttc, CRABP2 : caaggttggggaggagtttg and gttccccatcgttggtcagt) purchased from Integrated DNA Technologies were used for amplifications (5 min at 50 °C, 6 min at 95 °C, followed by 45 cycles of 15 s at 95 °C, 1 min at 60 °C) in an ABI 7900HT Fast Real Time PCR machine.

    Article Title: Hypoxia potentiates monocyte-derived dendritic cells for release of tumor necrosis factor α via MAP3K8
    Article Snippet: .. Briefly, mRNA was isolated from DCs using a Quick-RNA MiniPrep Plus kit (Zymo Research, Irvine, U.S.A.) and cDNA was generated in a standard reverse transcriptase reaction. qPCRs were done on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, U.S.A.), using FastStart SYBR Green Master mix (Hoffmann-La Roche, Basel, Switzerland) and analyzed in CFX Manager software version 3.1 (Bio-Rad, Hercules, U.S.A.). .. Gene expression was first normalized (ΔΔCq) to housekeeping genes ( TBP and GUSB ) validated with geNorm analysis, followed by normalization to untreated samples.

    Article Title: Characterization of the endogenous retrovirus insertion in CYP19A1 associated with henny feathering in chicken
    Article Snippet: Quantitative real-time RT-PCR Total RNA was extracted using Quick-RNA Miniprep Plus Kit (Zymo Research). .. First-strand cDNA was synthesized using SuperScript™ IV VILO™ Master Mix (Invitrogen). qPCRs were conducted with PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) according to the manufacturer’s protocol.

    Expressing:

    Article Title: MnTE-2-PyP Treatment, or NOX4 Inhibition, Protects against Radiation-Induced Damage in Mouse Primary Prostate Fibroblasts by Inhibiting the TGF-Beta 1 Signaling Pathway
    Article Snippet: Paragraph title: Profibrotic Gene Expression PCR Array ... At 24 h postirradiation, cells were harvested and washed two times with 1× PBS, and total cellular RNA was then isolated using Quick-RNA™ MiniPrep (Plus) kit (Zymo Research Corp., Irvine, CA) following the manufacturer's protocol.

    Article Title: Hypoxia potentiates monocyte-derived dendritic cells for release of tumor necrosis factor α via MAP3K8
    Article Snippet: Expression levels were quantitated with real-time quantitative PCR (RT-qPCR) using validated primers for MAP3K8 (GAGCGTTCTAAGTCTCTGCTG and GCAAGCAAATCCTCCACAGTTC), TBP (GAGCCAAGAGTGAAGAACAGTC and GCTCCCCACCATATTCTGAATCT) and GUSB (GACACGCTAGAGCATGAGGG and GGGTGAGTGTGTTGTTGATGG). .. Briefly, mRNA was isolated from DCs using a Quick-RNA MiniPrep Plus kit (Zymo Research, Irvine, U.S.A.) and cDNA was generated in a standard reverse transcriptase reaction. qPCRs were done on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, U.S.A.), using FastStart SYBR Green Master mix (Hoffmann-La Roche, Basel, Switzerland) and analyzed in CFX Manager software version 3.1 (Bio-Rad, Hercules, U.S.A.).

    Article Title: CNS-Wide over Expression of Fractalkine Improves Cognitive Functioning in a Tauopathy Model
    Article Snippet: RNA Isolation and Real-Time PCR RNA was isolated from posterior cortex using the Zymo Quick-RNA Miniprep Plus kit (Zymo Research, Irvine, CA, USA; cat. no. R1057) per the manufacturer’s recommended protocol. .. EXPRESS One-Step Superscript qRT-PCR Kit (cat. no. 11718200) and TaqMan Gene Expression Assays were purchased from ThermoFisher (Walthman, MA, USA).

    Transfection:

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: .. Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol. .. PCR amplification followed using primers specific to the 5′ and 3′ native exons of the pET01 vector and products were visualized on a 1.5% agarose gel.

    Northern Blot:

    Article Title: Non-specific degradation of transcripts promotes plasmid clearance during type III-A CRISPR-Cas immunity
    Article Snippet: RNA was then purified using Quick-RNA Miniprep Plus Kit (Zymo research). .. For Northern blot analysis, 80 ml of OD 0.15 S. aureus RN4220 cells were spun down and lysed as above.

    Cell Culture:

    Article Title: Arylfluorosulfates Inactivate Intracellular Lipid Binding Protein(s) through Chemoselective SuFEx Reaction with a Binding-site Tyr Residue
    Article Snippet: MCF-7 cells were cultured in DMEM supplemented with charcoal-treated fetal bovine serum (FBS), 1% glutamine, 1% sodium pyruvate, 1% non-essential amino acids, 1% HEPES, 10 µg/ml Insulin and 1% penicillin/streptomycin. .. Cells were treated with retinoic acid (100 nM) and compound 4 as described at 37 °C, washed with Dulbecco’s phosphate-buffered saline, and RNA was extracted using the Quick-RNA MiniPrep Plus Kit (Zymo Research). qPCR reactions were performed on cDNA prepared from 500 ng of total cellular RNA using the QuantiTect Reverse Transcription Kit (Qiagen).

    Article Title: A Short Protocol for Gene Knockout and Complementation in Xylella fastidiosa Shows that One of the Type IV Pilin Paralogs (PD1926) Is Needed for Twitching while Another (PD1924) Affects Pilus Number and Location
    Article Snippet: Wild-type X. fastidiosa TemeculaL, WM1-1, or mutant cells cultured in PW plates were scraped and adjusted to an OD600 of 0.25 as previously mentioned. .. Pellet formed was suspended in 200 μl of DNA/RNA Shield (Zymo Research), and RNA was extracted using a Quick-RNA MiniPrep Plus kit (Zymo Research), using in-column DNase treatment following the manufacturers' protocol.

