dna clean concentrator kit  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Select a Size DNA Clean Concentrator Kit
    Description:
    The Select a Size DNA Clean Concentrator Kit Select a Size DCC provides the quickest and easiest method for purifying a desired range of DNA fragments sizes from library preps PCR endonuclease digestions ligations etc Simply adjust the binding conditions for the desired cutoff bind wash and elute Selectively recover 300 bp 200 bp 150 bp 100 bp 50 bp DNA fragments or perform a double size selection Unique Zymo Spin column technology yields high quality DNA in just minutes that is suitable for next generation sequencing PCR and other downstream applications The entire purification procedure can be performed in as little as 7 minutes for 2 preps or 20 minutes for 24 samples See figures below
    Catalog Number:
    d4080
    Price:
    None
    Applications:
    DNA Clean-up & Size Selection
    Size:
    25 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research dna clean concentrator kit
    Select a Size DNA Clean Concentrator Kit
    The Select a Size DNA Clean Concentrator Kit Select a Size DCC provides the quickest and easiest method for purifying a desired range of DNA fragments sizes from library preps PCR endonuclease digestions ligations etc Simply adjust the binding conditions for the desired cutoff bind wash and elute Selectively recover 300 bp 200 bp 150 bp 100 bp 50 bp DNA fragments or perform a double size selection Unique Zymo Spin column technology yields high quality DNA in just minutes that is suitable for next generation sequencing PCR and other downstream applications The entire purification procedure can be performed in as little as 7 minutes for 2 preps or 20 minutes for 24 samples See figures below
    https://www.bioz.com/result/dna clean concentrator kit/product/Zymo Research
    Average 95 stars, based on 170 article reviews
    Price from $9.99 to $1999.99
    dna clean concentrator kit - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "The Clinical Influence of Autophagy-Associated Proteins on Human Lung Cancer"

    Article Title: The Clinical Influence of Autophagy-Associated Proteins on Human Lung Cancer

    Journal: Disease Markers

    doi: 10.1155/2018/8314963

    (a) Methylation status of LC3A in 5 lung cancer cell lines and HBEC. Bisulfite sequencing (BS) showed a heterogeneous methylation pattern in the promoter region and exon 4 of the LC3A gene in lung cancer cell lines. White: unmethylated; grey: partially methylated or only one allele is methylated; black: totally methylated or two alleles are methylated. 1–6: 6 CpG sites in promoter region; 1–8: 8 CpG sites in exon 4. (b) Representative results from methylation-specific PCR (MSP) showing that LC3A was unmethylated in cases 1, 4, and 5 while partially methylated in cases 3, 6, 7, and 8. Case 2 was excluded for the statistical analysis (see Supplementary Table 3 ), since no PCR products were observed most probably due to degraded genomic DNA. U: unmethylated; M: methylated.
    Figure Legend Snippet: (a) Methylation status of LC3A in 5 lung cancer cell lines and HBEC. Bisulfite sequencing (BS) showed a heterogeneous methylation pattern in the promoter region and exon 4 of the LC3A gene in lung cancer cell lines. White: unmethylated; grey: partially methylated or only one allele is methylated; black: totally methylated or two alleles are methylated. 1–6: 6 CpG sites in promoter region; 1–8: 8 CpG sites in exon 4. (b) Representative results from methylation-specific PCR (MSP) showing that LC3A was unmethylated in cases 1, 4, and 5 while partially methylated in cases 3, 6, 7, and 8. Case 2 was excluded for the statistical analysis (see Supplementary Table 3 ), since no PCR products were observed most probably due to degraded genomic DNA. U: unmethylated; M: methylated.

    Techniques Used: Methylation, Methylation Sequencing, Polymerase Chain Reaction

    2) Product Images from "Large diverse population cohorts of hiPSCs and derived hepatocyte-like cells reveal functional genetic variation at blood lipid-associated loci"

    Article Title: Large diverse population cohorts of hiPSCs and derived hepatocyte-like cells reveal functional genetic variation at blood lipid-associated loci

    Journal: Cell stem cell

    doi: 10.1016/j.stem.2017.03.017

    Evidence for rs2277862- CPNE1 as a Functional SNP-Gene Set (A) Schematics of human chromosome 20q11 locus showing the relative positions of rs2277862, CPNE1 , and ERGIC3 and mouse chromosome 2qH1 locus showing the relative positions of rs27324996, Cpne1 , and Ergic3 . (B) Top panels: heterozygous knock-in of rs2277862 minor allele with a single-strand DNA oligonucleotide. Representative indels in non-knock-in clones are also shown. Bottom panels: homozygous 38-bp deletions (“knockout” or Δ38/Δ38) encompassing rs2277862 using a dual gRNA approach. A representative agarose gel of PCR amplicons is shown. The protospacers are underlined, the PAMs are bolded, and the SNP position is indicated in red. (C) Left panels: gene expression in undifferentiated HUES 8 cells (n = 2 wild-type clones and 1 knock-in clone; 6 wells per clone) and differentiated HUES 8 HLCs (n = 2 wild-type clones and 1 knock-in clone; 6 wells per clone) normalized to mean expression level in wild-type clones. Right panels: gene expression in undifferentiated HUES 8 cells (n = 10 wild-type and 10 knockout clones, 3 wells per clone) and undifferentiated H7 cells (n = 8 wild-type and 6 knockout clones, 3 wells per clone) normalized to mean expression level in wild-type clones. (D) CRISPR interference at the rs2277862 site. The three gRNA protospacers are underlined, the PAMs are bolded, and the SNP position is indicated in red. The graphs show gene expression, normalized to mean expression level in control cells, in HEK 293T cells transfected with catalytically dead Cas9 (dCas9) with the gRNAs (either singly or in combination, 3 wells per condition). Control cells were transfected with dCas9 without an accompanying gRNA. (E) The noncoding rs2277862 site is well conserved in mouse, including allelic variants of the SNP itself, with the murine equivalent being rs27324996. The SNP position is indicated in red, non-conserved nucleotides are indicated in blue, the gRNA protospacer used to generate the knock-in mouse is underlined, and the PAM is bolded. The electropherogram is from a mouse in which the minor allele of rs2277862/rs27324996 (T) has been knocked into one chromosome, along with four non-conserved nucleotides to “humanize” the site. (F) Gene expression in liver from littermates of the C57BL/6J background (n = 18 wild-type mice and 10 homozygous knock-in mice), normalized to mean expression level in wild-type mice. Data are displayed as means and s.e.m. P -values were calculated with two-tailed Welch’s t -tests.
    Figure Legend Snippet: Evidence for rs2277862- CPNE1 as a Functional SNP-Gene Set (A) Schematics of human chromosome 20q11 locus showing the relative positions of rs2277862, CPNE1 , and ERGIC3 and mouse chromosome 2qH1 locus showing the relative positions of rs27324996, Cpne1 , and Ergic3 . (B) Top panels: heterozygous knock-in of rs2277862 minor allele with a single-strand DNA oligonucleotide. Representative indels in non-knock-in clones are also shown. Bottom panels: homozygous 38-bp deletions (“knockout” or Δ38/Δ38) encompassing rs2277862 using a dual gRNA approach. A representative agarose gel of PCR amplicons is shown. The protospacers are underlined, the PAMs are bolded, and the SNP position is indicated in red. (C) Left panels: gene expression in undifferentiated HUES 8 cells (n = 2 wild-type clones and 1 knock-in clone; 6 wells per clone) and differentiated HUES 8 HLCs (n = 2 wild-type clones and 1 knock-in clone; 6 wells per clone) normalized to mean expression level in wild-type clones. Right panels: gene expression in undifferentiated HUES 8 cells (n = 10 wild-type and 10 knockout clones, 3 wells per clone) and undifferentiated H7 cells (n = 8 wild-type and 6 knockout clones, 3 wells per clone) normalized to mean expression level in wild-type clones. (D) CRISPR interference at the rs2277862 site. The three gRNA protospacers are underlined, the PAMs are bolded, and the SNP position is indicated in red. The graphs show gene expression, normalized to mean expression level in control cells, in HEK 293T cells transfected with catalytically dead Cas9 (dCas9) with the gRNAs (either singly or in combination, 3 wells per condition). Control cells were transfected with dCas9 without an accompanying gRNA. (E) The noncoding rs2277862 site is well conserved in mouse, including allelic variants of the SNP itself, with the murine equivalent being rs27324996. The SNP position is indicated in red, non-conserved nucleotides are indicated in blue, the gRNA protospacer used to generate the knock-in mouse is underlined, and the PAM is bolded. The electropherogram is from a mouse in which the minor allele of rs2277862/rs27324996 (T) has been knocked into one chromosome, along with four non-conserved nucleotides to “humanize” the site. (F) Gene expression in liver from littermates of the C57BL/6J background (n = 18 wild-type mice and 10 homozygous knock-in mice), normalized to mean expression level in wild-type mice. Data are displayed as means and s.e.m. P -values were calculated with two-tailed Welch’s t -tests.

