q5  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Q5 Reaction Buffer Pack
    Description:
    Q5 Reaction Buffer Pack 6 0 ml
    Catalog Number:
    b9027s
    Price:
    27
    Size:
    6 0 ml
    Category:
    Buffers
    Buy from Supplier
    Name:
    Q5 High Fidelity DNA Polymerase
    Description:
    Q5 High Fidelity DNA Polymerase 500 units
    Catalog Number:
    m0491l
    Price:
    432
    Size:
    500 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs q5
    Q5 High Fidelity DNA Polymerase
    Q5 High Fidelity DNA Polymerase 500 units
    https://www.bioz.com/result/q5/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    q5 - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. A 754-bp SalI/NotI fragment was cloned into pGEX-4T-3 (Novagen) to be expressed as a glutathione S -transferase–AlgR (GST-AlgR) fusion protein.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: .. The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. Site-directed mutagenesis was performed using the algRD54XbaIF/algRD54NR primers for the D54N allele or the algRD54EF/algRD54ER primer pair for the D54E mutation.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. The following constructs were amplified, cloned (with an N-terminal double Strep 2-tag), verified by sequencing, expressed and purified: Net4LN-LE1-2—γ1LEa3-4 (Net4 aa: 20-394 fused to laminin γ1 aa: 396-492), Net4LN-LE1—γ1LEa2-4 (Net4 aa: 20-331 fused to laminin γ1 aa: 340-492), γ1LN-LEa1—Net4LE2-31 /2 (Laminin γ1 aa: 44-339 fused to Net4 aa: 332-462) and Net4-ΔC—N-term agrin (NP_067295, aa: 20-462, E195A, R199A, fused to NP_067617, aa: 33–164).

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Paragraph title: Cloning of rap-1, rap-2 and mig-15 ... Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast
    Article Snippet: Module library construction To generate individual modules we amplified the specific DNA sequence of interest by PCR using primers (Figs and ) that contain 25 bp of the multiple cloning site (MCS) of pUC57 followed by the BsaI restriction site, a specific 4 bp overhang ( and ), which determines the cloning position. .. PCR products were amplified by PCR using the Q5 (NEB) high-fidelity polymerase following standard conditions.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB).

    Amplification:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag. ..

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: .. The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. A 754-bp SalI/NotI fragment was cloned into pGEX-4T-3 (Novagen) to be expressed as a glutathione S -transferase–AlgR (GST-AlgR) fusion protein.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: .. The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. Site-directed mutagenesis was performed using the algRD54XbaIF/algRD54NR primers for the D54N allele or the algRD54EF/algRD54ER primer pair for the D54E mutation.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. The following constructs were amplified, cloned (with an N-terminal double Strep 2-tag), verified by sequencing, expressed and purified: Net4LN-LE1-2—γ1LEa3-4 (Net4 aa: 20-394 fused to laminin γ1 aa: 396-492), Net4LN-LE1—γ1LEa2-4 (Net4 aa: 20-331 fused to laminin γ1 aa: 340-492), γ1LN-LEa1—Net4LE2-31 /2 (Laminin γ1 aa: 44-339 fused to Net4 aa: 332-462) and Net4-ΔC—N-term agrin (NP_067295, aa: 20-462, E195A, R199A, fused to NP_067617, aa: 33–164).

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag. ..

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast
    Article Snippet: .. PCR products were amplified by PCR using the Q5 (NEB) high-fidelity polymerase following standard conditions. .. The product of this first PCR was then used as a megaprimer to insert the target sequence into the pUC-57 destination vector through a second, PCR.

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. ..

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB).

    Synthesized:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: In vitro transcription of single guide RNAs for the CRISPR/Cas9 system Template guide DNA was first synthesized by Integrated DNA Technologies in the form of a gBlock. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    Construct:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: To construct the tyrosine-tagged Sso Pox, the gBlock was amplified using F-Sso Pox and Sso PoxR-Tyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. The algZ mutant was constructed using the algZHSDMF/algZHSDMR primers.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. ..