    Generated:

    Article Title: Hypoxia potentiates monocyte-derived dendritic cells for release of tumor necrosis factor α via MAP3K8
    Article Snippet: .. Briefly, mRNA was isolated from DCs using a Quick-RNA MiniPrep Plus kit (Zymo Research, Irvine, U.S.A.) and cDNA was generated in a standard reverse transcriptase reaction. qPCRs were done on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, U.S.A.), using FastStart SYBR Green Master mix (Hoffmann-La Roche, Basel, Switzerland) and analyzed in CFX Manager software version 3.1 (Bio-Rad, Hercules, U.S.A.). .. Gene expression was first normalized (ΔΔCq) to housekeeping genes ( TBP and GUSB ) validated with geNorm analysis, followed by normalization to untreated samples.

    Article Title: TBK1 suppresses RIPK1-driven apoptosis and inflammation during development and in aging
    Article Snippet: RNA was isolated from primary microglia in culture using Quick™-RNA MiniPrep Plus kit (Zymo Research) with 3 replicates for each genotype. .. Double-stranded cDNA was generated for library construction with 12 cycles of PCR and 0.3 ng of cDNA was used as input to the NexteraXT kit (Illumina).

    Sequencing:

    Article Title: Overlap of Promoter Recognition Specificity of Stress Response Sigma Factors SigD and SigH in Corynebacterium glutamicum ATCC 13032
    Article Snippet: Paragraph title: RNA Isolation, cDNA Library Preparation and Sequencing ... Total RNA was isolated from 3 biological replicates of C. glutamicum cells grown to the exponential phase using a Quick-RNA Miniprep Plus kit according to the manufacturer’s instructions (Zymo Research).

    Article Title: HEK293T cell lines defective for O-linked glycosylation
    Article Snippet: .. 2.7 Sequencing RNA was purified from mutant cell lines using the Quick-RNA Miniprep Plus Kit (Zymo Research). .. First-strand complementary DNA (cDNA) was synthesized by priming with oligo-DT and reverse transcribed using the Super Script IV Reverse Transcriptase (Thermo Fisher) according to manufacturer’s specified protocol.

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: Mutations were then introduced into the wild-type sequence using QuikChange Lightning Site-Directed Mutagenesis (Agilent) according to the manufacture’s protocols. .. Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol.

    RNA Sequencing Assay:

    Article Title: Non-specific degradation of transcripts promotes plasmid clearance during type III-A CRISPR-Cas immunity
    Article Snippet: For the Csm6 targeting RNA-seq, 2.5 μg of Listeria seeligeri RNA was added at this stage. .. RNA was then purified using Quick-RNA Miniprep Plus Kit (Zymo research).

    Article Title: TBK1 suppresses RIPK1-driven apoptosis and inflammation during development and in aging
    Article Snippet: Paragraph title: RNA-seq ... RNA was isolated from primary microglia in culture using Quick™-RNA MiniPrep Plus kit (Zymo Research) with 3 replicates for each genotype.

    Irradiation:

    Article Title: MnTE-2-PyP Treatment, or NOX4 Inhibition, Protects against Radiation-Induced Damage in Mouse Primary Prostate Fibroblasts by Inhibiting the TGF-Beta 1 Signaling Pathway
    Article Snippet: The following day, cells were either sham irradiated or 2 Gy X-ray irradiated. .. At 24 h postirradiation, cells were harvested and washed two times with 1× PBS, and total cellular RNA was then isolated using Quick-RNA™ MiniPrep (Plus) kit (Zymo Research Corp., Irvine, CA) following the manufacturer's protocol.

    Mutagenesis:

    Article Title: A Short Protocol for Gene Knockout and Complementation in Xylella fastidiosa Shows that One of the Type IV Pilin Paralogs (PD1926) Is Needed for Twitching while Another (PD1924) Affects Pilus Number and Location
    Article Snippet: Wild-type X. fastidiosa TemeculaL, WM1-1, or mutant cells cultured in PW plates were scraped and adjusted to an OD600 of 0.25 as previously mentioned. .. Pellet formed was suspended in 200 μl of DNA/RNA Shield (Zymo Research), and RNA was extracted using a Quick-RNA MiniPrep Plus kit (Zymo Research), using in-column DNase treatment following the manufacturers' protocol.

    Article Title: HEK293T cell lines defective for O-linked glycosylation
    Article Snippet: .. 2.7 Sequencing RNA was purified from mutant cell lines using the Quick-RNA Miniprep Plus Kit (Zymo Research). .. First-strand complementary DNA (cDNA) was synthesized by priming with oligo-DT and reverse transcribed using the Super Script IV Reverse Transcriptase (Thermo Fisher) according to manufacturer’s specified protocol.

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: Wild-type or mutant mini-genes were transfected in triplicates into COS7 cells using TransIT-LT1 Transfection Reagent (Mirus). .. Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol.

    Isolation:

    Article Title: MnTE-2-PyP Treatment, or NOX4 Inhibition, Protects against Radiation-Induced Damage in Mouse Primary Prostate Fibroblasts by Inhibiting the TGF-Beta 1 Signaling Pathway
    Article Snippet: .. At 24 h postirradiation, cells were harvested and washed two times with 1× PBS, and total cellular RNA was then isolated using Quick-RNA™ MiniPrep (Plus) kit (Zymo Research Corp., Irvine, CA) following the manufacturer's protocol. .. Concentration and quality of total RNA were measured with Infinite® M200 PRO plate reader (Tecan® , Männedorf, Switzerland).