    Techniques Used: Functional Assay, Knock-In, Clone Assay, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Expressing, Knock-Out, CRISPR, Transfection, Mouse Assay, Two Tailed Test

    3) Product Images from "Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria"

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria

    Journal: mSystems

    doi: 10.1128/mSystems.00143-17

    Golden Gate assembly of transposon delivery vectors from part vectors. (A to E) The five part vectors that are used for Golden Gate assembly of the magic pool transposon delivery vectors: part1 vector, part2 vector, part3 vector, barcoded part4 vector, and part5 vector (not drawn to scale). We show the sequences of the 4-nucleotide overhangs for Golden Gate assembly. (F) The transposon delivery vector with DNA barcode. ColE1 is the replication origin ColE1. cat is the chloramphenicol resistance gene. GFP is green fluorescent protein. oriT is the origin of transfer. AmpR is the beta-lactam resistance gene. R6K is a conditional replication origin. N20 is random 20-nucleotide DNA barcode.
    Figure Legend Snippet: Golden Gate assembly of transposon delivery vectors from part vectors. (A to E) The five part vectors that are used for Golden Gate assembly of the magic pool transposon delivery vectors: part1 vector, part2 vector, part3 vector, barcoded part4 vector, and part5 vector (not drawn to scale). We show the sequences of the 4-nucleotide overhangs for Golden Gate assembly. (F) The transposon delivery vector with DNA barcode. ColE1 is the replication origin ColE1. cat is the chloramphenicol resistance gene. GFP is green fluorescent protein. oriT is the origin of transfer. AmpR is the beta-lactam resistance gene. R6K is a conditional replication origin. N20 is random 20-nucleotide DNA barcode.

    Techniques Used: Plasmid Preparation

    Overview of the magic pool strategy. (A) Basic structure of a typical transposon delivery vector (not drawn to scale). The inverted repeat (IR) for the specific transposase is indicated. We dissected the transposon delivery vector into five different parts compatible with Golden Gate assembly, and the different parts are indicated by different colors. (B) General workflow of construction and application of magic pools. In step 1, variants of the five different parts are designed, cloned into a part-holding vector, confirmed by sequencing, and archived. In step 2, the part vectors are mixed and assembled using Golden Gate assembly to produce the magic pools of transposon delivery vectors. In step 3, the magic pool vectors are characterized by DNA sequencing whereby each unique DNA barcode (random 20-nucleotide DNA barcode [N20]) is linked to a specific combination of parts. In step 4, preliminary mutant libraries of approximately 5,000 CFU are made using the magic pool, and TnSeq is performed to link the DNA barcode to the insertion site, thereby simultaneously assessing the efficacy of the vectors in the magic pool. ID, identification. In step 5, an effective vector is reassembled using the archived parts, fully barcoded with millions of random DNA barcodes, and a full RB-TnSeq transposon mutant library is constructed. oriT is the origin of transfer. AmpR is the beta-lactam resistance cassette. R6K is the conditional replication origin.
    Figure Legend Snippet: Overview of the magic pool strategy. (A) Basic structure of a typical transposon delivery vector (not drawn to scale). The inverted repeat (IR) for the specific transposase is indicated. We dissected the transposon delivery vector into five different parts compatible with Golden Gate assembly, and the different parts are indicated by different colors. (B) General workflow of construction and application of magic pools. In step 1, variants of the five different parts are designed, cloned into a part-holding vector, confirmed by sequencing, and archived. In step 2, the part vectors are mixed and assembled using Golden Gate assembly to produce the magic pools of transposon delivery vectors. In step 3, the magic pool vectors are characterized by DNA sequencing whereby each unique DNA barcode (random 20-nucleotide DNA barcode [N20]) is linked to a specific combination of parts. In step 4, preliminary mutant libraries of approximately 5,000 CFU are made using the magic pool, and TnSeq is performed to link the DNA barcode to the insertion site, thereby simultaneously assessing the efficacy of the vectors in the magic pool. ID, identification. In step 5, an effective vector is reassembled using the archived parts, fully barcoded with millions of random DNA barcodes, and a full RB-TnSeq transposon mutant library is constructed. oriT is the origin of transfer. AmpR is the beta-lactam resistance cassette. R6K is the conditional replication origin.

    Techniques Used: Plasmid Preparation, Clone Assay, Sequencing, DNA Sequencing, Mutagenesis, Construct

    4) Product Images from "Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis"

    Article Title: Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis

    Journal: Microbial biotechnology

    doi: 10.1111/j.1751-7915.2010.00230.x

    PCR‐based gene mutagenesis and plasmid multimerization. A. Relevant features of the vector pNWP43N‐Bscel5. P 43 , SP nprB , Bscel5 and term represent the P 43 promoter, the NprB signal peptide‐encoding sequence, gene of family 5 endoglucanse and terminator of Bscel5 from B. subtilis respectively. ColE1 ori , repB and cat represent the sequences coding for the ColE1 replication origin, replicase and chloramphenicol resistance marker respectively. The arrows show the transcription directions for these genes. B. The flow scheme of the two‐step PCR procedure for the gene mutagenesis and plasmid multimerization. gh5 , family 5 glycoside hydrolase‐encoding sequence; cbm3 , family 3 carbohydrate‐binding module‐encoding sequence. P1, P2, P3 and P4 denote the positions of the primers for the PCR amplification. This figure was not drawn to scale. C. Plasmid multimerization by PCR. Lanes: M, DNA markers; 1, PCR‐linearized pNWP43N‐Bscel5; 2, error‐prone PCR product of SPnprB‐Bscel5 ; 3, multimerized plasmid; 4, multimer digested with PstI/HindIII.
    Figure Legend Snippet: PCR‐based gene mutagenesis and plasmid multimerization. A. Relevant features of the vector pNWP43N‐Bscel5. P 43 , SP nprB , Bscel5 and term represent the P 43 promoter, the NprB signal peptide‐encoding sequence, gene of family 5 endoglucanse and terminator of Bscel5 from B. subtilis respectively. ColE1 ori , repB and cat represent the sequences coding for the ColE1 replication origin, replicase and chloramphenicol resistance marker respectively. The arrows show the transcription directions for these genes. B. The flow scheme of the two‐step PCR procedure for the gene mutagenesis and plasmid multimerization. gh5 , family 5 glycoside hydrolase‐encoding sequence; cbm3 , family 3 carbohydrate‐binding module‐encoding sequence. P1, P2, P3 and P4 denote the positions of the primers for the PCR amplification. This figure was not drawn to scale. C. Plasmid multimerization by PCR. Lanes: M, DNA markers; 1, PCR‐linearized pNWP43N‐Bscel5; 2, error‐prone PCR product of SPnprB‐Bscel5 ; 3, multimerized plasmid; 4, multimer digested with PstI/HindIII.

    Techniques Used: Polymerase Chain Reaction, Mutagenesis, Plasmid Preparation, Sequencing, Marker, Flow Cytometry, Binding Assay, Amplification

    5) Product Images from "An evolutionary arms race between KRAB zinc finger genes 91/93 and SVA/L1 retrotransposons"

    Article Title: An evolutionary arms race between KRAB zinc finger genes 91/93 and SVA/L1 retrotransposons

    Journal: Nature

    doi: 10.1038/nature13760

    KAP1 associates with recently emerged transposable elements a, Immunoblot incubated with anti-KAP1 antibody loaded with 1% input and eluates of KAP1-ChIP or IgG-ChIP derived from human ESC lysates. b , Diagram showing numbers of KAP1 peaks identified in two independent biological replicates and common peaks. c , Distribution of 9174 KAP1-ChIP-seq peaks over various DNA elements. d , Distribution of retrotransposon classes among KAP1-ChIP peaks from hESCs (left) or genome wide (right) e , KAP1 and H3K4me3 ChIP-seq and RNA-seq coverage tracks for a representative region on human chromosome 11 in hESCs (white-, grey-shaded) and TC11-mESCs (yellow-shaded). Blue arrows: de-repressed retrotransposons; black arrows: re-activated transcription; Red vertical shading: reactivated SVAs; orange shading: reactivated LTR12C. Blue and tan in RNA-seq tracks indicate positive and negative strand transcripts, respectively. Note that while the majority of SVAs display aberrant H3K4me3 signal, for unclear reasons not all SVAs display aberrant transcription in TC11-mESCs. sup: supernatant; Rep: biological replicate; TSS: transcription start site.
    Figure Legend Snippet: KAP1 associates with recently emerged transposable elements a, Immunoblot incubated with anti-KAP1 antibody loaded with 1% input and eluates of KAP1-ChIP or IgG-ChIP derived from human ESC lysates. b , Diagram showing numbers of KAP1 peaks identified in two independent biological replicates and common peaks. c , Distribution of 9174 KAP1-ChIP-seq peaks over various DNA elements. d , Distribution of retrotransposon classes among KAP1-ChIP peaks from hESCs (left) or genome wide (right) e , KAP1 and H3K4me3 ChIP-seq and RNA-seq coverage tracks for a representative region on human chromosome 11 in hESCs (white-, grey-shaded) and TC11-mESCs (yellow-shaded). Blue arrows: de-repressed retrotransposons; black arrows: re-activated transcription; Red vertical shading: reactivated SVAs; orange shading: reactivated LTR12C. Blue and tan in RNA-seq tracks indicate positive and negative strand transcripts, respectively. Note that while the majority of SVAs display aberrant H3K4me3 signal, for unclear reasons not all SVAs display aberrant transcription in TC11-mESCs. sup: supernatant; Rep: biological replicate; TSS: transcription start site.

