q5  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Q5 Site Directed Mutagenesis Kit
    Description:
    Q5 Site Directed Mutagenesis Kit 10 rxns
    Catalog Number:
    e0554s
    Price:
    197
    Size:
    10 rxns
    Category:
    PCR Mutagenesis Kits
    Buy from Supplier


    Structured Review

    New England Biolabs q5
    Q5 Site Directed Mutagenesis Kit
    Q5 Site Directed Mutagenesis Kit 10 rxns
    https://www.bioz.com/result/q5/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    q5 - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Luciferase:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    In Vitro:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Mutagenesis:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Article Title: Phytochrome Signaling Is Mediated by PHYTOCHROME INTERACTING FACTOR in the Liverwort Marchantia polymorpha
    Article Snippet: .. To obtain the overexpression lines of Mp- PHYY241H , the plasmid carrying Mp- PHY cDNA was mutagenized using a Phusion site-directed mutagenesis kit (New England Biolabs) with the primer pair 5′-CACACAAATTCCATGAGGAT-3′ and 5′-CCATAACCCGGTCGTAACCT-3′. .. The cloned sequence was then transferred to the pMpGWB103 vector to generate pMH03.

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA). .. For determination of CaM binding and production of transgenic plants carrying mutated versions of CBP60g , site-specific mutagenesis was carried out beginning with a full-length cDNA clone or a genomic clone, respectively, in pCR8.

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Biochemical Analysis of the Complex between the Tetrameric Export Adapter Protein Rec of HERV-K/HML-2 and the Responsive RNA Element RcRE pck30
    Article Snippet: .. The mutations in RcRE pck30 were inserted into pSP64_pck30 by using a Phusion site-directed mutagenesis kit (New England BioLabs) according to the manufacturer instructions with primers ordered from Eurofins MWG (see Table S1 in the supplemental material). ..

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Polymerase Chain Reaction:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Generated:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Modification:

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Binding Assay:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Over Expression:

    Article Title: Phytochrome Signaling Is Mediated by PHYTOCHROME INTERACTING FACTOR in the Liverwort Marchantia polymorpha
    Article Snippet: .. To obtain the overexpression lines of Mp- PHYY241H , the plasmid carrying Mp- PHY cDNA was mutagenized using a Phusion site-directed mutagenesis kit (New England Biolabs) with the primer pair 5′-CACACAAATTCCATGAGGAT-3′ and 5′-CCATAACCCGGTCGTAACCT-3′. .. The cloned sequence was then transferred to the pMpGWB103 vector to generate pMH03.

    Plasmid Preparation:

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Article Title: Phytochrome Signaling Is Mediated by PHYTOCHROME INTERACTING FACTOR in the Liverwort Marchantia polymorpha
    Article Snippet: .. To obtain the overexpression lines of Mp- PHYY241H , the plasmid carrying Mp- PHY cDNA was mutagenized using a Phusion site-directed mutagenesis kit (New England Biolabs) with the primer pair 5′-CACACAAATTCCATGAGGAT-3′ and 5′-CCATAACCCGGTCGTAACCT-3′. .. The cloned sequence was then transferred to the pMpGWB103 vector to generate pMH03.

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs q5 dna high fidelity polymerase
    Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and <t>Q5</t> DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).
    Q5 Dna High Fidelity Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1569 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 dna high fidelity polymerase/product/New England Biolabs
    Average 99 stars, based on 1569 article reviews
    Price from $9.99 to $1999.99
    q5 dna high fidelity polymerase - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and Q5 DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: DNA synthesis from diphosphate substrates by DNA polymerases

    doi: 10.1073/pnas.1712193115

    Figure Lengend Snippet: Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and Q5 DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).

    Article Snippet: Taq DNA polymerase, Phusion High-Fidelity DNA polymerase, DeepVent DNA polymerase, Vent DNA polymerase, Q5 DNA High-Fidelity polymerase, Bst polymerase, Bsu DNA polymerase (large fragment), and ThermoPol Reaction Buffer [1×: 20 mM Tris⋅HCl, 10 mM (NH4 )2 SO4 , 10 mM KCl, 2 mM MgSO4 , 0.1% Triton–X–100, pH 8.8 at 25 °C] were purchased from New England Biolabs.