    Article Title: Non-specific degradation of transcripts promotes plasmid clearance during type III-A CRISPR-Cas immunity
    Article Snippet: RNA was then purified using Quick-RNA Miniprep Plus Kit (Zymo research). .. The RNA was then isolated by resuspending the lysed cells in Trizol (Thermo Fisher Scientific), and following the Trizol manufacturer’s protocol.

    Article Title: Hypoxia potentiates monocyte-derived dendritic cells for release of tumor necrosis factor α via MAP3K8
    Article Snippet: .. Briefly, mRNA was isolated from DCs using a Quick-RNA MiniPrep Plus kit (Zymo Research, Irvine, U.S.A.) and cDNA was generated in a standard reverse transcriptase reaction. qPCRs were done on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, U.S.A.), using FastStart SYBR Green Master mix (Hoffmann-La Roche, Basel, Switzerland) and analyzed in CFX Manager software version 3.1 (Bio-Rad, Hercules, U.S.A.). .. Gene expression was first normalized (ΔΔCq) to housekeeping genes ( TBP and GUSB ) validated with geNorm analysis, followed by normalization to untreated samples.

    Article Title: RNA-seq of spinal cord from nerve-injured rats after spinal cord stimulation
    Article Snippet: Paragraph title: RNA isolation ... Total RNA was extracted from the ipsilateral spinal cord with the Quick-RNA MiniPrep Plus kit (Zymo, Irvine, CA) according to manufacturer instructions with on-column DNase I digestion.

    Article Title: CNS-Wide over Expression of Fractalkine Improves Cognitive Functioning in a Tauopathy Model
    Article Snippet: .. RNA Isolation and Real-Time PCR RNA was isolated from posterior cortex using the Zymo Quick-RNA Miniprep Plus kit (Zymo Research, Irvine, CA, USA; cat. no. R1057) per the manufacturer’s recommended protocol. .. EXPRESS One-Step Superscript qRT-PCR Kit (cat. no. 11718200) and TaqMan Gene Expression Assays were purchased from ThermoFisher (Walthman, MA, USA).

    Article Title: Overlap of Promoter Recognition Specificity of Stress Response Sigma Factors SigD and SigH in Corynebacterium glutamicum ATCC 13032
    Article Snippet: .. Total RNA was isolated from 3 biological replicates of C. glutamicum cells grown to the exponential phase using a Quick-RNA Miniprep Plus kit according to the manufacturer’s instructions (Zymo Research). .. After additional DNase treatment, RNA samples were purified with an RNA Clean & Concentrator-5 kit (Zymo Research) and quantified with a DropSense 16 (Trinean).

    Article Title: TBK1 suppresses RIPK1-driven apoptosis and inflammation during development and in aging
    Article Snippet: .. RNA was isolated from primary microglia in culture using Quick™-RNA MiniPrep Plus kit (Zymo Research) with 3 replicates for each genotype. ..

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: .. Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol. .. PCR amplification followed using primers specific to the 5′ and 3′ native exons of the pET01 vector and products were visualized on a 1.5% agarose gel.

    Article Title: Efficient gene correction of an aberrant splice site in β‐thalassaemia iPSCs by CRISPR/Cas9 and single‐strand oligodeoxynucleotides, et al. Efficient gene correction of an aberrant splice site in β‐thalassaemia iPSCs by CRISPR/Cas9 and single‐strand oligodeoxynucleotides
    Article Snippet: .. 2.3 Quantitative polymerase chain reaction analysis Total RNA from iPSCs was extracted using Quick‐RNA MiniPrep Plus Kit (Zymo Research), and total RNA from differentiated hematopoietic cells at day 22 was isolated via RNeasy Micro Kit (Qiagen) following the manufacturer's instructions. .. We acquired cDNA utilizing PrimeScript RT reagent Kit with gDNA Eraser (Takara) according to the manufacturer's instructions.

    Multiplex Assay:

    Article Title: A Short Protocol for Gene Knockout and Complementation in Xylella fastidiosa Shows that One of the Type IV Pilin Paralogs (PD1926) Is Needed for Twitching while Another (PD1924) Affects Pilus Number and Location
    Article Snippet: Pellet formed was suspended in 200 μl of DNA/RNA Shield (Zymo Research), and RNA was extracted using a Quick-RNA MiniPrep Plus kit (Zymo Research), using in-column DNase treatment following the manufacturers' protocol. .. Quantitative PCR was performed using 1 μl of cDNA in 20 μl volume containing 4 μl of 5× PerfeCTa multiplex quantitative PCR (qPCR) ToughMix (Quantabio), 0.4 μM forward and reverse primers, and 0.2 μM TaqMan probe (labeled with 5′ 6-carboxyfluorescein [FAM] and 3′ Black Hole 588 Quencher-1 [BHQ-1]).

    Labeling:

    Article Title: A Short Protocol for Gene Knockout and Complementation in Xylella fastidiosa Shows that One of the Type IV Pilin Paralogs (PD1926) Is Needed for Twitching while Another (PD1924) Affects Pilus Number and Location
    Article Snippet: Pellet formed was suspended in 200 μl of DNA/RNA Shield (Zymo Research), and RNA was extracted using a Quick-RNA MiniPrep Plus kit (Zymo Research), using in-column DNase treatment following the manufacturers' protocol. .. Quantitative PCR was performed using 1 μl of cDNA in 20 μl volume containing 4 μl of 5× PerfeCTa multiplex quantitative PCR (qPCR) ToughMix (Quantabio), 0.4 μM forward and reverse primers, and 0.2 μM TaqMan probe (labeled with 5′ 6-carboxyfluorescein [FAM] and 3′ Black Hole 588 Quencher-1 [BHQ-1]).