    Techniques Used: Incubation, Chromatin Immunoprecipitation, Derivative Assay, Genome Wide, RNA Sequencing Assay

    6) Product Images from "The Clinical Influence of Autophagy-Associated Proteins on Human Lung Cancer"

    Article Title: The Clinical Influence of Autophagy-Associated Proteins on Human Lung Cancer

    Journal: Disease Markers

    doi: 10.1155/2018/8314963

    ), since no PCR products were observed most probably due to degraded genomic DNA. U: unmethylated; M: methylated.
    Figure Legend Snippet: ), since no PCR products were observed most probably due to degraded genomic DNA. U: unmethylated; M: methylated.

    Techniques Used: Polymerase Chain Reaction, Methylation

    7) Product Images from "Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP"

    Article Title: Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0225801

    RAT-ChIP enables genome wide histone modification profiling from 100 cells. A Overview of RAT-ChIP method. B Agarose gel electrophoresis of DNA after chromatin treatment with a combination of restriction enzymes (middle lane) and after tagmentation (left lane). C UCSC genome browser custom histone H3K4me3 and H3K27me3 tracks of RAT-ChIP-seq with 100 and 1,000 K562 cells in comparison with ENCODE data in a genomic region centred around IL17C gene. D Clustered global Pearson correlation heatmap (enrichments in 5kb windows) of RAT-ChIP-seq and different published histone H3K4me3 and H3K27me3 datasets in K562 cells.
    Figure Legend Snippet: RAT-ChIP enables genome wide histone modification profiling from 100 cells. A Overview of RAT-ChIP method. B Agarose gel electrophoresis of DNA after chromatin treatment with a combination of restriction enzymes (middle lane) and after tagmentation (left lane). C UCSC genome browser custom histone H3K4me3 and H3K27me3 tracks of RAT-ChIP-seq with 100 and 1,000 K562 cells in comparison with ENCODE data in a genomic region centred around IL17C gene. D Clustered global Pearson correlation heatmap (enrichments in 5kb windows) of RAT-ChIP-seq and different published histone H3K4me3 and H3K27me3 datasets in K562 cells.

    Techniques Used: Chromatin Immunoprecipitation, Genome Wide, Modification, Agarose Gel Electrophoresis

    8) Product Images from "Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria"

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria

    Journal: mSystems

    doi: 10.1128/mSystems.00143-17

    Golden Gate assembly of transposon delivery vectors from part vectors. (A to E) The five part vectors that are used for Golden Gate assembly of the magic pool transposon delivery vectors: part1 vector, part2 vector, part3 vector, barcoded part4 vector, and part5 vector (not drawn to scale). We show the sequences of the 4-nucleotide overhangs for Golden Gate assembly. (F) The transposon delivery vector with DNA barcode. ColE1 is the replication origin ColE1. cat is the chloramphenicol resistance gene. GFP is green fluorescent protein. oriT is the origin of transfer. AmpR is the beta-lactam resistance gene. R6K is a conditional replication origin. N20 is random 20-nucleotide DNA barcode.
    Figure Legend Snippet: Golden Gate assembly of transposon delivery vectors from part vectors. (A to E) The five part vectors that are used for Golden Gate assembly of the magic pool transposon delivery vectors: part1 vector, part2 vector, part3 vector, barcoded part4 vector, and part5 vector (not drawn to scale). We show the sequences of the 4-nucleotide overhangs for Golden Gate assembly. (F) The transposon delivery vector with DNA barcode. ColE1 is the replication origin ColE1. cat is the chloramphenicol resistance gene. GFP is green fluorescent protein. oriT is the origin of transfer. AmpR is the beta-lactam resistance gene. R6K is a conditional replication origin. N20 is random 20-nucleotide DNA barcode.

    Techniques Used: Plasmid Preparation

    Overview of the magic pool strategy. (A) Basic structure of a typical transposon delivery vector (not drawn to scale). The inverted repeat (IR) for the specific transposase is indicated. We dissected the transposon delivery vector into five different parts compatible with Golden Gate assembly, and the different parts are indicated by different colors. (B) General workflow of construction and application of magic pools. In step 1, variants of the five different parts are designed, cloned into a part-holding vector, confirmed by sequencing, and archived. In step 2, the part vectors are mixed and assembled using Golden Gate assembly to produce the magic pools of transposon delivery vectors. In step 3, the magic pool vectors are characterized by DNA sequencing whereby each unique DNA barcode (random 20-nucleotide DNA barcode [N20]) is linked to a specific combination of parts. In step 4, preliminary mutant libraries of approximately 5,000 CFU are made using the magic pool, and TnSeq is performed to link the DNA barcode to the insertion site, thereby simultaneously assessing the efficacy of the vectors in the magic pool. ID, identification. In step 5, an effective vector is reassembled using the archived parts, fully barcoded with millions of random DNA barcodes, and a full RB-TnSeq transposon mutant library is constructed. oriT is the origin of transfer. AmpR is the beta-lactam resistance cassette. R6K is the conditional replication origin.
    Figure Legend Snippet: Overview of the magic pool strategy. (A) Basic structure of a typical transposon delivery vector (not drawn to scale). The inverted repeat (IR) for the specific transposase is indicated. We dissected the transposon delivery vector into five different parts compatible with Golden Gate assembly, and the different parts are indicated by different colors. (B) General workflow of construction and application of magic pools. In step 1, variants of the five different parts are designed, cloned into a part-holding vector, confirmed by sequencing, and archived. In step 2, the part vectors are mixed and assembled using Golden Gate assembly to produce the magic pools of transposon delivery vectors. In step 3, the magic pool vectors are characterized by DNA sequencing whereby each unique DNA barcode (random 20-nucleotide DNA barcode [N20]) is linked to a specific combination of parts. In step 4, preliminary mutant libraries of approximately 5,000 CFU are made using the magic pool, and TnSeq is performed to link the DNA barcode to the insertion site, thereby simultaneously assessing the efficacy of the vectors in the magic pool. ID, identification. In step 5, an effective vector is reassembled using the archived parts, fully barcoded with millions of random DNA barcodes, and a full RB-TnSeq transposon mutant library is constructed. oriT is the origin of transfer. AmpR is the beta-lactam resistance cassette. R6K is the conditional replication origin.

    Techniques Used: Plasmid Preparation, Clone Assay, Sequencing, DNA Sequencing, Mutagenesis, Construct

    9) Product Images from "Development of a Method to Implement Whole-Genome Bisulfite Sequencing of cfDNA from Cancer Patients and a Mouse Tumor Model"

    Article Title: Development of a Method to Implement Whole-Genome Bisulfite Sequencing of cfDNA from Cancer Patients and a Mouse Tumor Model

    Journal: Frontiers in Genetics

    doi: 10.3389/fgene.2018.00006

    Representative bioanalyzer images of freshly isolated and bead-purified cfDNA. (A–C) Healthy human control, (D–F) WT mouse, and (G–I) PDAC mouse. The left columns depict the freshly isolated starting cfDNA (green arrow and dotted line) and the contaminating high molecular weight DNA (black arrow) evident by a wide peak. The middle column depicts the high molecular weight DNA removed from the same samples shown in (A–G) by the SPRI AMPure bead purification step after the 0.5X dilution step. The right column shows the purified cfDNA as recovered form the SPRI AMPure bead purification step after the 1.6X dilution step from the same samples shown in (A–G) . The desired cfDNA peak is visible ∼150–200 bp (green arrow and dotted line).
    Figure Legend Snippet: Representative bioanalyzer images of freshly isolated and bead-purified cfDNA. (A–C) Healthy human control, (D–F) WT mouse, and (G–I) PDAC mouse. The left columns depict the freshly isolated starting cfDNA (green arrow and dotted line) and the contaminating high molecular weight DNA (black arrow) evident by a wide peak. The middle column depicts the high molecular weight DNA removed from the same samples shown in (A–G) by the SPRI AMPure bead purification step after the 0.5X dilution step. The right column shows the purified cfDNA as recovered form the SPRI AMPure bead purification step after the 1.6X dilution step from the same samples shown in (A–G) . The desired cfDNA peak is visible ∼150–200 bp (green arrow and dotted line).

