onetaq  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    OneTaq 2X Master Mix with Standard Buffer
    Description:
    OneTaq 2X Master Mix with Standard Buffer 500 rxns
    Catalog Number:
    m0482l
    Price:
    188
    Size:
    500 rxns
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs onetaq
    OneTaq 2X Master Mix with Standard Buffer
    OneTaq 2X Master Mix with Standard Buffer 500 rxns
    https://www.bioz.com/result/onetaq/product/New England Biolabs
    Average 99 stars, based on 89 article reviews
    Price from $9.99 to $1999.99
    onetaq - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Multiplexed Knockouts in the Model Diatom Phaeodactylum by Episomal Delivery of a Selectable Cas9
    Article Snippet: .. Multiple DNA polymerases were used for cloning purposes including Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA, United States), AccuPrime Taq High-Fidelity DNA polymerase (Thermo Fisher Scientific), OneTaq 2X Master Mix with standard buffer (New England Biolabs, Ipswich, MA, United States), and Phire Plant Direct PCR Master Mix (Thermo Fisher Scientific). .. Enzymatic components to make a 2X GA master mix that included Phusion HF DNA polymerase, T5 exonuclease (Thermo Fisher Scientific), and DNA Taq Ligase (Thermo Fisher Scientific) were purchased separately and mixed in lab.

    Amplification:

    Article Title: Sterile activation of invariant natural killer T cells by ER-stressed antigen-presenting cells
    Article Snippet: .. XBP1 mRNA was amplified from the cDNA by PCR using the OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) following the manufacturer’s instructions. ..

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: .. Amplification of 3C variant genes from pTarget GLuc-Δ1D2A-3C wild-type, L127P, and C163A constructs was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers NotI-3CLeb89-F (CAGCGGCCGCATGAGTGGTGCCCCACCG) and 3C Asia-ns-EcoRI-R (GAATTCCTCGTGGTGTGGTTC). .. PCR product was purified using a PCR purification kit (Qiagen).

    Article Title: Antihyperglycaemia and related gene expressions of aqueous extract of Gongronema latifolium leaf in alloxan-induced diabetic rats
    Article Snippet: .. Also, OneTaq® 2X Master Mix (NEB) was used in PCR amplification using the following primer set: Hexokinase Forward: GTGTACAAGCTGCACCCGA Reverse: CAGCATGCAAGCCTTCTTG Glucose-6-phosphatase Forward: GCTCCGTGCCTCTGATAAA Reverse: CCACGAAAGATAGCGAGAGTAG The expression level of the genes studied was normalized by GADPH, and the band density was measured using ImageJ is plotted as a bar graph as illustrated by Elekofehinti et al. ( ). ..

    Article Title: One-Vector System for Multiplexed CRISPR/Cas9 against Hepatitis B Virus cccDNA Utilizing High-Capacity Adenoviral Vectors
    Article Snippet: .. Mutation Detection For the T7 endonuclease 1 (T7E1) (New England Biolabs, MA) mutation detection assay, DNA sequences that span the target sites were amplified from purified genomic DNA by PCR using standard conditions for the OneTaq 2X Master Mix with Standard Buffer (New England Biolabs, MA), with the following primer sets: S/HBV-RT, S-T7 for 5′-ttcctcttcatcctgctgct-3′ and S rev 5′-tgtaaaaggggcagcaaaac-3′; X, No. 5-forw 5′-actcctagccgcttgttttg-3′ and No.5-rev 5′-ataagggtcgatgtccatgc-3′; C, C-T7 for 5′-ctgggtgggtgttaatttgg-3′ and No.6-rev 5′-tacccgccttccatagagtg-3′; P1, P1_F 5′-gctttcactttctcgccaac-3′ and P1_R 5′-accttgggcaatatttggtg-3′; and XCp, XCp_F 5′-actctctcgtccccttctcc-3′ and XCp_R 5′-gcctgagtgcagtatggtga-3′. .. The PCR products were desalted by ethanol precipitation and resuspended in 1× NEB2 buffer (New England Biolabs, MA).

    Article Title: Novel RNA viruses within plant parasitic cyst nematodes
    Article Snippet: .. OneTaq® 2X Master Mix with standard buffer (New England BioLabs) and appropriate primers ( ) were used according to manufacturer’s protocol to amplify products from cDNA in the Bio-Rad C1000 Touch Thermal Cycler under the following conditions: 94°C, 5 minutes; 94°C, 30 seconds; 60°C, 30 seconds; 68°C, 60 seconds for 40 amplification cycles followed by a final extension of 68°C for 5 minutes. ..

