q5  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Q5 Site Directed Mutagenesis Kit
    Description:
    Q5 Site Directed Mutagenesis Kit 10 rxns
    Catalog Number:
    e0554s
    Price:
    197
    Size:
    10 rxns
    Category:
    PCR Mutagenesis Kits
    Buy from Supplier


    Structured Review

    New England Biolabs q5
    Q5 Site Directed Mutagenesis Kit
    Q5 Site Directed Mutagenesis Kit 10 rxns
    https://www.bioz.com/result/q5/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    q5 - by Bioz Stars, 2020-10
    99/100 stars

    Images

    Related Articles

    Molecular Cloning:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Transfection:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Luciferase:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    In Vitro:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Clone Assay:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Mutagenesis:

    Article Title: Comparative RNA sequencing reveals that HPV16 E6 abrogates the effect of E6*I on ROS metabolism
    Article Snippet: .. The pXJ40βGlo∆int vector was generated from the pXJ40 vector, using Q5Site-Directed Mutagenesis Kit (New England Biolabs) and the following primers 5′-CTCCTGGGCAACGTG-3′ and 5′-CCTGAAGTTCTCAGGATCG-3′. .. The pXJ40-E6*I vector, lacking the intron 1 located in the E6 ORF corresponding to the nucleotides from 227 to 408 was generated from the pXJ40-E6All vector (Primers: 5′-GTGTATTAACTGTCAAAAGCC-3′ and 5′-CTCACGTCGCAGTAACTG-3′).

    Article Title: Mitochondrial Ferredoxin Determines Vulnerability of Cells to Copper Excess
    Article Snippet: .. A C-terminal HA tag was added by site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) in conjunction with Phusion DNA polymerase. .. The Leu-142 or Met-129 codons were replaced with a valine codon by site-directed mutagenesis using the Q5 kit with pRS315- YAH1-HA as the PCR template.

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Construct:

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    Sequencing:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Generated:

    Article Title: Comparative RNA sequencing reveals that HPV16 E6 abrogates the effect of E6*I on ROS metabolism
    Article Snippet: .. The pXJ40βGlo∆int vector was generated from the pXJ40 vector, using Q5Site-Directed Mutagenesis Kit (New England Biolabs) and the following primers 5′-CTCCTGGGCAACGTG-3′ and 5′-CCTGAAGTTCTCAGGATCG-3′. .. The pXJ40-E6*I vector, lacking the intron 1 located in the E6 ORF corresponding to the nucleotides from 227 to 408 was generated from the pXJ40-E6All vector (Primers: 5′-GTGTATTAACTGTCAAAAGCC-3′ and 5′-CTCACGTCGCAGTAACTG-3′).

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Polymerase Chain Reaction:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Derivative Assay:

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    Modification:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Binding Assay:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Plasmid Preparation:

    Article Title: Comparative RNA sequencing reveals that HPV16 E6 abrogates the effect of E6*I on ROS metabolism
    Article Snippet: .. The pXJ40βGlo∆int vector was generated from the pXJ40 vector, using Q5Site-Directed Mutagenesis Kit (New England Biolabs) and the following primers 5′-CTCCTGGGCAACGTG-3′ and 5′-CCTGAAGTTCTCAGGATCG-3′. .. The pXJ40-E6*I vector, lacking the intron 1 located in the E6 ORF corresponding to the nucleotides from 227 to 408 was generated from the pXJ40-E6All vector (Primers: 5′-GTGTATTAACTGTCAAAAGCC-3′ and 5′-CTCACGTCGCAGTAACTG-3′).

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs q5 dna high fidelity polymerase
    Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and <t>Q5</t> DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).
    Q5 Dna High Fidelity Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1569 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 dna high fidelity polymerase/product/New England Biolabs
    Average 99 stars, based on 1569 article reviews
    Price from $9.99 to $1999.99
    q5 dna high fidelity polymerase - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and Q5 DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: DNA synthesis from diphosphate substrates by DNA polymerases

    doi: 10.1073/pnas.1712193115

    Figure Lengend Snippet: Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and Q5 DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).

    Article Snippet: Taq DNA polymerase, Phusion High-Fidelity DNA polymerase, DeepVent DNA polymerase, Vent DNA polymerase, Q5 DNA High-Fidelity polymerase, Bst polymerase, Bsu DNA polymerase (large fragment), and ThermoPol Reaction Buffer [1×: 20 mM Tris⋅HCl, 10 mM (NH4 )2 SO4 , 10 mM KCl, 2 mM MgSO4 , 0.1% Triton–X–100, pH 8.8 at 25 °C] were purchased from New England Biolabs.

    Techniques: Polymerase Chain Reaction, Amplification

    Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Journal: Molecular Oncology

    Article Title: Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer

    doi: 10.1002/1878-0261.12305

    Figure Lengend Snippet: Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Article Snippet: To increase the sensitivity of the analysis, the remaining 75 μL serum DNA was subjected to 12 cycles of PCR pre‐amplification with Q5 High‐Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA) using a multiplex PIK3CA primer mix.

    Techniques: Mutagenesis, Amplification

    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Journal: Bio-protocol

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome

    doi: 10.21769/BioProtoc.2272

    Figure Lengend Snippet: PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Article Snippet: The PCR program used to linearize pPB41 is: PCR amplify CRISPR/Cas9 using plasmid generated in step B1 ( ) Amplify plasmid generated in step B1 (pPB43 in the example) via PCR using Q5 DNA polymerase (NEB) and primers oPEB232 and oPEB234.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Mutagenesis, Plasmid Preparation