onetaq  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    OneTaq 2X Master Mix with Standard Buffer
    Description:
    OneTaq 2X Master Mix with Standard Buffer 500 rxns
    Catalog Number:
    m0482l
    Price:
    188
    Size:
    500 rxns
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs onetaq
    OneTaq 2X Master Mix with Standard Buffer
    OneTaq 2X Master Mix with Standard Buffer 500 rxns
    https://www.bioz.com/result/onetaq/product/New England Biolabs
    Average 99 stars, based on 89 article reviews
    Price from $9.99 to $1999.99
    onetaq - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: .. PCR was performed using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers GLuc-F and GLuc-R (Table ). .. Insertion into the pTarget vector (Promega) followed manufacturer’s instructions for T/A cloning.

    Article Title: Sterile activation of invariant natural killer T cells by ER-stressed antigen-presenting cells
    Article Snippet: .. XBP1 mRNA was amplified from the cDNA by PCR using the OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) following the manufacturer’s instructions. ..

    Article Title: Gene editing the phytoene desaturase alleles of Cavendish banana using CRISPR/Cas9
    Article Snippet: .. Colonies were inoculated into a PCR containing OneTaq® 2× Master Mix (NEB) and primers M13-F (5′-CCCAGTCACGACGTTGTAAAACG-3′) and M13-R (5′-AGCGGATAACAATTTCACACAGG-3′). ..

    Article Title: Sensitivity of PCR Assays for Murine Gammaretroviruses and Mouse Contamination in Human Blood Samples
    Article Snippet: .. On the same day, one sample of LNCaP gDNA designated LN1 was tested with gagL PCR using HotStart-IT FideliTaq master mix (USB) and OneTaq® 2× master mix (NEB) separately, each with 42 LNCaP gDNA aliquots and 6 no-template negative controls. gagL sequences were confirmed in 4/42 of each of the PCR. .. LN1 showed gag sequences in 9.5% (8/84) PCR tests.

    Article Title: Detection of a Frameshift Deletion in the SPTBN4 Gene Leads to Prevention of Severe Myopathy and Postnatal Mortality in Pigs
    Article Snippet: .. Validation of Causal 16 bp SPTBN4 Deletion PCR was done using 60 ng of genomic DNA, with 0.4 µm of each primer, 1.8 mM MgCl2, and 25 units/ml OneTaq® DNA Polymerase (OneTaq® 2X Master Mix with Standard Buffer, New England Biolabs) in manufacturer’s PCR buffer in a final volume of 12 µl. ..

    Amplification:

    Article Title: Sterile activation of invariant natural killer T cells by ER-stressed antigen-presenting cells
    Article Snippet: .. XBP1 mRNA was amplified from the cDNA by PCR using the OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) following the manufacturer’s instructions. ..

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: .. Amplification of 3C variant genes from pTarget GLuc-Δ1D2A-3C wild-type, L127P, and C163A constructs was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers NotI-3CLeb89-F (CAGCGGCCGCATGAGTGGTGCCCCACCG) and 3C Asia-ns-EcoRI-R (GAATTCCTCGTGGTGTGGTTC). .. PCR product was purified using a PCR purification kit (Qiagen).

    Construct:

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: .. Amplification of 3C variant genes from pTarget GLuc-Δ1D2A-3C wild-type, L127P, and C163A constructs was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers NotI-3CLeb89-F (CAGCGGCCGCATGAGTGGTGCCCCACCG) and 3C Asia-ns-EcoRI-R (GAATTCCTCGTGGTGTGGTTC). .. PCR product was purified using a PCR purification kit (Qiagen).

    Variant Assay:

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: .. Amplification of 3C variant genes from pTarget GLuc-Δ1D2A-3C wild-type, L127P, and C163A constructs was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers NotI-3CLeb89-F (CAGCGGCCGCATGAGTGGTGCCCCACCG) and 3C Asia-ns-EcoRI-R (GAATTCCTCGTGGTGTGGTTC). .. PCR product was purified using a PCR purification kit (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs onetaq one step rt pcr kit
    qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to <t>RT-PCR</t> master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and <t>OneTaq</t> polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.
    Onetaq One Step Rt Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq one step rt pcr kit/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    onetaq one step rt pcr kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    96
    New England Biolabs onetaq hot start 2x master mix
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); <t>OneTaq</t> = OneTaq Hot Start <t>2X</t> Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Onetaq Hot Start 2x Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq hot start 2x master mix/product/New England Biolabs
    Average 96 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    onetaq hot start 2x master mix - by Bioz Stars, 2020-07
    96/100 stars
      Buy from Supplier

    86
    New England Biolabs 1x onetaq standard reaction buffer
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); <t>OneTaq</t> = OneTaq Hot Start <t>2X</t> Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    1x Onetaq Standard Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x onetaq standard reaction buffer/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1x onetaq standard reaction buffer - by Bioz Stars, 2020-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to RT-PCR master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and OneTaq polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.

    Journal: bioRxiv

    Article Title: A Highly Scalable and Rapidly Deployable RNA Extraction-Free COVID-19 Assay by Quantitative Sanger Sequencing

    doi: 10.1101/2020.04.07.029199

    Figure Lengend Snippet: qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to RT-PCR master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and OneTaq polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.

    Article Snippet: qSanger Amplification Reverse transcription and amplification for was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S).

    Techniques: Amplification, Negative Control, Sequencing, Reverse Transcription Polymerase Chain Reaction, Purification, RNA Extraction

    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Journal: Scientific Reports

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay

    doi: 10.1038/s41598-019-40035-5

    Figure Lengend Snippet: Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Article Snippet: Several master mixes were tested in the optimization experiments, namely AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA), AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA), OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA), Platinum Hot Start PCR Master Mix (Invitrogen, California, USA), and HotStarTaq DNA Polymerase (Qiagen, Germany).

    Techniques: Polymerase Chain Reaction, Hot Start PCR