    Mutagenesis:

    Article Title: One-Vector System for Multiplexed CRISPR/Cas9 against Hepatitis B Virus cccDNA Utilizing High-Capacity Adenoviral Vectors
    Article Snippet: .. Mutation Detection For the T7 endonuclease 1 (T7E1) (New England Biolabs, MA) mutation detection assay, DNA sequences that span the target sites were amplified from purified genomic DNA by PCR using standard conditions for the OneTaq 2X Master Mix with Standard Buffer (New England Biolabs, MA), with the following primer sets: S/HBV-RT, S-T7 for 5′-ttcctcttcatcctgctgct-3′ and S rev 5′-tgtaaaaggggcagcaaaac-3′; X, No. 5-forw 5′-actcctagccgcttgttttg-3′ and No.5-rev 5′-ataagggtcgatgtccatgc-3′; C, C-T7 for 5′-ctgggtgggtgttaatttgg-3′ and No.6-rev 5′-tacccgccttccatagagtg-3′; P1, P1_F 5′-gctttcactttctcgccaac-3′ and P1_R 5′-accttgggcaatatttggtg-3′; and XCp, XCp_F 5′-actctctcgtccccttctcc-3′ and XCp_R 5′-gcctgagtgcagtatggtga-3′. .. The PCR products were desalted by ethanol precipitation and resuspended in 1× NEB2 buffer (New England Biolabs, MA).

    Detection Assay:

    Article Title: One-Vector System for Multiplexed CRISPR/Cas9 against Hepatitis B Virus cccDNA Utilizing High-Capacity Adenoviral Vectors
    Article Snippet: .. Mutation Detection For the T7 endonuclease 1 (T7E1) (New England Biolabs, MA) mutation detection assay, DNA sequences that span the target sites were amplified from purified genomic DNA by PCR using standard conditions for the OneTaq 2X Master Mix with Standard Buffer (New England Biolabs, MA), with the following primer sets: S/HBV-RT, S-T7 for 5′-ttcctcttcatcctgctgct-3′ and S rev 5′-tgtaaaaggggcagcaaaac-3′; X, No. 5-forw 5′-actcctagccgcttgttttg-3′ and No.5-rev 5′-ataagggtcgatgtccatgc-3′; C, C-T7 for 5′-ctgggtgggtgttaatttgg-3′ and No.6-rev 5′-tacccgccttccatagagtg-3′; P1, P1_F 5′-gctttcactttctcgccaac-3′ and P1_R 5′-accttgggcaatatttggtg-3′; and XCp, XCp_F 5′-actctctcgtccccttctcc-3′ and XCp_R 5′-gcctgagtgcagtatggtga-3′. .. The PCR products were desalted by ethanol precipitation and resuspended in 1× NEB2 buffer (New England Biolabs, MA).

    Construct:

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: .. Amplification of 3C variant genes from pTarget GLuc-Δ1D2A-3C wild-type, L127P, and C163A constructs was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers NotI-3CLeb89-F (CAGCGGCCGCATGAGTGGTGCCCCACCG) and 3C Asia-ns-EcoRI-R (GAATTCCTCGTGGTGTGGTTC). .. PCR product was purified using a PCR purification kit (Qiagen).

    Purification:

    Article Title: One-Vector System for Multiplexed CRISPR/Cas9 against Hepatitis B Virus cccDNA Utilizing High-Capacity Adenoviral Vectors
    Article Snippet: .. Mutation Detection For the T7 endonuclease 1 (T7E1) (New England Biolabs, MA) mutation detection assay, DNA sequences that span the target sites were amplified from purified genomic DNA by PCR using standard conditions for the OneTaq 2X Master Mix with Standard Buffer (New England Biolabs, MA), with the following primer sets: S/HBV-RT, S-T7 for 5′-ttcctcttcatcctgctgct-3′ and S rev 5′-tgtaaaaggggcagcaaaac-3′; X, No. 5-forw 5′-actcctagccgcttgttttg-3′ and No.5-rev 5′-ataagggtcgatgtccatgc-3′; C, C-T7 for 5′-ctgggtgggtgttaatttgg-3′ and No.6-rev 5′-tacccgccttccatagagtg-3′; P1, P1_F 5′-gctttcactttctcgccaac-3′ and P1_R 5′-accttgggcaatatttggtg-3′; and XCp, XCp_F 5′-actctctcgtccccttctcc-3′ and XCp_R 5′-gcctgagtgcagtatggtga-3′. .. The PCR products were desalted by ethanol precipitation and resuspended in 1× NEB2 buffer (New England Biolabs, MA).