    Techniques Used: Isolation, Purification, Molecular Weight

    10) Product Images from "Tools for Rapid Genetic Engineering of Vibrio fischeri"

    Article Title: Tools for Rapid Genetic Engineering of Vibrio fischeri

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.00850-18

    Scheme for rapid insertion of genes of interest. A method was developed to introduce a gene of interest (GOI) with an Em r cassette into a benign site in the chromosome. (A) In this study, insertions were targeted to the indicated locus, the intergenic region between yeiR ( VF_2370 ) and glmS ( VF_2372 ). The arrow indicates the site of insertion, while the arrowhead indicates the position of the Tn 7 site. (B) The up- and downstream segments are amplified with the indicated primers using pKV502 and pKV503 as templates, as shown, or similar templates, while the GOI is typically amplified from chromosomal DNA. (C) The PCR SOE product (top) recombines into the chromosome (middle), as indicated by the crossed lines, resulting in the insertion (bottom).
    Figure Legend Snippet: Scheme for rapid insertion of genes of interest. A method was developed to introduce a gene of interest (GOI) with an Em r cassette into a benign site in the chromosome. (A) In this study, insertions were targeted to the indicated locus, the intergenic region between yeiR ( VF_2370 ) and glmS ( VF_2372 ). The arrow indicates the site of insertion, while the arrowhead indicates the position of the Tn 7 site. (B) The up- and downstream segments are amplified with the indicated primers using pKV502 and pKV503 as templates, as shown, or similar templates, while the GOI is typically amplified from chromosomal DNA. (C) The PCR SOE product (top) recombines into the chromosome (middle), as indicated by the crossed lines, resulting in the insertion (bottom).

    Techniques Used: Introduce, Amplification, Polymerase Chain Reaction

    11) Product Images from "Tools for Rapid Genetic Engineering of Vibrio fischeri"

    Article Title: Tools for Rapid Genetic Engineering of Vibrio fischeri

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.00850-18

    Scheme for rapid insertion of genes of interest. A method was developed to introduce a gene of interest (GOI) with an Em r cassette into a benign site in the chromosome. (A) In this study, insertions were targeted to the indicated locus, the intergenic region between yeiR ( VF_2370 ) and glmS ( VF_2372 ). The arrow indicates the site of insertion, while the arrowhead indicates the position of the Tn 7 site. (B) The up- and downstream segments are amplified with the indicated primers using pKV502 and pKV503 as templates, as shown, or similar templates, while the GOI is typically amplified from chromosomal DNA. (C) The PCR SOE product (top) recombines into the chromosome (middle), as indicated by the crossed lines, resulting in the insertion (bottom).
    Figure Legend Snippet: Scheme for rapid insertion of genes of interest. A method was developed to introduce a gene of interest (GOI) with an Em r cassette into a benign site in the chromosome. (A) In this study, insertions were targeted to the indicated locus, the intergenic region between yeiR ( VF_2370 ) and glmS ( VF_2372 ). The arrow indicates the site of insertion, while the arrowhead indicates the position of the Tn 7 site. (B) The up- and downstream segments are amplified with the indicated primers using pKV502 and pKV503 as templates, as shown, or similar templates, while the GOI is typically amplified from chromosomal DNA. (C) The PCR SOE product (top) recombines into the chromosome (middle), as indicated by the crossed lines, resulting in the insertion (bottom).

    Techniques Used: Introduce, Amplification, Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: Light-activated cell identification and sorting (LACIS) for selection of edited clones on a nanofluidic device
    Article Snippet: Genomic DNA was extracted from exported clones by incubating in Proteinase K buffer (0.1 M NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA) for 30 min at 55 °C, then for 20 min at 80 °C to inactivate Proteinase K. The genomic region around the CRISPR/Cas9 target site for CXCR4 gene was amplified by PCR with primers positioned outside of the HDR repair template sequence (positioned to avoid amplification of exogenous template) for ten cycles using KAPA HiFi Hotstart ReadyMix (Kapa Biosystems, KR0370) according to the manufacturer’s protocol (PCR primers listed in Supplementary Data ). .. PCR products of the expected size were isolated with Select-A-Size DNA Clean and Concentrator (Zymo research, D4080) as sequencing libraries.

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: The mammalian expression vector pCMV3-untagged (from Sino Biological) was used and the cloning sites are Hpa I (5’) and EcoR V (3’). .. PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research).

    Amplification:

    Article Title: Rapid and highly-specific generation of targeted DNA sequencing libraries enabled by linking capture probes with universal primers
    Article Snippet: An additional cleanup with the Zymo Select-a-Size DNA Clean & Concentrator column (Zymo Research) was performed, as per the manufacturer’s instructions. .. After cleanup, the entire volume of ligated DNA was amplified with custom primers TTTTTAGCACGCACCGAGATCTACAC and TTTTTCCGCTGAGTTACGAGATCGGT .

    Article Title: Light-activated cell identification and sorting (LACIS) for selection of edited clones on a nanofluidic device
    Article Snippet: Amplicon pools were re-amplified by PCR for 15 cycles using a universal primer to add the sequencing adaptor and secondary barcodes to allow parallel sequencing of multiple amplicon pools (Primer sequences are listed in Supplementary Data ). .. PCR products of the expected size were isolated with Select-A-Size DNA Clean and Concentrator (Zymo research, D4080) as sequencing libraries.

    Article Title: Microbial community shifts in the oxic-settling-anoxic process in response to changes to sludge interchange ratio
    Article Snippet: The 16S primers used amplified the V3-V4 region of the 16S rRNA gene. .. The final pooled library was cleaned up with Select-a-Size DNA Clean & Concentrator™ (Zymo Research, Irvine, CA), then quantified with TapeStation® and Qubit®.

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: Mouse IgG1 Fc gene were amplified from the cDNA of a mouse hybridoma secreted an antibody with IgG1 isotype (mAb17). .. PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research).

    Construct:

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research). .. All pCMV3 expression constructs were verified by DNA Sanger sequencing.

    Real-time Polymerase Chain Reaction:

    Article Title: Microbial community shifts in the oxic-settling-anoxic process in response to changes to sludge interchange ratio
    Article Snippet: The PCR products are quantified with qPCR fluorescence readings and pooled together based on equal molarity. .. The final pooled library was cleaned up with Select-a-Size DNA Clean & Concentrator™ (Zymo Research, Irvine, CA), then quantified with TapeStation® and Qubit®.

    Incubation:

    Article Title: Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair
    Article Snippet: .. Each reaction was incubated for 15 min at 37 °C, after which DNA was isolated from reaction mixtures and recovered using Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA). .. Secondary in vitro HDR reactions included DNA recovered from the initial cleavage reaction, 100 pmol of single-stranded donor DNA (Integrated DNA Technologies, Coralville, Iowa) 1364-S 5′-GACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGGCGGCCGCTTTTACAACGTCGTGACTGGGAAAACC-3′ or 1364-NS 5′-GGTTTTCCCAGTCACGACGTTGTAAAAGCGGCCGCCGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTC-3′ and 175 µg of cell-free extract supplemented with 400 cohesive end units of Quick T4 Ligase (New England Biolabs, Ipswich, MA) in a reaction buffer (20 mM TRIS, 15 mM MgCl2 , 0.4 mM DTT and 1.0 mM ATP) at a final volume of 25 µl.

    Article Title: Detection of spacer precursors formed in vivo during primed CRISPR adaptation
    Article Snippet: The upper DNA-containing fraction was transferred to a fresh tube; 0.2 M NaCl, 15 μg/ml of Glycoblue (Invitrogen) and two volumes of cold 100% ethanol were added, and the solution was incubated at −80 °C overnight. .. DNA fragments < 700 bp in length were isolated from 9 μg of total genomic DNA using a Select-a-Size DNA Clean & Concentrator kit (Zymo Research) according to manufacturer’s recommendations.

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: ∼0.5 pmole of fragmented gDNA (165 ng ∼500-bp DNA) was subjected to a 30 µL end-repair/dA-tailing reaction using the NEBNext Ultra II End Repair/dA-Tailing Module (NEB, Cat. E7546L) as detailed above with addition of 3 mM dATP after 5min incubation at 20°, followed by 5 min incubation at 65°. .. A Select-a-Size DNA Clean & Concentrator (Zymo, Cat. D4080) was used to purify each end-repair/dA-tail reaction following the manufacturer’s protocol.

    Expressing:

    Article Title: Complex Mammalian-like Hematopoietic System Found in a Colonial Chordate
    Article Snippet: The endostyle epithelium consists of eight distinct anatomical zones, each defined by a specific gene expression profile , , , . .. Size selection was performed prior to barcoding using Zymo Research Select-a-Size DNA Clean and Concentrator Kit (D4080); Libraries were barcoded using NEBnext Ultra DNA Library Prep Kit Master for Illumina (New England Biolabs, E7370S) and NEBNext Multiplex Oligos for Illumina (New England Biolabs, E6609S).

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: Paragraph title: Expression and purification of Sema domains of PLXNB1, PLXNB2, and PLXNB3 ... PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research).

    Modification:

    Article Title: Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair
    Article Snippet: Each reaction was incubated for 15 min at 37 °C, after which DNA was isolated from reaction mixtures and recovered using Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA). .. Modified plasmid DNA from the final reaction mixture was then isolated and purified during spin column recovery.

    Transformation Assay:

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research). .. After digestion of pCMV3 plasmid with Hpa I andd EcoR V-HF®, a band of ~6.1 kb was purified from agarose-TAE gel, transformed into competent DH5α competent bacteria, plated on LB-agar plates with ampicillin selection reagent.

