q5 (New England Biolabs)
New England Biolabs is a verified supplier 
99
|
Name:
Q5 Reaction Buffer Pack
Description:
Q5 Reaction Buffer Pack 6 0 ml
Catalog Number:
b9027s
Price:
27
Size:
6 0 ml
Category:
Buffers
|
Buy from Supplier |
|
Name:
Q5 High Fidelity DNA Polymerase
Description:
Q5 High Fidelity DNA Polymerase 500 units
Catalog Number:
m0491l
Price:
432
Size:
500 units
Category:
Thermostable DNA Polymerases
|
Buy from Supplier |
Structured Review
New England Biolabs
q5
Q5 High Fidelity DNA Polymerase 500 units
https://www.bioz.com/result/q5/product/New England Biolabs
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Q5 High Fidelity DNA Polymerase 500 units
https://www.bioz.com/result/q5/product/New England Biolabs
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
q5 - by Bioz Stars,
2020-01
99/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Clone Assay:Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The algR gene was PCR amplified using Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: .. The wild-type algR genomic region was amplified using Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans Article Snippet: Paragraph title: Cloning of rap-1, rap-2 and mig-15 ... Phusion (NEB) or Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast Article Snippet: Module library construction To generate individual modules we amplified the specific DNA sequence of interest by PCR using primers (Figs and ) that contain 25 bp of the multiple cloning site (MCS) of pUC57 followed by the BsaI restriction site, a specific 4 bp overhang ( and ), which determines the cloning position. .. PCR products were amplified by PCR using the Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Amplification:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: .. The Sso Pox gene was amplified with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: .. The algR gene was PCR amplified using Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: .. The wild-type algR genomic region was amplified using Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: .. The Sso Pox gene was amplified with Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast Article Snippet: .. PCR products were amplified by PCR using the Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development Article Snippet: .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Synthesized:Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development Article Snippet: In vitro transcription of single guide RNAs for the CRISPR/Cas9 system Template guide DNA was first synthesized by Integrated DNA Technologies in the form of a gBlock. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Construct:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: To construct the tyrosine-tagged Sso Pox, the gBlock was amplified using F-Sso Pox and Sso PoxR-Tyr. .. The Sso Pox gene was amplified with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The wild-type algR genomic region was amplified using Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: To construct the tyrosine-tagged Sso Pox, the gBlock was amplified using F- Sso Pox and Sso PoxR-Tyr. .. The Sso Pox gene was amplified with Real-time Polymerase Chain Reaction:Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice Article Snippet: The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with IA:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: SsoPox Expression Plasmids The Sso Pox genetic sequence was optimized for E. coli using the IDT codon optimization tool and the gBlock and primers for insertion into pET200 plasmid were ordered from IDT (Coralville, IA, USA). .. The Sso Pox gene was amplified with Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The Sso Pox genetic sequence was optimized for E. coli using the IDT codon optimization tool and the gBlock and primers for insertion into pET200 plasmid were ordered from IDT (Coralville, IA, USA). .. The Sso Pox gene was amplified with Incubation:Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The algR gene was PCR amplified using Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice Article Snippet: Fragmented DNA and UDP-azide-glucose were incubated overnight with T4 BGT (NEB) at 37 °C followed by biotin conjugation. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Expressing:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: Paragraph title: 4.1. SsoPox Expression Plasmids ... The Sso Pox gene was amplified with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The algR gene was PCR amplified using Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein Article Snippet: Plasmid pET-15b expressing a His6 -tagged version of the human RAD51 protein was a generous gift from Dr. Hitoshi Kurumizaka at Waseda University, Japan. .. The F86L and E258A mutations were introduced separately using the Transformation Assay:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The Sso Pox gene was amplified with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The algR gene was PCR amplified using Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The Sso Pox gene was amplified with Gel Purification:Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Conjugation Assay:Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice Article Snippet: Fragmented DNA and UDP-azide-glucose were incubated overnight with T4 BGT (NEB) at 37 °C followed by biotin conjugation. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Flow Cytometry:Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Ligation:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets Article Snippet: Biotinylated products were collected on streptavidin beads (Life Technologies 11205D), washed, and re-suspended in a ligation mastermix, containing 25% w/v PEG8000 (Sigma 89510-250G-F), 1 μM ssAdapter, 1 mM Co(NH2 )6 Cl3 (Sigma H7891-5G), 1 × T4 ligation buffer and 20 U T4 ligase (NEB), for 16 h at 25 °C and 300 rpm shaking. .. Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pH Sso PoxTyr. .. The Sso Pox gene was amplified with Generated:Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice Article Snippet: The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method Article Snippet: Two-step assembly: preparation of fragments For each DNA fragment to be assembled, two PCR products were generated: one with primers LF and SR, the other with primers SF and LR. .. PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Polymerase Chain Reaction:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: .. The algR gene was PCR amplified using Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets Article Snippet: .. Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pH Sso PoxTyr. .. The Sso Pox gene was amplified with Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans Article Snippet: .. Phusion (NEB) or Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method Article Snippet: .. PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast Article Snippet: .. PCR products were amplified by PCR using the Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development Article Snippet: .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein Article Snippet: The F86L and E258A mutations were introduced separately using the Sequencing:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The primer sequences and the gBlock sequence are found in . .. The Sso Pox gene was amplified with Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The primer sequences and the gBlock sequence are found in . .. The Sso Pox gene was amplified with Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice Article Snippet: For the sequencing analysis of pull-down DNA (BGT-seq or hMe_Seal) [ ], genomic DNA was fragmented to a length of approximately 300 bp using the Covaris system. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development Article Snippet: A T7 promoter sequence was added upstream of the guide for in vitro transcription. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Binding Assay:Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the ChIP-sequencing:Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice Article Snippet: .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Methylation:Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast Article Snippet: PCR products were amplified by PCR using the Mutagenesis:Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: Paragraph title: algR mutant construction. ... The wild-type algR genomic region was amplified using Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: .. Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein Article Snippet: .. The F86L and E258A mutations were introduced separately using the Purification:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: Paragraph title: AlgR purification. ... The algR gene was PCR amplified using Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes Article Snippet: Design of chimeric constructs and site-directed mutagenesis To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pH Sso PoxTyr. .. The Sso Pox gene was amplified with Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice Article Snippet: .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development Article Snippet: Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Reverse Transcription Polymerase Chain Reaction:Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or CRISPR:Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development Article Snippet: Paragraph title: In vitro transcription of single guide RNAs for the CRISPR/Cas9 system ... Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with cDNA Library Assay:Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans Article Snippet: Cloning of rap-1, rap-2 and mig-15 cDNAs of rap-1 and rap-2 were obtained from cDNA library prepared from N2 RNA. .. Phusion (NEB) or Chromatin Immunoprecipitation:Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Plasmid Preparation:Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: To add the glutamine tag the pHSso PoxTyr plasmid was digested with NheI and SacI. .. The Sso Pox gene was amplified with Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The algR gene was PCR amplified using Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching Article Snippet: To add the glutamine tag the pH Sso PoxTyr plasmid was digested with NheI and SacI. .. The Sso Pox gene was amplified with Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans Article Snippet: Phusion (NEB) or Article Title: COSPLAY: An expandable toolbox for combinatorial and swift generation of expression plasmids in yeast Article Snippet: PCR products were amplified by PCR using the Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein Article Snippet: Plasmid pET-15b expressing a His6 -tagged version of the human RAD51 protein was a generous gift from Dr. Hitoshi Kurumizaka at Waseda University, Japan. .. The F86L and E258A mutations were introduced separately using the Positron Emission Tomography:Article Title: Defects in Recombination Activity Caused by Somatic and Germline Mutations in the Multimerization/BRCA2 Binding Region of Human RAD51 Protein Article Snippet: Plasmid pET-15b expressing a His6 -tagged version of the human RAD51 protein was a generous gift from Dr. Hitoshi Kurumizaka at Waseda University, Japan. .. The F86L and E258A mutations were introduced separately using the In Vitro:Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development Article Snippet: Paragraph title: In vitro transcription of single guide RNAs for the CRISPR/Cas9 system ... Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Concentration Assay:Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development Article Snippet: .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with DNA Purification:Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Gel Extraction:Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Homologous Recombination:Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner Article Snippet: The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using |