    Purification:

    Article Title: Non-specific degradation of transcripts promotes plasmid clearance during type III-A CRISPR-Cas immunity
    Article Snippet: .. RNA was then purified using Quick-RNA Miniprep Plus Kit (Zymo research). .. For Northern blot analysis, 80 ml of OD 0.15 S. aureus RN4220 cells were spun down and lysed as above.

    Article Title: Selection of stable reference genes for RT-qPCR in Rhodococcus opacus PD630
    Article Snippet: RNA extraction and cDNA synthesis RNA was extracted from the triplicate biological samples stored at −80 °C in the DNA/RNA Shield using the Quick-RNA MiniPrep Plus kit (Zymo Research), per the instructions. .. All samples were treated with the TURBO DNA-free kit (Ambion) to remove any gDNA present in the samples and then purified using the RNA Clean and Concentrator kit (Zymo Research).

    Article Title: Overlap of Promoter Recognition Specificity of Stress Response Sigma Factors SigD and SigH in Corynebacterium glutamicum ATCC 13032
    Article Snippet: Total RNA was isolated from 3 biological replicates of C. glutamicum cells grown to the exponential phase using a Quick-RNA Miniprep Plus kit according to the manufacturer’s instructions (Zymo Research). .. After additional DNase treatment, RNA samples were purified with an RNA Clean & Concentrator-5 kit (Zymo Research) and quantified with a DropSense 16 (Trinean).

    Article Title: HEK293T cell lines defective for O-linked glycosylation
    Article Snippet: .. 2.7 Sequencing RNA was purified from mutant cell lines using the Quick-RNA Miniprep Plus Kit (Zymo Research). .. First-strand complementary DNA (cDNA) was synthesized by priming with oligo-DT and reverse transcribed using the Super Script IV Reverse Transcriptase (Thermo Fisher) according to manufacturer’s specified protocol.

    Polymerase Chain Reaction:

    Article Title: MnTE-2-PyP Treatment, or NOX4 Inhibition, Protects against Radiation-Induced Damage in Mouse Primary Prostate Fibroblasts by Inhibiting the TGF-Beta 1 Signaling Pathway
    Article Snippet: Paragraph title: Profibrotic Gene Expression PCR Array ... At 24 h postirradiation, cells were harvested and washed two times with 1× PBS, and total cellular RNA was then isolated using Quick-RNA™ MiniPrep (Plus) kit (Zymo Research Corp., Irvine, CA) following the manufacturer's protocol.

    Article Title: Hypoxia potentiates monocyte-derived dendritic cells for release of tumor necrosis factor α via MAP3K8
    Article Snippet: MAP3K8 expression in untreated moDCs was checked with PCR on cDNA using primers for MAP3K8 (CTCCCCAAAATGGACGTTACC and GGATTTCCACATCAGATGGCTTA). .. Briefly, mRNA was isolated from DCs using a Quick-RNA MiniPrep Plus kit (Zymo Research, Irvine, U.S.A.) and cDNA was generated in a standard reverse transcriptase reaction. qPCRs were done on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, U.S.A.), using FastStart SYBR Green Master mix (Hoffmann-La Roche, Basel, Switzerland) and analyzed in CFX Manager software version 3.1 (Bio-Rad, Hercules, U.S.A.).

    Article Title: Selection of stable reference genes for RT-qPCR in Rhodococcus opacus PD630
    Article Snippet: RNA extraction and cDNA synthesis RNA was extracted from the triplicate biological samples stored at −80 °C in the DNA/RNA Shield using the Quick-RNA MiniPrep Plus kit (Zymo Research), per the instructions. .. To confirm that all gDNA was depleted, PCR was performed by using the previously described GoTaq protocol with primers targeting the genome.

    Article Title: HEK293T cell lines defective for O-linked glycosylation
    Article Snippet: 2.7 Sequencing RNA was purified from mutant cell lines using the Quick-RNA Miniprep Plus Kit (Zymo Research). .. Genes of interested were PCR amplified from cDNA using gene specific primers designed to flank areas just outside target gRNA sites and the Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Fisher) according to manufacturer’s specified protocol.

    Article Title: TBK1 suppresses RIPK1-driven apoptosis and inflammation during development and in aging
    Article Snippet: RNA was isolated from primary microglia in culture using Quick™-RNA MiniPrep Plus kit (Zymo Research) with 3 replicates for each genotype. .. Double-stranded cDNA was generated for library construction with 12 cycles of PCR and 0.3 ng of cDNA was used as input to the NexteraXT kit (Illumina).

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: After restriction enzyme digestion, the PCR fragment was ligated into the pET01 vector and sequenced confirmed. .. Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol.

    Construct:

    Article Title: Overlap of Promoter Recognition Specificity of Stress Response Sigma Factors SigD and SigH in Corynebacterium glutamicum ATCC 13032
    Article Snippet: Total RNA was isolated from 3 biological replicates of C. glutamicum cells grown to the exponential phase using a Quick-RNA Miniprep Plus kit according to the manufacturer’s instructions (Zymo Research). .. To construct the whole transcriptome cDNA library, 2.5 μg total RNA (RIN > 9) was used for the depletion of rRNA with a Ribo-Zero rRNA Removal Kit (Bacteria) according to manufacturer’s instructions (Illumina).

    cDNA Library Assay:

    Article Title: Overlap of Promoter Recognition Specificity of Stress Response Sigma Factors SigD and SigH in Corynebacterium glutamicum ATCC 13032
    Article Snippet: Paragraph title: RNA Isolation, cDNA Library Preparation and Sequencing ... Total RNA was isolated from 3 biological replicates of C. glutamicum cells grown to the exponential phase using a Quick-RNA Miniprep Plus kit according to the manufacturer’s instructions (Zymo Research).