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: To construct the tyrosine-tagged Sso Pox, the gBlock was amplified using F- Sso Pox and Sso PoxR-Tyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Real-time Polymerase Chain Reaction:

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB). .. Library quality was determined using a BioAnalyzer2000, and quantification was performed via qPCR using KAPA Library Quantification Kits (Illumina) followed by Illumina sequencing using the MiSeq and Hiseq2500 platforms; the sequences and processed data are available from the NCBI GEO repository (Accession no.: [GEO: GSE87165]).

    IA:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: SsoPox Expression Plasmids The Sso Pox genetic sequence was optimized for E. coli using the IDT codon optimization tool and the gBlock and primers for insertion into pET200 plasmid were ordered from IDT (Coralville, IA, USA). .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The Sso Pox genetic sequence was optimized for E. coli using the IDT codon optimization tool and the gBlock and primers for insertion into pET200 plasmid were ordered from IDT (Coralville, IA, USA). .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Incubation:

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. The resulting plasmid (pGEX-4TAlgR) was transformed into E. coli BL21(DE3) (NEB) cells and incubated overnight.

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: Fragmented DNA and UDP-azide-glucose were incubated overnight with T4 BGT (NEB) at 37 °C followed by biotin conjugation. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB).

    Expressing:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: Paragraph title: 4.1. SsoPox Expression Plasmids ... The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. The colonies from this transformation were collected, inoculated into LB supplemented with 100 μg/ml ampicillin, and grown to an optical density at 600 nm (OD600 ) of 0.6; 0.2 mM isopropyl-β- d -galactopyranoside (IPTG) was added to induce AlgR expression for 4 h at 15°C.

    Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein
    Article Snippet: Plasmid pET-15b expressing a His6 -tagged version of the human RAD51 protein was a generous gift from Dr. Hitoshi Kurumizaka at Waseda University, Japan. .. The F86L and E258A mutations were introduced separately using the Q5 (New England Biolabs) site-directed mutagenesis protocol.

    Transformation Assay:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag. .. After transformation into E. coli BL21(DE3) pLysS cells, the enzymes Sso Pox-Tyr (MW: 39.694 kDa) and Sso Pox-Gln (MW: 38.719 kDa) were expressed and purified.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. The resulting plasmid (pGEX-4TAlgR) was transformed into E. coli BL21(DE3) (NEB) cells and incubated overnight.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag. .. After transformation into E. coli BL21(DE3) pLysS cells, the enzymes Sso Pox-Tyr (MW: 39.694 kDa) and Sso Pox-Gln (MW: 38.719 kDa) were expressed and purified.

    Gel Purification:

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol. .. Depending on PCR purity, either gel purification (QIAquick Gel Extraction Kit, Qiagen, Hilden, Germany) or PCR purification (QIAquick PCR Purification Kit, Qiagen, Hilden, Germany) were used to clean up the products.

    Conjugation Assay:

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: Fragmented DNA and UDP-azide-glucose were incubated overnight with T4 BGT (NEB) at 37 °C followed by biotin conjugation. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB).

    Flow Cytometry:

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. DNA libraries were purified with a PCR purification kit (Qiagen) and sequenced on Ion Torrent PGM 318 chip, 400 flow.

    Ligation:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Biotinylated products were collected on streptavidin beads (Life Technologies 11205D), washed, and re-suspended in a ligation mastermix, containing 25% w/v PEG8000 (Sigma 89510-250G-F), 1 μM ssAdapter, 1 mM Co(NH2 )6 Cl3 (Sigma H7891-5G), 1 × T4 ligation buffer and 20 U T4 ligase (NEB), for 16 h at 25 °C and 300 rpm shaking. .. Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pH Sso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Generated:

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. ..

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB). .. For paired-end reads, BAM files were generated from PE75 reads mapped by Bowtie2.

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: Two-step assembly: preparation of fragments For each DNA fragment to be assembled, two PCR products were generated: one with primers LF and SR, the other with primers SF and LR. .. PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol.

    Polymerase Chain Reaction:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: .. The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. A 754-bp SalI/NotI fragment was cloned into pGEX-4T-3 (Novagen) to be expressed as a glutathione S -transferase–AlgR (GST-AlgR) fusion protein.