    Flow Cytometry:

    Article Title: Bioengineered Noncoding RNAs Selectively Change Cellular miRNome Profiles for Cancer Therapy
    Article Snippet: Target BERA was purified on small scale using spin columns: RNA Clean & Concentrator and Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA). .. Separation of nCAR/sRNA from total RNAs was achieved on an Enrich-Q 10 × 100 column that was first equilibrated with Buffer A (10 mM sodium phosphate, pH 7.0) at a constant flow rate of 2.5 ml/min for 2 minutes and then followed by a gradient elution at the same flow rate: 55% Buffer B (Buffer A + 1 M sodium chloride, pH 7.0) for 4.8 minutes, 55%–75% Buffer B for 20.4 minutes, and then 100% Buffer B for 9.6 minutes.

    Ligation:

    Article Title: Rapid and highly-specific generation of targeted DNA sequencing libraries enabled by linking capture probes with universal primers
    Article Snippet: Paragraph title: Adapter ligation ... An additional cleanup with the Zymo Select-a-Size DNA Clean & Concentrator column (Zymo Research) was performed, as per the manufacturer’s instructions.

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: A Select-a-Size DNA Clean & Concentrator (Zymo, Cat. D4080) was used to purify each end-repair/dA-tail reaction following the manufacturer’s protocol. .. A 1D native barcoding kit (Oxford Nanopore, EXP-NBD103) and a 1D Ligation Sequencing Kit (Oxford Nanopore, SQK-LSK108) were used for library preparation.

    Generated:

    Article Title: Detection of spacer precursors formed in vivo during primed CRISPR adaptation
    Article Snippet: Paragraph title: Isolation of DNA fragments generated in vivo ... DNA fragments < 700 bp in length were isolated from 9 μg of total genomic DNA using a Select-a-Size DNA Clean & Concentrator kit (Zymo Research) according to manufacturer’s recommendations.

    Polymerase Chain Reaction:

    Article Title: Light-activated cell identification and sorting (LACIS) for selection of edited clones on a nanofluidic device
    Article Snippet: .. PCR products of the expected size were isolated with Select-A-Size DNA Clean and Concentrator (Zymo research, D4080) as sequencing libraries. .. Pooled barcoded libraries were sequenced with 300 bp paired-end reads on a MiSeq (Illumina) instrument using the 300 cycles v3 reagent kit (Illumina).

    Article Title: Microbial community shifts in the oxic-settling-anoxic process in response to changes to sludge interchange ratio
    Article Snippet: The PCR products are quantified with qPCR fluorescence readings and pooled together based on equal molarity. .. The final pooled library was cleaned up with Select-a-Size DNA Clean & Concentrator™ (Zymo Research, Irvine, CA), then quantified with TapeStation® and Qubit®.

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: .. PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research). .. After digestion of pCMV3 plasmid with Hpa I andd EcoR V-HF®, a band of ~6.1 kb was purified from agarose-TAE gel, transformed into competent DH5α competent bacteria, plated on LB-agar plates with ampicillin selection reagent.

    Binding Assay:

    Article Title: Rapid and highly-specific generation of targeted DNA sequencing libraries enabled by linking capture probes with universal primers
    Article Snippet: An additional cleanup with the Zymo Select-a-Size DNA Clean & Concentrator column (Zymo Research) was performed, as per the manufacturer’s instructions. .. A 5:1 binding buffer to ethanol ratio was used to select the desired product size.

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: A Select-a-Size DNA Clean & Concentrator (Zymo, Cat. D4080) was used to purify each end-repair/dA-tail reaction following the manufacturer’s protocol. .. 156 µL size selection mix (500 µL Select-a-Size DNA binding buffer + 5 µL 100% ethanol, can be scaled up for more reactions) was added to each end-repair/dA-tailing reaction tube and gently mixed by pipetting.

    Multiplexing:

    Article Title: Rapid and highly-specific generation of targeted DNA sequencing libraries enabled by linking capture probes with universal primers
    Article Snippet: Custom ligation adapter sequences were ordered for the LTC workflow (IDT), consisting of AGCACGCACCGAGATCTACAC BBBB ACACTCTTTCCCTACACGACGCTCTTCCGATCTT annealed to AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC BBBBNNNN ACCGATCTCGTAACTCAGCGG , where BBBB indicates a four base sample-specific barcode for multiplexing samples on the sequencer, and NNNN indicates a four base UMI. .. An additional cleanup with the Zymo Select-a-Size DNA Clean & Concentrator column (Zymo Research) was performed, as per the manufacturer’s instructions.

    In Vivo:

    Article Title: Detection of spacer precursors formed in vivo during primed CRISPR adaptation
    Article Snippet: Paragraph title: Isolation of DNA fragments generated in vivo ... DNA fragments < 700 bp in length were isolated from 9 μg of total genomic DNA using a Select-a-Size DNA Clean & Concentrator kit (Zymo Research) according to manufacturer’s recommendations.

    RNA Sequencing Assay:

    Article Title: Complex Mammalian-like Hematopoietic System Found in a Colonial Chordate
    Article Snippet: Resultant RNA was cleaned and concentrated (Zymo Research RNA Clean and Concentrator-5, R1015) and analyzed by an Agilent 2100 Bioanalyzer for quality analysis prior to library preparation. cDNA libraries were then prepared from high quality samples (RIN > 8) using Ovation RNA-seq v2(Nugen). .. Size selection was performed prior to barcoding using Zymo Research Select-a-Size DNA Clean and Concentrator Kit (D4080); Libraries were barcoded using NEBnext Ultra DNA Library Prep Kit Master for Illumina (New England Biolabs, E7370S) and NEBNext Multiplex Oligos for Illumina (New England Biolabs, E6609S).

    Fluorescence:

    Article Title: Microbial community shifts in the oxic-settling-anoxic process in response to changes to sludge interchange ratio
    Article Snippet: The PCR products are quantified with qPCR fluorescence readings and pooled together based on equal molarity. .. The final pooled library was cleaned up with Select-a-Size DNA Clean & Concentrator™ (Zymo Research, Irvine, CA), then quantified with TapeStation® and Qubit®.

    Isolation:

    Article Title: Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair
    Article Snippet: .. Each reaction was incubated for 15 min at 37 °C, after which DNA was isolated from reaction mixtures and recovered using Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA). .. Secondary in vitro HDR reactions included DNA recovered from the initial cleavage reaction, 100 pmol of single-stranded donor DNA (Integrated DNA Technologies, Coralville, Iowa) 1364-S 5′-GACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGGCGGCCGCTTTTACAACGTCGTGACTGGGAAAACC-3′ or 1364-NS 5′-GGTTTTCCCAGTCACGACGTTGTAAAAGCGGCCGCCGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTC-3′ and 175 µg of cell-free extract supplemented with 400 cohesive end units of Quick T4 Ligase (New England Biolabs, Ipswich, MA) in a reaction buffer (20 mM TRIS, 15 mM MgCl2 , 0.4 mM DTT and 1.0 mM ATP) at a final volume of 25 µl.

    Article Title: Light-activated cell identification and sorting (LACIS) for selection of edited clones on a nanofluidic device
    Article Snippet: .. PCR products of the expected size were isolated with Select-A-Size DNA Clean and Concentrator (Zymo research, D4080) as sequencing libraries. .. Pooled barcoded libraries were sequenced with 300 bp paired-end reads on a MiSeq (Illumina) instrument using the 300 cycles v3 reagent kit (Illumina).

    Article Title: Detection of spacer precursors formed in vivo during primed CRISPR adaptation
    Article Snippet: .. DNA fragments < 700 bp in length were isolated from 9 μg of total genomic DNA using a Select-a-Size DNA Clean & Concentrator kit (Zymo Research) according to manufacturer’s recommendations. ..

    Article Title: Bioengineered Noncoding RNAs Selectively Change Cellular miRNome Profiles for Cancer Therapy
    Article Snippet: Target BERA was purified on small scale using spin columns: RNA Clean & Concentrator and Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA). .. RNA was isolated following the protocols suggested for > 200 nt (RNA Clean & Concentrator) sequentially followed by a 50-bp cutoff protocol (Select-a-Size DNA Clean & Concentrator).

    Article Title: Bioengineered Noncoding RNAs Selectively Change Cellular miRNome Profiles for Cancer Therapy
    Article Snippet: .. Since the nCAR system generally offers BERAs (e.g., nCAR/miR-34a-5p and nCAR/miR-124-3p, etc.) around a length of 180 nt, we assessed whether target BERAs could be isolated with commercially available Select-a-Size DNA Clean & Concentrator ( ) based on similar physicochemical properties of nucleic acids. .. The 50-bp selection was able to produce > 88% pure BERA (determined by HPLC method) with a yield of 15–20 μ ).

    Transfection:

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research). .. To express PLXNB (SEMA)-mIgG1 Fc fusion proteins, pCMV3 expression plasmids were purified and transfected into FreeStyle™ 293-F Cells (Thermo Fisher Scientific) at a cell density of 0.75 × 106 viable cells/ml and plasmid concentration of 1 μg/mL with 3 μg/mL PEI 25000 (Polysciences) plasmids.