    Plasmid Preparation:

    Article Title: Non-specific degradation of transcripts promotes plasmid clearance during type III-A CRISPR-Cas immunity
    Article Snippet: RNA purification For isolating RNA for pG0400/pG0420 RNA-seq, 5ml of S. aureus RN4220 cells at OD 0.6 containing the relevant plasmid were spun down. .. RNA was then purified using Quick-RNA Miniprep Plus Kit (Zymo research).

    Article Title: HEK293T cell lines defective for O-linked glycosylation
    Article Snippet: 2.7 Sequencing RNA was purified from mutant cell lines using the Quick-RNA Miniprep Plus Kit (Zymo Research). .. Bands of the correct length were gel purified using the Zymo Gel DNA Recovery Kit (Zymo Research) and blunt-end ligated into a sequencing vector using the Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher).

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: .. Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol. .. PCR amplification followed using primers specific to the 5′ and 3′ native exons of the pET01 vector and products were visualized on a 1.5% agarose gel.

    Software:

    Article Title: Arylfluorosulfates Inactivate Intracellular Lipid Binding Protein(s) through Chemoselective SuFEx Reaction with a Binding-site Tyr Residue
    Article Snippet: Cells were treated with retinoic acid (100 nM) and compound 4 as described at 37 °C, washed with Dulbecco’s phosphate-buffered saline, and RNA was extracted using the Quick-RNA MiniPrep Plus Kit (Zymo Research). qPCR reactions were performed on cDNA prepared from 500 ng of total cellular RNA using the QuantiTect Reverse Transcription Kit (Qiagen). .. Data were analyzed using the RQ Manager and DataAssist 2.0 software packages (ABI).

    Article Title: Hypoxia potentiates monocyte-derived dendritic cells for release of tumor necrosis factor α via MAP3K8
    Article Snippet: .. Briefly, mRNA was isolated from DCs using a Quick-RNA MiniPrep Plus kit (Zymo Research, Irvine, U.S.A.) and cDNA was generated in a standard reverse transcriptase reaction. qPCRs were done on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, U.S.A.), using FastStart SYBR Green Master mix (Hoffmann-La Roche, Basel, Switzerland) and analyzed in CFX Manager software version 3.1 (Bio-Rad, Hercules, U.S.A.). .. Gene expression was first normalized (ΔΔCq) to housekeeping genes ( TBP and GUSB ) validated with geNorm analysis, followed by normalization to untreated samples.

    Real-time Polymerase Chain Reaction:

    Article Title: Arylfluorosulfates Inactivate Intracellular Lipid Binding Protein(s) through Chemoselective SuFEx Reaction with a Binding-site Tyr Residue
    Article Snippet: .. Cells were treated with retinoic acid (100 nM) and compound 4 as described at 37 °C, washed with Dulbecco’s phosphate-buffered saline, and RNA was extracted using the Quick-RNA MiniPrep Plus Kit (Zymo Research). qPCR reactions were performed on cDNA prepared from 500 ng of total cellular RNA using the QuantiTect Reverse Transcription Kit (Qiagen). .. The 2× Fast SYBR Green qPCR Master Mix (Biotool), cDNA, and appropriate human primers ( CRBP1 ; ctccagtcactccccgaaat and cgtcctgcacgatctctttg; FABP5 : tggccaagccagattgtatc and ctgccatcagctgtggtttc, CRABP2 : caaggttggggaggagtttg and gttccccatcgttggtcagt) purchased from Integrated DNA Technologies were used for amplifications (5 min at 50 °C, 6 min at 95 °C, followed by 45 cycles of 15 s at 95 °C, 1 min at 60 °C) in an ABI 7900HT Fast Real Time PCR machine.

    Article Title: A Short Protocol for Gene Knockout and Complementation in Xylella fastidiosa Shows that One of the Type IV Pilin Paralogs (PD1926) Is Needed for Twitching while Another (PD1924) Affects Pilus Number and Location
    Article Snippet: Paragraph title: RNA preparation and quantitative PCR. ... Pellet formed was suspended in 200 μl of DNA/RNA Shield (Zymo Research), and RNA was extracted using a Quick-RNA MiniPrep Plus kit (Zymo Research), using in-column DNase treatment following the manufacturers' protocol.

    Article Title: Hypoxia potentiates monocyte-derived dendritic cells for release of tumor necrosis factor α via MAP3K8
    Article Snippet: .. Briefly, mRNA was isolated from DCs using a Quick-RNA MiniPrep Plus kit (Zymo Research, Irvine, U.S.A.) and cDNA was generated in a standard reverse transcriptase reaction. qPCRs were done on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, U.S.A.), using FastStart SYBR Green Master mix (Hoffmann-La Roche, Basel, Switzerland) and analyzed in CFX Manager software version 3.1 (Bio-Rad, Hercules, U.S.A.). .. Gene expression was first normalized (ΔΔCq) to housekeeping genes ( TBP and GUSB ) validated with geNorm analysis, followed by normalization to untreated samples.

    Article Title: CNS-Wide over Expression of Fractalkine Improves Cognitive Functioning in a Tauopathy Model
    Article Snippet: .. RNA Isolation and Real-Time PCR RNA was isolated from posterior cortex using the Zymo Quick-RNA Miniprep Plus kit (Zymo Research, Irvine, CA, USA; cat. no. R1057) per the manufacturer’s recommended protocol. .. EXPRESS One-Step Superscript qRT-PCR Kit (cat. no. 11718200) and TaqMan Gene Expression Assays were purchased from ThermoFisher (Walthman, MA, USA).