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: .. Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. One microliter of this PCR reaction was used as a template in a subsequent reaction: 50 μl Q5 PCR reaction with 0.2 μM P1trunc and 0.2 μM IonTorrent_index primers—98 °C/30”, 10 × (98 °C/10”, 61 °C/10”, 72 °C/1’), 10 × (98 °C/10”, 69 °C/10”, 72 °C/1’), 72 °C/2’.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. ..

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pH Sso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments. .. Amplified fragments were cloned into the Asc I and Kpn I sites of pSM vector using SLiCE method , Gibson assembly ( ) or T4 ligase (NEB).

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: .. PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol. .. Depending on PCR purity, either gel purification (QIAquick Gel Extraction Kit, Qiagen, Hilden, Germany) or PCR purification (QIAquick PCR Purification Kit, Qiagen, Hilden, Germany) were used to clean up the products.

    Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast
    Article Snippet: .. PCR products were amplified by PCR using the Q5 (NEB) high-fidelity polymerase following standard conditions. .. The product of this first PCR was then used as a megaprimer to insert the target sequence into the pUC-57 destination vector through a second, PCR.

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. ..

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB). .. Mutant strains were constructed using homologous recombination, as described above, and were checked using PCR and the algRintF/algRintR primer pair and digestion with the appropriate restriction enzyme.

    Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein
    Article Snippet: The F86L and E258A mutations were introduced separately using the Q5 (New England Biolabs) site-directed mutagenesis protocol. .. PCR reactions were carried out according to the Q5 protocol and the resulting plasmids were sequenced at the University of Vermont Cancer Center DNA Analysis Facility to verify successful mutagenesis.

    Sequencing:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The primer sequences and the gBlock sequence are found in . .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. The following constructs were amplified, cloned (with an N-terminal double Strep 2-tag), verified by sequencing, expressed and purified: Net4LN-LE1-2—γ1LEa3-4 (Net4 aa: 20-394 fused to laminin γ1 aa: 396-492), Net4LN-LE1—γ1LEa2-4 (Net4 aa: 20-331 fused to laminin γ1 aa: 340-492), γ1LN-LEa1—Net4LE2-31 /2 (Laminin γ1 aa: 44-339 fused to Net4 aa: 332-462) and Net4-ΔC—N-term agrin (NP_067295, aa: 20-462, E195A, R199A, fused to NP_067617, aa: 33–164).

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The primer sequences and the gBlock sequence are found in . .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: For the sequencing analysis of pull-down DNA (BGT-seq or hMe_Seal) [ ], genomic DNA was fragmented to a length of approximately 300 bp using the Covaris system. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB).

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: A T7 promoter sequence was added upstream of the guide for in vitro transcription. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB). .. Constructs were analyzed by restriction enzyme analysis and sequencing.

    Binding Assay:

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. ..

    ChIP-sequencing:

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB). .. Library quality was determined using a BioAnalyzer2000, and quantification was performed via qPCR using KAPA Library Quantification Kits (Illumina) followed by Illumina sequencing using the MiSeq and Hiseq2500 platforms; the sequences and processed data are available from the NCBI GEO repository (Accession no.: [GEO: GSE87165]).

    Methylation:

    Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast
    Article Snippet: PCR products were amplified by PCR using the Q5 (NEB) high-fidelity polymerase following standard conditions. .. The second PCR product is digested by the addition of 1 μl DpnI-FD (ThermoFishe) for 1 hour at 37° C to destroy the methylated pUC-57 template plasmid.

    Mutagenesis:

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: Paragraph title: algR mutant construction. ... The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. ..

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB). .. Constructs were analyzed by restriction enzyme analysis and sequencing.

    Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein
    Article Snippet: .. The F86L and E258A mutations were introduced separately using the Q5 (New England Biolabs) site-directed mutagenesis protocol. ..

    Purification:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: Paragraph title: AlgR purification. ... The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ).