    Purification:

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: .. A Select-a-Size DNA Clean & Concentrator was used to perform a quick column-based reaction purification and size selection for short fragments < 400 bp. .. Addition of 5 µL 100% ethanol to 500 A Select-a-Size DNA binding buffer discards fragments < 400 bp while retaining fragments ≥400 bp efficiently (data not shown).

    Article Title: Rapid and highly-specific generation of targeted DNA sequencing libraries enabled by linking capture probes with universal primers
    Article Snippet: After ligation, the ligation mixture was purified using the Agencourt AMPure XP Kit (Beckman Coulter) as per manufacturer’s specification, with a 0.4:1 bead to sample volumetric ratio, and eluted in 40 μL of 0.1x IDTE. .. An additional cleanup with the Zymo Select-a-Size DNA Clean & Concentrator column (Zymo Research) was performed, as per the manufacturer’s instructions.

    Article Title: Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair
    Article Snippet: RNP complexes consisted of purified AsCas12a or SpCas9 protein (Integrated DNA Technologies, Coralville, Iowa) and site-specific crRNA (Integrated DNA Technologies, Coralville, Iowa). .. Each reaction was incubated for 15 min at 37 °C, after which DNA was isolated from reaction mixtures and recovered using Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA).

    Article Title: Bioengineered Noncoding RNAs Selectively Change Cellular miRNome Profiles for Cancer Therapy
    Article Snippet: .. Target BERA was purified on small scale using spin columns: RNA Clean & Concentrator and Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA). .. RNA was isolated following the protocols suggested for > 200 nt (RNA Clean & Concentrator) sequentially followed by a 50-bp cutoff protocol (Select-a-Size DNA Clean & Concentrator).

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: .. PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research). .. After digestion of pCMV3 plasmid with Hpa I andd EcoR V-HF®, a band of ~6.1 kb was purified from agarose-TAE gel, transformed into competent DH5α competent bacteria, plated on LB-agar plates with ampicillin selection reagent.

    Sequencing:

    Article Title: Light-activated cell identification and sorting (LACIS) for selection of edited clones on a nanofluidic device
    Article Snippet: .. PCR products of the expected size were isolated with Select-A-Size DNA Clean and Concentrator (Zymo research, D4080) as sequencing libraries. .. Pooled barcoded libraries were sequenced with 300 bp paired-end reads on a MiSeq (Illumina) instrument using the 300 cycles v3 reagent kit (Illumina).

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: Paragraph title: Rapid multiplex MinION Sequencing library preparation ... A Select-a-Size DNA Clean & Concentrator (Zymo, Cat. D4080) was used to purify each end-repair/dA-tail reaction following the manufacturer’s protocol.

    Article Title: Microbial community shifts in the oxic-settling-anoxic process in response to changes to sludge interchange ratio
    Article Snippet: 16S ribosomal RNA gene targeted sequencing was performed using the Quick-16S™ NGS Library Preparation Kit (Zymo Research, Irvine, CA). .. The final pooled library was cleaned up with Select-a-Size DNA Clean & Concentrator™ (Zymo Research, Irvine, CA), then quantified with TapeStation® and Qubit®.

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research). .. All pCMV3 expression constructs were verified by DNA Sanger sequencing.

    Selection:

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: .. A Select-a-Size DNA Clean & Concentrator was used to perform a quick column-based reaction purification and size selection for short fragments < 400 bp. .. Addition of 5 µL 100% ethanol to 500 A Select-a-Size DNA binding buffer discards fragments < 400 bp while retaining fragments ≥400 bp efficiently (data not shown).

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: A Select-a-Size DNA Clean & Concentrator (Zymo, Cat. D4080) was used to purify each end-repair/dA-tail reaction following the manufacturer’s protocol. .. 156 µL size selection mix (500 µL Select-a-Size DNA binding buffer + 5 µL 100% ethanol, can be scaled up for more reactions) was added to each end-repair/dA-tailing reaction tube and gently mixed by pipetting.

    Article Title: Complex Mammalian-like Hematopoietic System Found in a Colonial Chordate
    Article Snippet: .. Size selection was performed prior to barcoding using Zymo Research Select-a-Size DNA Clean and Concentrator Kit (D4080); Libraries were barcoded using NEBnext Ultra DNA Library Prep Kit Master for Illumina (New England Biolabs, E7370S) and NEBNext Multiplex Oligos for Illumina (New England Biolabs, E6609S). .. Barcoded library samples were then sequenced on an Illumina NextSeq 500 (2×150bp, producing an average of 15 million reads/cell population).

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research). .. After digestion of pCMV3 plasmid with Hpa I andd EcoR V-HF®, a band of ~6.1 kb was purified from agarose-TAE gel, transformed into competent DH5α competent bacteria, plated on LB-agar plates with ampicillin selection reagent.

    Fast Protein Liquid Chromatography:

    Article Title: Bioengineered Noncoding RNAs Selectively Change Cellular miRNome Profiles for Cancer Therapy
    Article Snippet: Target BERA was purified on small scale using spin columns: RNA Clean & Concentrator and Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA). .. Large-scale purification of target BERA was performed with a NGC QUEST 10PLUS fast protein liquid chromatography system (Bio-Rad) equipped with an anion exchange Enrich-Q 10 × 100 column (Bio-Rad).

    CRISPR:

    Article Title: Light-activated cell identification and sorting (LACIS) for selection of edited clones on a nanofluidic device
    Article Snippet: Genomic DNA was extracted from exported clones by incubating in Proteinase K buffer (0.1 M NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA) for 30 min at 55 °C, then for 20 min at 80 °C to inactivate Proteinase K. The genomic region around the CRISPR/Cas9 target site for CXCR4 gene was amplified by PCR with primers positioned outside of the HDR repair template sequence (positioned to avoid amplification of exogenous template) for ten cycles using KAPA HiFi Hotstart ReadyMix (Kapa Biosystems, KR0370) according to the manufacturer’s protocol (PCR primers listed in Supplementary Data ). .. PCR products of the expected size were isolated with Select-A-Size DNA Clean and Concentrator (Zymo research, D4080) as sequencing libraries.

    Plasmid Preparation:

    Article Title: Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair
    Article Snippet: In vitro reaction conditions In vitro DNA cleavage reaction mixtures consisted of 500 ng (0.014 µM) of pHSG299 (Takara Bio Company, Shiga, Japan) plasmid DNA and 10 pmol RNP in a reaction buffer (100 mM NaCl, 20 mM Tris-HCl, 10 mM MgCl2 and 100 µg/ml BSA) at a final volume of 20 µl. .. Each reaction was incubated for 15 min at 37 °C, after which DNA was isolated from reaction mixtures and recovered using Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA).

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: The templates of PLXNB1, PLXNB2, and PLXNB3 gene were the expression vector pCI-neo carrying the PLXNBs whole genes as described above. .. PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research).

    Multiplex Assay:

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: Paragraph title: Rapid multiplex MinION Sequencing library preparation ... A Select-a-Size DNA Clean & Concentrator (Zymo, Cat. D4080) was used to purify each end-repair/dA-tail reaction following the manufacturer’s protocol.

    Article Title: Complex Mammalian-like Hematopoietic System Found in a Colonial Chordate
    Article Snippet: .. Size selection was performed prior to barcoding using Zymo Research Select-a-Size DNA Clean and Concentrator Kit (D4080); Libraries were barcoded using NEBnext Ultra DNA Library Prep Kit Master for Illumina (New England Biolabs, E7370S) and NEBNext Multiplex Oligos for Illumina (New England Biolabs, E6609S). .. Barcoded library samples were then sequenced on an Illumina NextSeq 500 (2×150bp, producing an average of 15 million reads/cell population).

    Recombinant:

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: The signal peptide human PLXNB1, PLXNB2, PLXNB3 were kept for effective secretion of expressed recombinant protiens. .. PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research).

    In Vitro:

    Article Title: Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair
    Article Snippet: Paragraph title: In vitro reaction conditions ... Each reaction was incubated for 15 min at 37 °C, after which DNA was isolated from reaction mixtures and recovered using Select-a-Size DNA Clean & Concentrator (Zymo Research, Irvine, CA).

    Ethanol Precipitation:

    Article Title: Detection of spacer precursors formed in vivo during primed CRISPR adaptation
    Article Snippet: DNA was isolated by phenol:chloroform:isoamyl alcohol extraction and ethanol precipitation as described above. .. DNA fragments < 700 bp in length were isolated from 9 μg of total genomic DNA using a Select-a-Size DNA Clean & Concentrator kit (Zymo Research) according to manufacturer’s recommendations.

    Next-Generation Sequencing:

    Article Title: Light-activated cell identification and sorting (LACIS) for selection of edited clones on a nanofluidic device
    Article Snippet: Paragraph title: Sample processing for next-generation sequencing ... PCR products of the expected size were isolated with Select-A-Size DNA Clean and Concentrator (Zymo research, D4080) as sequencing libraries.