    Article Title: Efficient gene correction of an aberrant splice site in β‐thalassaemia iPSCs by CRISPR/Cas9 and single‐strand oligodeoxynucleotides, et al. Efficient gene correction of an aberrant splice site in β‐thalassaemia iPSCs by CRISPR/Cas9 and single‐strand oligodeoxynucleotides
    Article Snippet: .. 2.3 Quantitative polymerase chain reaction analysis Total RNA from iPSCs was extracted using Quick‐RNA MiniPrep Plus Kit (Zymo Research), and total RNA from differentiated hematopoietic cells at day 22 was isolated via RNeasy Micro Kit (Qiagen) following the manufacturer's instructions. .. We acquired cDNA utilizing PrimeScript RT reagent Kit with gDNA Eraser (Takara) according to the manufacturer's instructions.

    RNA Extraction:

    Article Title: Selection of stable reference genes for RT-qPCR in Rhodococcus opacus PD630
    Article Snippet: .. RNA extraction and cDNA synthesis RNA was extracted from the triplicate biological samples stored at −80 °C in the DNA/RNA Shield using the Quick-RNA MiniPrep Plus kit (Zymo Research), per the instructions. .. The optional ZR BashingBead Lysis Tubes (0.1 and 0.5 mm beads; Zymo Research) were used to lyse the cells.

    Agarose Gel Electrophoresis:

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol. .. PCR amplification followed using primers specific to the 5′ and 3′ native exons of the pET01 vector and products were visualized on a 1.5% agarose gel.

    In Vitro:

    Article Title: Exonic mutations and exon skipping: lessons learned from DFNA5
    Article Snippet: Paragraph title: In vitro splicing analysis ... Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research). cDNA was transcribed using 750ng of isolated RNA SuperScript™ III Reverse Transcriptase (ThermoFisher Scientific) using a primer specific to the 3′ native exon of the pET01 vector according to manufacture protocol.

    Spectrophotometry:

    Article Title: A Short Protocol for Gene Knockout and Complementation in Xylella fastidiosa Shows that One of the Type IV Pilin Paralogs (PD1926) Is Needed for Twitching while Another (PD1924) Affects Pilus Number and Location
    Article Snippet: Pellet formed was suspended in 200 μl of DNA/RNA Shield (Zymo Research), and RNA was extracted using a Quick-RNA MiniPrep Plus kit (Zymo Research), using in-column DNase treatment following the manufacturers' protocol. .. RNA concentration was measured by a NanoDrop 2000 spectrophotometer (Thermo Scientific). cDNA was prepared using qScript cDNA SuperMix (Quantabio) with 170 ng of normalized RNA in 20 μl volume.

    Concentration Assay:

    Article Title: MnTE-2-PyP Treatment, or NOX4 Inhibition, Protects against Radiation-Induced Damage in Mouse Primary Prostate Fibroblasts by Inhibiting the TGF-Beta 1 Signaling Pathway
    Article Snippet: At 24 h postirradiation, cells were harvested and washed two times with 1× PBS, and total cellular RNA was then isolated using Quick-RNA™ MiniPrep (Plus) kit (Zymo Research Corp., Irvine, CA) following the manufacturer's protocol. .. Concentration and quality of total RNA were measured with Infinite® M200 PRO plate reader (Tecan® , Männedorf, Switzerland).

    Article Title: A Short Protocol for Gene Knockout and Complementation in Xylella fastidiosa Shows that One of the Type IV Pilin Paralogs (PD1926) Is Needed for Twitching while Another (PD1924) Affects Pilus Number and Location
    Article Snippet: Pellet formed was suspended in 200 μl of DNA/RNA Shield (Zymo Research), and RNA was extracted using a Quick-RNA MiniPrep Plus kit (Zymo Research), using in-column DNase treatment following the manufacturers' protocol. .. RNA concentration was measured by a NanoDrop 2000 spectrophotometer (Thermo Scientific). cDNA was prepared using qScript cDNA SuperMix (Quantabio) with 170 ng of normalized RNA in 20 μl volume.

    Lysis:

    Article Title: Selection of stable reference genes for RT-qPCR in Rhodococcus opacus PD630
    Article Snippet: RNA extraction and cDNA synthesis RNA was extracted from the triplicate biological samples stored at −80 °C in the DNA/RNA Shield using the Quick-RNA MiniPrep Plus kit (Zymo Research), per the instructions. .. The optional ZR BashingBead Lysis Tubes (0.1 and 0.5 mm beads; Zymo Research) were used to lyse the cells.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Zymo Research quick rna plus kit
    Negative controls lacking guide <t>RNA</t> for nuclease and base editing experiments To verify genomic DNA cleavage and base editing results, the same sites were sequenced after treatment with SpCas9 nuclease, SpCas9-BE3, or SpCas9-ABE but without any sgRNA. a , Indel rates at endogenous target sites 5 days after treatment of <t>HEK293T</t> cells with SpCas9. b , Target C•G to T•A conversion 3 days after treatment of HEK293T cells with SpCas9-BE3. c, Target A•T to G•C base conversion 5 days after treatment of HEK293T cells with SpCas9-ABE. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Complete HTS results across the protospacer are provided in Supplementary Table 14 .
    Quick Rna Plus Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick rna plus kit/product/Zymo Research
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quick rna plus kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Zymo Research quick rna micro prep kit
    mRNA expression of TET 2 and TET 3 in B cells ex vivo . B‐cell populations were <t>FACS</t> ‐sorted from bone marrow and spleens of 8‐wk‐young wild type mice (Development and Mature; n = 3) or spleens from 9‐wk‐young wild type mice that has been immunized with sheep RBC 7 days before (Antigen activated; n = 3), and <t>RNA</t> was isolated for qRT ‐ PCR analysis for (A) TET 2 and (B) TET 3 expression. HPRT was used as reference gene. Bone marrow: pro B cells, large and small pre B cells and immature IgM + B cells. Spleen: transitional 1 (T1) B cells, transitional 2 (T2) B cells, mature follicular ( FO ) B cells, marginal zone ( MZ ) B cells, germinal centre ( GC ) B cells and plasmablasts/plasma cells ( PC ). GC B cells were further divided into dark zone centroblasts ( CB ) and light zone centrocytes ( CC ). Data are shown as mean ± SD.
    Quick Rna Micro Prep Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick rna micro prep kit/product/Zymo Research
    Average 95 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    quick rna micro prep kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Zymo Research quick rna mini prep plus kit
    R. typhi elicits an immune response in Drosophila cells. Shown are results of a PCR array analysis of transcripts in uninfected and R. typhi -infected <t>KC167</t> cells. <t>RNA</t> was extracted from KC167 cells infected with R. typhi for 0 or 4 h, and cDNA was used in the Fruit Fly Signal Transduction PathwayFinder PCR array.
    Quick Rna Mini Prep Plus Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick rna mini prep plus kit/product/Zymo Research
    Average 95 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    quick rna mini prep plus kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Negative controls lacking guide RNA for nuclease and base editing experiments To verify genomic DNA cleavage and base editing results, the same sites were sequenced after treatment with SpCas9 nuclease, SpCas9-BE3, or SpCas9-ABE but without any sgRNA. a , Indel rates at endogenous target sites 5 days after treatment of HEK293T cells with SpCas9. b , Target C•G to T•A conversion 3 days after treatment of HEK293T cells with SpCas9-BE3. c, Target A•T to G•C base conversion 5 days after treatment of HEK293T cells with SpCas9-ABE. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Complete HTS results across the protospacer are provided in Supplementary Table 14 .