    Techniques: Polymerase Chain Reaction, Amplification

    Optimization of EvaGreen- and Q5 DNA polymerase-based dNTP quantification. ( A-F ) Each critical reaction component and reaction temperature were varied and the outcome evaluated. ( G ) Assay conditions in graphs A to F . The standard curves were generated from end-point (1h) baseline-corrected fluorescence values.

    Journal: bioRxiv

    Article Title: A sensitive assay for dNTPs based on long synthetic oligonucleotides, EvaGreen dye, and inhibitor-resistant high-fidelity DNA polymerase

    doi: 10.1101/2019.12.17.879122

    Figure Lengend Snippet: Optimization of EvaGreen- and Q5 DNA polymerase-based dNTP quantification. ( A-F ) Each critical reaction component and reaction temperature were varied and the outcome evaluated. ( G ) Assay conditions in graphs A to F . The standard curves were generated from end-point (1h) baseline-corrected fluorescence values.

    Article Snippet: Based on the lowest background signal, and reported ( ) inhibitor resistance in DNA extraction-free PCR, we chose to continue the optimization with Q5 DNA polymerase.

    Techniques: Generated, Fluorescence

    Long synthetic DNA oligonucleotides, an inhibitor-resistant high-fidelity DNA polymerase and EvaGreen detection chemistry allow quantification of dNTPs from mouse liver extracts. ( A ) Representative quantification of dTTP using the published fluorometric probe-hydrolysis-based assay. For clarity, curves from three lowest standard samples (0.31 to 0.08 pmol) are not shown. ( B ) Representative quantification of dTTP using Q5 DNA polymerase, long oligonucleotide template and EvaGreen detection chemistry. ( C - D ) dTTP signal generated by the fluorometric methods from mouse liver extracts with and without 0.5 pmol dTTP spike-in calibrant. The final extract volume was diluted to 80 µl per 40 mg of initial tissue weight. ( E - F ) Standard curves generated from the end-point baseline-corrected fluorescence values. The lowest y-axis value shows the background signal. Gray lines present the 95% confidence interval of the non-linear curve fit.

    Journal: bioRxiv

    Article Title: A sensitive assay for dNTPs based on long synthetic oligonucleotides, EvaGreen dye, and inhibitor-resistant high-fidelity DNA polymerase

    doi: 10.1101/2019.12.17.879122

    Figure Lengend Snippet: Long synthetic DNA oligonucleotides, an inhibitor-resistant high-fidelity DNA polymerase and EvaGreen detection chemistry allow quantification of dNTPs from mouse liver extracts. ( A ) Representative quantification of dTTP using the published fluorometric probe-hydrolysis-based assay. For clarity, curves from three lowest standard samples (0.31 to 0.08 pmol) are not shown. ( B ) Representative quantification of dTTP using Q5 DNA polymerase, long oligonucleotide template and EvaGreen detection chemistry. ( C - D ) dTTP signal generated by the fluorometric methods from mouse liver extracts with and without 0.5 pmol dTTP spike-in calibrant. The final extract volume was diluted to 80 µl per 40 mg of initial tissue weight. ( E - F ) Standard curves generated from the end-point baseline-corrected fluorescence values. The lowest y-axis value shows the background signal. Gray lines present the 95% confidence interval of the non-linear curve fit.

    Article Snippet: Based on the lowest background signal, and reported ( ) inhibitor resistance in DNA extraction-free PCR, we chose to continue the optimization with Q5 DNA polymerase.

    Techniques: Hydrolysis Assay, Generated, Fluorescence

    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Journal: Bio-protocol

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome

    doi: 10.21769/BioProtoc.2272

    Figure Lengend Snippet: PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Article Snippet: The PCR program used to linearize pPB41 is: PCR amplify CRISPR/Cas9 using plasmid generated in step B1 ( ) Amplify plasmid generated in step B1 (pPB43 in the example) via PCR using Q5 DNA polymerase (NEB) and primers oPEB232 and oPEB234.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Mutagenesis, Plasmid Preparation

    Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Journal: Molecular Oncology

    Article Title: Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer

    doi: 10.1002/1878-0261.12305

    Figure Lengend Snippet: Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Article Snippet: To increase the sensitivity of the analysis, the remaining 75 μL serum DNA was subjected to 12 cycles of PCR pre‐amplification with Q5 High‐Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA) using a multiplex PIK3CA primer mix.

    Techniques: Mutagenesis, Amplification