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. DNA libraries were purified with a PCR purification kit (Qiagen) and sequenced on Ion Torrent PGM 318 chip, 400 flow.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. The following constructs were amplified, cloned (with an N-terminal double Strep 2-tag), verified by sequencing, expressed and purified: Net4LN-LE1-2—γ1LEa3-4 (Net4 aa: 20-394 fused to laminin γ1 aa: 396-492), Net4LN-LE1—γ1LEa2-4 (Net4 aa: 20-331 fused to laminin γ1 aa: 340-492), γ1LN-LEa1—Net4LE2-31 /2 (Laminin γ1 aa: 44-339 fused to Net4 aa: 332-462) and Net4-ΔC—N-term agrin (NP_067295, aa: 20-462, E195A, R199A, fused to NP_067617, aa: 33–164).

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pH Sso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB). .. Library quality was determined using a BioAnalyzer2000, and quantification was performed via qPCR using KAPA Library Quantification Kits (Illumina) followed by Illumina sequencing using the MiSeq and Hiseq2500 platforms; the sequences and processed data are available from the NCBI GEO repository (Accession no.: [GEO: GSE87165]).

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol. .. Depending on PCR purity, either gel purification (QIAquick Gel Extraction Kit, Qiagen, Hilden, Germany) or PCR purification (QIAquick PCR Purification Kit, Qiagen, Hilden, Germany) were used to clean up the products.

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. .. Each PCR amplified gBlock was purified by using a QIAGEN (Valencia, USA) PCR purification kit following standard protocol.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    CRISPR:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Paragraph title: In vitro transcription of single guide RNAs for the CRISPR/Cas9 system ... Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    cDNA Library Assay:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Cloning of rap-1, rap-2 and mig-15 cDNAs of rap-1 and rap-2 were obtained from cDNA library prepared from N2 RNA. .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Chromatin Immunoprecipitation:

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. DNA libraries were purified with a PCR purification kit (Qiagen) and sequenced on Ion Torrent PGM 318 chip, 400 flow.

    Plasmid Preparation:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: To add the glutamine tag the pHSso PoxTyr plasmid was digested with NheI and SacI. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. The resulting plasmid (pGEX-4TAlgR) was transformed into E. coli BL21(DE3) (NEB) cells and incubated overnight.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: To add the glutamine tag the pH Sso PoxTyr plasmid was digested with NheI and SacI. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments. .. Amplified fragments were cloned into the Asc I and Kpn I sites of pSM vector using SLiCE method , Gibson assembly ( ) or T4 ligase (NEB).

    Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast
    Article Snippet: PCR products were amplified by PCR using the Q5 (NEB) high-fidelity polymerase following standard conditions. .. The product of this first PCR was then used as a megaprimer to insert the target sequence into the pUC-57 destination vector through a second, PCR.

    Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein
    Article Snippet: Plasmid pET-15b expressing a His6 -tagged version of the human RAD51 protein was a generous gift from Dr. Hitoshi Kurumizaka at Waseda University, Japan. .. The F86L and E258A mutations were introduced separately using the Q5 (New England Biolabs) site-directed mutagenesis protocol.

    Positron Emission Tomography:

    Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein
    Article Snippet: Plasmid pET-15b expressing a His6 -tagged version of the human RAD51 protein was a generous gift from Dr. Hitoshi Kurumizaka at Waseda University, Japan. .. The F86L and E258A mutations were introduced separately using the Q5 (New England Biolabs) site-directed mutagenesis protocol.

    In Vitro:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Paragraph title: In vitro transcription of single guide RNAs for the CRISPR/Cas9 system ... Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    Concentration Assay:

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol. .. The two PCR products for each fragment were mixed in 1:1 molar ratio, to a final concentration of 40 fmol/μl DNA (40 fmol/μl ≈ 24 ng/kb/μl DNA) in 1× CutSmart buffer (NEB, Ipswich, MA, USA).

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. ..

    DNA Purification:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Gel Extraction:

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol. .. Depending on PCR purity, either gel purification (QIAquick Gel Extraction Kit, Qiagen, Hilden, Germany) or PCR purification (QIAquick PCR Purification Kit, Qiagen, Hilden, Germany) were used to clean up the products.

    Homologous Recombination:

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB). .. Mutant strains were constructed using homologous recombination, as described above, and were checked using PCR and the algRintF/algRintR primer pair and digestion with the appropriate restriction enzyme.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs q5 high fidelity dna polymerase
    Q5 High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 411 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 high fidelity dna polymerase/product/New England Biolabs
    Average 90 stars, based on 411 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results