    Journal: Nature

    Article Title: Evolved Cas9 variants with broad PAM compatibility and high DNA specificity

    doi: 10.1038/nature26155

    Figure Lengend Snippet: Negative controls lacking guide RNA for nuclease and base editing experiments To verify genomic DNA cleavage and base editing results, the same sites were sequenced after treatment with SpCas9 nuclease, SpCas9-BE3, or SpCas9-ABE but without any sgRNA. a , Indel rates at endogenous target sites 5 days after treatment of HEK293T cells with SpCas9. b , Target C•G to T•A conversion 3 days after treatment of HEK293T cells with SpCas9-BE3. c, Target A•T to G•C base conversion 5 days after treatment of HEK293T cells with SpCas9-ABE. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Complete HTS results across the protospacer are provided in Supplementary Table 14 .

    Article Snippet: RNA expression quantification for endogenous transcriptional activation assay RNA was extracted from HEK293T cells using the Quick-RNA Plus Kit (Zymo Research). cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad) and qPCR was performed on a Bio-Rad CFX96 Real-Time PCR Detection System using Q5 Polymerase (NEB) and SYBR Green (Lonza).

    Techniques:

    Transcriptional activation with xCas9 3.7 on all 64 NNN PAM sites and endogenous gene activation in human cells a–d, The transcriptional activator dxCas9(3.7)–VPR was tested on the R1 protospacer ( Extended Data Fig. 3 and Supplementary Table 8 ) with each of the 64 possible NNN PAMs (NAN, NCN, NGN, and NTN) in HEK293T cells. e, Endogenous gene activation was tested using both dSpCas9–VPR and dxCas9(3.7)–VPR to activate expression of the NEUROD1, ASCL1, MIAT, or RHOXF2 at six total sites. RNA expression as measured by RT-qPCR was compared to background expression levels for each gene (measured in the control with no sgRNA) and was normalized to ACTB expression. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Target sites are in Supplementary Table 9 .

    Journal: Nature

    Article Title: Evolved Cas9 variants with broad PAM compatibility and high DNA specificity

    doi: 10.1038/nature26155

    Figure Lengend Snippet: Transcriptional activation with xCas9 3.7 on all 64 NNN PAM sites and endogenous gene activation in human cells a–d, The transcriptional activator dxCas9(3.7)–VPR was tested on the R1 protospacer ( Extended Data Fig. 3 and Supplementary Table 8 ) with each of the 64 possible NNN PAMs (NAN, NCN, NGN, and NTN) in HEK293T cells. e, Endogenous gene activation was tested using both dSpCas9–VPR and dxCas9(3.7)–VPR to activate expression of the NEUROD1, ASCL1, MIAT, or RHOXF2 at six total sites. RNA expression as measured by RT-qPCR was compared to background expression levels for each gene (measured in the control with no sgRNA) and was normalized to ACTB expression. Values and error bars reflect the mean and s.d. of n=3 biologically independent samples. Target sites are in Supplementary Table 9 .

    Article Snippet: RNA expression quantification for endogenous transcriptional activation assay RNA was extracted from HEK293T cells using the Quick-RNA Plus Kit (Zymo Research). cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad) and qPCR was performed on a Bio-Rad CFX96 Real-Time PCR Detection System using Q5 Polymerase (NEB) and SYBR Green (Lonza).

    Techniques: Activation Assay, Expressing, RNA Expression, Quantitative RT-PCR

    mRNA expression of TET 2 and TET 3 in B cells ex vivo . B‐cell populations were FACS ‐sorted from bone marrow and spleens of 8‐wk‐young wild type mice (Development and Mature; n = 3) or spleens from 9‐wk‐young wild type mice that has been immunized with sheep RBC 7 days before (Antigen activated; n = 3), and RNA was isolated for qRT ‐ PCR analysis for (A) TET 2 and (B) TET 3 expression. HPRT was used as reference gene. Bone marrow: pro B cells, large and small pre B cells and immature IgM + B cells. Spleen: transitional 1 (T1) B cells, transitional 2 (T2) B cells, mature follicular ( FO ) B cells, marginal zone ( MZ ) B cells, germinal centre ( GC ) B cells and plasmablasts/plasma cells ( PC ). GC B cells were further divided into dark zone centroblasts ( CB ) and light zone centrocytes ( CC ). Data are shown as mean ± SD.