    Article Title: Microbial community shifts in the oxic-settling-anoxic process in response to changes to sludge interchange ratio
    Article Snippet: 16S ribosomal RNA gene targeted sequencing was performed using the Quick-16S™ NGS Library Preparation Kit (Zymo Research, Irvine, CA). .. The final pooled library was cleaned up with Select-a-Size DNA Clean & Concentrator™ (Zymo Research, Irvine, CA), then quantified with TapeStation® and Qubit®.

    Concentration Assay:

    Article Title: Plexin-B2 mediates physiologic and pathologic functions of angiogenin
    Article Snippet: PCR products were purified with the Select-A-Size DNA Clean & Concentrator kit (Zymo Research). .. To express PLXNB (SEMA)-mIgG1 Fc fusion proteins, pCMV3 expression plasmids were purified and transfected into FreeStyle™ 293-F Cells (Thermo Fisher Scientific) at a cell density of 0.75 × 106 viable cells/ml and plasmid concentration of 1 μg/mL with 3 μg/mL PEI 25000 (Polysciences) plasmids.

    Lysis:

    Article Title: Complex Mammalian-like Hematopoietic System Found in a Colonial Chordate
    Article Snippet: Dissected endostyles samples were flash frozen in liquid nitrogen to minimize RNA degradation and stored at −80 C. Using a mechanized Konte tissue grinder and pestle, samples were homogenized in the presence of lysis buffer (Qiagen RNAeasy Microkit #74004), and total RNA was extracted following the manufacturer’s protocol. .. Size selection was performed prior to barcoding using Zymo Research Select-a-Size DNA Clean and Concentrator Kit (D4080); Libraries were barcoded using NEBnext Ultra DNA Library Prep Kit Master for Illumina (New England Biolabs, E7370S) and NEBNext Multiplex Oligos for Illumina (New England Biolabs, E6609S).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Zymo Research dna clean concentrator kit
    (a) Methylation status of LC3A in 5 lung cancer cell lines and HBEC. Bisulfite sequencing (BS) showed a heterogeneous methylation pattern in the promoter region and exon 4 of the LC3A gene in lung cancer cell lines. White: unmethylated; grey: partially methylated or only one allele is methylated; black: totally methylated or two alleles are methylated. 1–6: 6 CpG sites in promoter region; 1–8: 8 CpG sites in exon 4. (b) Representative results from methylation-specific <t>PCR</t> (MSP) showing that LC3A was unmethylated in cases 1, 4, and 5 while partially methylated in cases 3, 6, 7, and 8. Case 2 was excluded for the statistical analysis (see Supplementary Table 3 ), since no PCR products were observed most probably due to degraded genomic <t>DNA.</t> U: unmethylated; M: methylated.
    Dna Clean Concentrator Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 122 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna clean concentrator kit/product/Zymo Research
    Average 95 stars, based on 122 article reviews
    Price from $9.99 to $1999.99
    dna clean concentrator kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    (a) Methylation status of LC3A in 5 lung cancer cell lines and HBEC. Bisulfite sequencing (BS) showed a heterogeneous methylation pattern in the promoter region and exon 4 of the LC3A gene in lung cancer cell lines. White: unmethylated; grey: partially methylated or only one allele is methylated; black: totally methylated or two alleles are methylated. 1–6: 6 CpG sites in promoter region; 1–8: 8 CpG sites in exon 4. (b) Representative results from methylation-specific PCR (MSP) showing that LC3A was unmethylated in cases 1, 4, and 5 while partially methylated in cases 3, 6, 7, and 8. Case 2 was excluded for the statistical analysis (see Supplementary Table 3 ), since no PCR products were observed most probably due to degraded genomic DNA. U: unmethylated; M: methylated.

    Journal: Disease Markers

    Article Title: The Clinical Influence of Autophagy-Associated Proteins on Human Lung Cancer

    doi: 10.1155/2018/8314963

    Figure Lengend Snippet: (a) Methylation status of LC3A in 5 lung cancer cell lines and HBEC. Bisulfite sequencing (BS) showed a heterogeneous methylation pattern in the promoter region and exon 4 of the LC3A gene in lung cancer cell lines. White: unmethylated; grey: partially methylated or only one allele is methylated; black: totally methylated or two alleles are methylated. 1–6: 6 CpG sites in promoter region; 1–8: 8 CpG sites in exon 4. (b) Representative results from methylation-specific PCR (MSP) showing that LC3A was unmethylated in cases 1, 4, and 5 while partially methylated in cases 3, 6, 7, and 8. Case 2 was excluded for the statistical analysis (see Supplementary Table 3 ), since no PCR products were observed most probably due to degraded genomic DNA. U: unmethylated; M: methylated.

    Article Snippet: PCR products were purified using a DNA Clean & Concentrator Kit (Zymo Research) and sequenced by capillary electrophoresis (LGC, Berlin, Germany).

    Techniques: Methylation, Methylation Sequencing, Polymerase Chain Reaction

    Evidence for rs2277862- CPNE1 as a Functional SNP-Gene Set (A) Schematics of human chromosome 20q11 locus showing the relative positions of rs2277862, CPNE1 , and ERGIC3 and mouse chromosome 2qH1 locus showing the relative positions of rs27324996, Cpne1 , and Ergic3 . (B) Top panels: heterozygous knock-in of rs2277862 minor allele with a single-strand DNA oligonucleotide. Representative indels in non-knock-in clones are also shown. Bottom panels: homozygous 38-bp deletions (“knockout” or Δ38/Δ38) encompassing rs2277862 using a dual gRNA approach. A representative agarose gel of PCR amplicons is shown. The protospacers are underlined, the PAMs are bolded, and the SNP position is indicated in red. (C) Left panels: gene expression in undifferentiated HUES 8 cells (n = 2 wild-type clones and 1 knock-in clone; 6 wells per clone) and differentiated HUES 8 HLCs (n = 2 wild-type clones and 1 knock-in clone; 6 wells per clone) normalized to mean expression level in wild-type clones. Right panels: gene expression in undifferentiated HUES 8 cells (n = 10 wild-type and 10 knockout clones, 3 wells per clone) and undifferentiated H7 cells (n = 8 wild-type and 6 knockout clones, 3 wells per clone) normalized to mean expression level in wild-type clones. (D) CRISPR interference at the rs2277862 site. The three gRNA protospacers are underlined, the PAMs are bolded, and the SNP position is indicated in red. The graphs show gene expression, normalized to mean expression level in control cells, in HEK 293T cells transfected with catalytically dead Cas9 (dCas9) with the gRNAs (either singly or in combination, 3 wells per condition). Control cells were transfected with dCas9 without an accompanying gRNA. (E) The noncoding rs2277862 site is well conserved in mouse, including allelic variants of the SNP itself, with the murine equivalent being rs27324996. The SNP position is indicated in red, non-conserved nucleotides are indicated in blue, the gRNA protospacer used to generate the knock-in mouse is underlined, and the PAM is bolded. The electropherogram is from a mouse in which the minor allele of rs2277862/rs27324996 (T) has been knocked into one chromosome, along with four non-conserved nucleotides to “humanize” the site. (F) Gene expression in liver from littermates of the C57BL/6J background (n = 18 wild-type mice and 10 homozygous knock-in mice), normalized to mean expression level in wild-type mice. Data are displayed as means and s.e.m. P -values were calculated with two-tailed Welch’s t -tests.

    Journal: Cell stem cell

    Article Title: Large diverse population cohorts of hiPSCs and derived hepatocyte-like cells reveal functional genetic variation at blood lipid-associated loci

    doi: 10.1016/j.stem.2017.03.017

    Figure Lengend Snippet: Evidence for rs2277862- CPNE1 as a Functional SNP-Gene Set (A) Schematics of human chromosome 20q11 locus showing the relative positions of rs2277862, CPNE1 , and ERGIC3 and mouse chromosome 2qH1 locus showing the relative positions of rs27324996, Cpne1 , and Ergic3 . (B) Top panels: heterozygous knock-in of rs2277862 minor allele with a single-strand DNA oligonucleotide. Representative indels in non-knock-in clones are also shown. Bottom panels: homozygous 38-bp deletions (“knockout” or Δ38/Δ38) encompassing rs2277862 using a dual gRNA approach. A representative agarose gel of PCR amplicons is shown. The protospacers are underlined, the PAMs are bolded, and the SNP position is indicated in red. (C) Left panels: gene expression in undifferentiated HUES 8 cells (n = 2 wild-type clones and 1 knock-in clone; 6 wells per clone) and differentiated HUES 8 HLCs (n = 2 wild-type clones and 1 knock-in clone; 6 wells per clone) normalized to mean expression level in wild-type clones. Right panels: gene expression in undifferentiated HUES 8 cells (n = 10 wild-type and 10 knockout clones, 3 wells per clone) and undifferentiated H7 cells (n = 8 wild-type and 6 knockout clones, 3 wells per clone) normalized to mean expression level in wild-type clones. (D) CRISPR interference at the rs2277862 site. The three gRNA protospacers are underlined, the PAMs are bolded, and the SNP position is indicated in red. The graphs show gene expression, normalized to mean expression level in control cells, in HEK 293T cells transfected with catalytically dead Cas9 (dCas9) with the gRNAs (either singly or in combination, 3 wells per condition). Control cells were transfected with dCas9 without an accompanying gRNA. (E) The noncoding rs2277862 site is well conserved in mouse, including allelic variants of the SNP itself, with the murine equivalent being rs27324996. The SNP position is indicated in red, non-conserved nucleotides are indicated in blue, the gRNA protospacer used to generate the knock-in mouse is underlined, and the PAM is bolded. The electropherogram is from a mouse in which the minor allele of rs2277862/rs27324996 (T) has been knocked into one chromosome, along with four non-conserved nucleotides to “humanize” the site. (F) Gene expression in liver from littermates of the C57BL/6J background (n = 18 wild-type mice and 10 homozygous knock-in mice), normalized to mean expression level in wild-type mice. Data are displayed as means and s.e.m. P -values were calculated with two-tailed Welch’s t -tests.

    Article Snippet: The region flanking rs27324996 was PCR amplified (F: 5′-TGGGAATGGCTTCTTAGGGC-3′ and R: 5′-CATCCCCAAGCAACTCAACC-3′) using AccuPrime Taq DNA Polymerase (Thermo Fisher Scientific) with the following cycling conditions: 94°C for 2 min, [94°C for 30 sec, 55°C for 30 sec, 68°C for 30 sec] × 40 cycles, 68°C for 5 min. PCR products were purified using the DNA Clean & Concentrator kit (Zymo Research) and analyzed for the presence of indels using the Surveyor Mutation Detection Kit (Integrated DNA Technologies) according to the manufacturer’s instructions.

    Techniques: Functional Assay, Knock-In, Clone Assay, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Expressing, Knock-Out, CRISPR, Transfection, Mouse Assay, Two Tailed Test

    Golden Gate assembly of transposon delivery vectors from part vectors. (A to E) The five part vectors that are used for Golden Gate assembly of the magic pool transposon delivery vectors: part1 vector, part2 vector, part3 vector, barcoded part4 vector, and part5 vector (not drawn to scale). We show the sequences of the 4-nucleotide overhangs for Golden Gate assembly. (F) The transposon delivery vector with DNA barcode. ColE1 is the replication origin ColE1. cat is the chloramphenicol resistance gene. GFP is green fluorescent protein. oriT is the origin of transfer. AmpR is the beta-lactam resistance gene. R6K is a conditional replication origin. N20 is random 20-nucleotide DNA barcode.

    Journal: mSystems

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria

    doi: 10.1128/mSystems.00143-17

    Figure Lengend Snippet: Golden Gate assembly of transposon delivery vectors from part vectors. (A to E) The five part vectors that are used for Golden Gate assembly of the magic pool transposon delivery vectors: part1 vector, part2 vector, part3 vector, barcoded part4 vector, and part5 vector (not drawn to scale). We show the sequences of the 4-nucleotide overhangs for Golden Gate assembly. (F) The transposon delivery vector with DNA barcode. ColE1 is the replication origin ColE1. cat is the chloramphenicol resistance gene. GFP is green fluorescent protein. oriT is the origin of transfer. AmpR is the beta-lactam resistance gene. R6K is a conditional replication origin. N20 is random 20-nucleotide DNA barcode.

    Article Snippet: The barcode PCR products were purified with the DNA Clean & Concentrator kit (Zymo Research) and included in a Golden Gate assembly reaction with either pHLL214 or pHLL215.

    Techniques: Plasmid Preparation

    Overview of the magic pool strategy. (A) Basic structure of a typical transposon delivery vector (not drawn to scale). The inverted repeat (IR) for the specific transposase is indicated. We dissected the transposon delivery vector into five different parts compatible with Golden Gate assembly, and the different parts are indicated by different colors. (B) General workflow of construction and application of magic pools. In step 1, variants of the five different parts are designed, cloned into a part-holding vector, confirmed by sequencing, and archived. In step 2, the part vectors are mixed and assembled using Golden Gate assembly to produce the magic pools of transposon delivery vectors. In step 3, the magic pool vectors are characterized by DNA sequencing whereby each unique DNA barcode (random 20-nucleotide DNA barcode [N20]) is linked to a specific combination of parts. In step 4, preliminary mutant libraries of approximately 5,000 CFU are made using the magic pool, and TnSeq is performed to link the DNA barcode to the insertion site, thereby simultaneously assessing the efficacy of the vectors in the magic pool. ID, identification. In step 5, an effective vector is reassembled using the archived parts, fully barcoded with millions of random DNA barcodes, and a full RB-TnSeq transposon mutant library is constructed. oriT is the origin of transfer. AmpR is the beta-lactam resistance cassette. R6K is the conditional replication origin.

    Journal: mSystems

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria

    doi: 10.1128/mSystems.00143-17

    Figure Lengend Snippet: Overview of the magic pool strategy. (A) Basic structure of a typical transposon delivery vector (not drawn to scale). The inverted repeat (IR) for the specific transposase is indicated. We dissected the transposon delivery vector into five different parts compatible with Golden Gate assembly, and the different parts are indicated by different colors. (B) General workflow of construction and application of magic pools. In step 1, variants of the five different parts are designed, cloned into a part-holding vector, confirmed by sequencing, and archived. In step 2, the part vectors are mixed and assembled using Golden Gate assembly to produce the magic pools of transposon delivery vectors. In step 3, the magic pool vectors are characterized by DNA sequencing whereby each unique DNA barcode (random 20-nucleotide DNA barcode [N20]) is linked to a specific combination of parts. In step 4, preliminary mutant libraries of approximately 5,000 CFU are made using the magic pool, and TnSeq is performed to link the DNA barcode to the insertion site, thereby simultaneously assessing the efficacy of the vectors in the magic pool. ID, identification. In step 5, an effective vector is reassembled using the archived parts, fully barcoded with millions of random DNA barcodes, and a full RB-TnSeq transposon mutant library is constructed. oriT is the origin of transfer. AmpR is the beta-lactam resistance cassette. R6K is the conditional replication origin.

    Article Snippet: The barcode PCR products were purified with the DNA Clean & Concentrator kit (Zymo Research) and included in a Golden Gate assembly reaction with either pHLL214 or pHLL215.

    Techniques: Plasmid Preparation, Clone Assay, Sequencing, DNA Sequencing, Mutagenesis, Construct

    PCR‐based gene mutagenesis and plasmid multimerization. A. Relevant features of the vector pNWP43N‐Bscel5. P 43 , SP nprB , Bscel5 and term represent the P 43 promoter, the NprB signal peptide‐encoding sequence, gene of family 5 endoglucanse and terminator of Bscel5 from B. subtilis respectively. ColE1 ori , repB and cat represent the sequences coding for the ColE1 replication origin, replicase and chloramphenicol resistance marker respectively. The arrows show the transcription directions for these genes. B. The flow scheme of the two‐step PCR procedure for the gene mutagenesis and plasmid multimerization. gh5 , family 5 glycoside hydrolase‐encoding sequence; cbm3 , family 3 carbohydrate‐binding module‐encoding sequence. P1, P2, P3 and P4 denote the positions of the primers for the PCR amplification. This figure was not drawn to scale. C. Plasmid multimerization by PCR. Lanes: M, DNA markers; 1, PCR‐linearized pNWP43N‐Bscel5; 2, error‐prone PCR product of SPnprB‐Bscel5 ; 3, multimerized plasmid; 4, multimer digested with PstI/HindIII.

    Journal: Microbial biotechnology

    Article Title: Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis

    doi: 10.1111/j.1751-7915.2010.00230.x

    Figure Lengend Snippet: PCR‐based gene mutagenesis and plasmid multimerization. A. Relevant features of the vector pNWP43N‐Bscel5. P 43 , SP nprB , Bscel5 and term represent the P 43 promoter, the NprB signal peptide‐encoding sequence, gene of family 5 endoglucanse and terminator of Bscel5 from B. subtilis respectively. ColE1 ori , repB and cat represent the sequences coding for the ColE1 replication origin, replicase and chloramphenicol resistance marker respectively. The arrows show the transcription directions for these genes. B. The flow scheme of the two‐step PCR procedure for the gene mutagenesis and plasmid multimerization. gh5 , family 5 glycoside hydrolase‐encoding sequence; cbm3 , family 3 carbohydrate‐binding module‐encoding sequence. P1, P2, P3 and P4 denote the positions of the primers for the PCR amplification. This figure was not drawn to scale. C. Plasmid multimerization by PCR. Lanes: M, DNA markers; 1, PCR‐linearized pNWP43N‐Bscel5; 2, error‐prone PCR product of SPnprB‐Bscel5 ; 3, multimerized plasmid; 4, multimer digested with PstI/HindIII.

    Article Snippet: Plasmid multimerization by overlap PCR The linearized pNWP43N‐Bscel5 and error‐prone PCR product were cleaned with a Zymo Research DNA Clean & Concentrator Kit.

    Techniques: Polymerase Chain Reaction, Mutagenesis, Plasmid Preparation, Sequencing, Marker, Flow Cytometry, Binding Assay, Amplification