    Journal: The Febs Journal

    Article Title: TET enzymes control antibody production and shape the mutational landscape in germinal centre B cells

    doi: 10.1111/febs.14934

    Figure Lengend Snippet: mRNA expression of TET 2 and TET 3 in B cells ex vivo . B‐cell populations were FACS ‐sorted from bone marrow and spleens of 8‐wk‐young wild type mice (Development and Mature; n = 3) or spleens from 9‐wk‐young wild type mice that has been immunized with sheep RBC 7 days before (Antigen activated; n = 3), and RNA was isolated for qRT ‐ PCR analysis for (A) TET 2 and (B) TET 3 expression. HPRT was used as reference gene. Bone marrow: pro B cells, large and small pre B cells and immature IgM + B cells. Spleen: transitional 1 (T1) B cells, transitional 2 (T2) B cells, mature follicular ( FO ) B cells, marginal zone ( MZ ) B cells, germinal centre ( GC ) B cells and plasmablasts/plasma cells ( PC ). GC B cells were further divided into dark zone centroblasts ( CB ) and light zone centrocytes ( CC ). Data are shown as mean ± SD.

    Article Snippet: Quantitative real‐time‐PCR RNA from snap‐frozen cell pellets of FACS‐sorted B cells was isolated using the Quick‐RNA Micro Prep Kit (Zymo Research, Irvine, CA, USA, R1050) and DNase digestion as per manufacturer's instructions.

    Techniques: Expressing, Ex Vivo, FACS, Mouse Assay, Isolation, Quantitative RT-PCR

    R. typhi elicits an immune response in Drosophila cells. Shown are results of a PCR array analysis of transcripts in uninfected and R. typhi -infected KC167 cells. RNA was extracted from KC167 cells infected with R. typhi for 0 or 4 h, and cDNA was used in the Fruit Fly Signal Transduction PathwayFinder PCR array.

    Journal: Infection and Immunity

    Article Title: The Cat Flea ( Ctenocephalides felis) Immune Deficiency Signaling Pathway Regulates Rickettsia typhi Infection

    doi: 10.1128/IAI.00562-17

    Figure Lengend Snippet: R. typhi elicits an immune response in Drosophila cells. Shown are results of a PCR array analysis of transcripts in uninfected and R. typhi -infected KC167 cells. RNA was extracted from KC167 cells infected with R. typhi for 0 or 4 h, and cDNA was used in the Fruit Fly Signal Transduction PathwayFinder PCR array.

    Article Snippet: Four hours postinfection, RNA was isolated from KC167 cells using the Quick-RNA Mini-Prep Plus kit (Zymo Research; R1055) and cDNAs were synthesized from 200 ng of RNA using an RT2 First Strand kit (Qiagen; 330401).

    Techniques: Polymerase Chain Reaction, Infection, Transduction

    Lethal Dox Suppresses LRP1 Protein Translation through the p53-Regulated miRNAs MiR-103 and MiR-107 (A) HCT116 cells were treated with the indicated dose of Dox (nanomolar) for 24 hr, after which RNA was collected and subjected to qRT-PCR analysis. Data represent at least two biological replicates, each performed in triplicate. (B) HCT116 cells were treated with the indicated dose of Dox for 24 hr, after which cells were subjected to ChIP analysis using anti-p53 antibody and non-specific IgG. Data represent at least two biological replicates, each performed in triplicate. (C) HCT116 cells were treated with the indicated stress for 24 hr, after which vehicle, MG132 (MG), or CQ was added to the cells for an additional 8 hr. After MG or CQ treatment, lysates were collected and subjected to western blot analysis. Data represent at least two biological replicates. (D) HCT116 cells were treated with the indicated course of Dox for 24 hr, after which cells were labeled with 35 S-Met/Cys for 30 min, chased with complete DMEM for another 30 min, and then subjected to LRP1 immunoprecipitation. Data represent at least two biological replicates.

    Journal: Cell reports

    Article Title: p53 Regulates the Expression of LRP1 and Apoptosis through a Stress Intensity-Dependent MicroRNA Feedback Loop

    doi: 10.1016/j.celrep.2018.07.010

    Figure Lengend Snippet: Lethal Dox Suppresses LRP1 Protein Translation through the p53-Regulated miRNAs MiR-103 and MiR-107 (A) HCT116 cells were treated with the indicated dose of Dox (nanomolar) for 24 hr, after which RNA was collected and subjected to qRT-PCR analysis. Data represent at least two biological replicates, each performed in triplicate. (B) HCT116 cells were treated with the indicated dose of Dox for 24 hr, after which cells were subjected to ChIP analysis using anti-p53 antibody and non-specific IgG. Data represent at least two biological replicates, each performed in triplicate. (C) HCT116 cells were treated with the indicated stress for 24 hr, after which vehicle, MG132 (MG), or CQ was added to the cells for an additional 8 hr. After MG or CQ treatment, lysates were collected and subjected to western blot analysis. Data represent at least two biological replicates. (D) HCT116 cells were treated with the indicated course of Dox for 24 hr, after which cells were labeled with 35 S-Met/Cys for 30 min, chased with complete DMEM for another 30 min, and then subjected to LRP1 immunoprecipitation. Data represent at least two biological replicates.

    Article Snippet: qRT-PCR After treatment, RNA was purified from cells using the Zymo Quick RNA mini-prep kit according to the protocol recommended by the manufacturer (Zymo Research, catalog no. R1057).

    Techniques: Quantitative RT-PCR, Chromatin Immunoprecipitation, Western Blot, Labeling, Immunoprecipitation