    Expressing:

    Article Title: Antihyperglycaemia and related gene expressions of aqueous extract of Gongronema latifolium leaf in alloxan-induced diabetic rats
    Article Snippet: .. Also, OneTaq® 2X Master Mix (NEB) was used in PCR amplification using the following primer set: Hexokinase Forward: GTGTACAAGCTGCACCCGA Reverse: CAGCATGCAAGCCTTCTTG Glucose-6-phosphatase Forward: GCTCCGTGCCTCTGATAAA Reverse: CCACGAAAGATAGCGAGAGTAG The expression level of the genes studied was normalized by GADPH, and the band density was measured using ImageJ is plotted as a bar graph as illustrated by Elekofehinti et al. ( ). ..

    Polymerase Chain Reaction:

    Article Title: Bacillus anthracis Virulence Regulator AtxA Binds Specifically to the pagA Promoter Region
    Article Snippet: .. PCR using OneTaq 2× mastermix with standard buffer (New England BioLabs) and pPAGK DNA ( ) and pRSP (this study) as the template was conducted under the following conditions: 30 s at 94°C, 30 cycles of 30 s at 94°C, 30 s at 53°C, and 1 min at 68°C, followed by 5 min at 68°C. .. Infrared-labeled PCR products were purified using the PureLink PCR purification kit (Invitrogen, Carlsbad, CA).

    Article Title: Sterile activation of invariant natural killer T cells by ER-stressed antigen-presenting cells
    Article Snippet: .. XBP1 mRNA was amplified from the cDNA by PCR using the OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) following the manufacturer’s instructions. ..

    Article Title: Antihyperglycaemia and related gene expressions of aqueous extract of Gongronema latifolium leaf in alloxan-induced diabetic rats
    Article Snippet: .. Also, OneTaq® 2X Master Mix (NEB) was used in PCR amplification using the following primer set: Hexokinase Forward: GTGTACAAGCTGCACCCGA Reverse: CAGCATGCAAGCCTTCTTG Glucose-6-phosphatase Forward: GCTCCGTGCCTCTGATAAA Reverse: CCACGAAAGATAGCGAGAGTAG The expression level of the genes studied was normalized by GADPH, and the band density was measured using ImageJ is plotted as a bar graph as illustrated by Elekofehinti et al. ( ). ..

    Article Title: One-Vector System for Multiplexed CRISPR/Cas9 against Hepatitis B Virus cccDNA Utilizing High-Capacity Adenoviral Vectors
    Article Snippet: .. Mutation Detection For the T7 endonuclease 1 (T7E1) (New England Biolabs, MA) mutation detection assay, DNA sequences that span the target sites were amplified from purified genomic DNA by PCR using standard conditions for the OneTaq 2X Master Mix with Standard Buffer (New England Biolabs, MA), with the following primer sets: S/HBV-RT, S-T7 for 5′-ttcctcttcatcctgctgct-3′ and S rev 5′-tgtaaaaggggcagcaaaac-3′; X, No. 5-forw 5′-actcctagccgcttgttttg-3′ and No.5-rev 5′-ataagggtcgatgtccatgc-3′; C, C-T7 for 5′-ctgggtgggtgttaatttgg-3′ and No.6-rev 5′-tacccgccttccatagagtg-3′; P1, P1_F 5′-gctttcactttctcgccaac-3′ and P1_R 5′-accttgggcaatatttggtg-3′; and XCp, XCp_F 5′-actctctcgtccccttctcc-3′ and XCp_R 5′-gcctgagtgcagtatggtga-3′. .. The PCR products were desalted by ethanol precipitation and resuspended in 1× NEB2 buffer (New England Biolabs, MA).

    Article Title: Multiplexed Knockouts in the Model Diatom Phaeodactylum by Episomal Delivery of a Selectable Cas9
    Article Snippet: .. Multiple DNA polymerases were used for cloning purposes including Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA, United States), AccuPrime Taq High-Fidelity DNA polymerase (Thermo Fisher Scientific), OneTaq 2X Master Mix with standard buffer (New England Biolabs, Ipswich, MA, United States), and Phire Plant Direct PCR Master Mix (Thermo Fisher Scientific). .. Enzymatic components to make a 2X GA master mix that included Phusion HF DNA polymerase, T5 exonuclease (Thermo Fisher Scientific), and DNA Taq Ligase (Thermo Fisher Scientific) were purchased separately and mixed in lab.

    Variant Assay:

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: .. Amplification of 3C variant genes from pTarget GLuc-Δ1D2A-3C wild-type, L127P, and C163A constructs was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers NotI-3CLeb89-F (CAGCGGCCGCATGAGTGGTGCCCCACCG) and 3C Asia-ns-EcoRI-R (GAATTCCTCGTGGTGTGGTTC). .. PCR product was purified using a PCR purification kit (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    New England Biolabs onetaq one step rt pcr kit
    qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to <t>RT-PCR</t> master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and <t>OneTaq</t> polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.
    Onetaq One Step Rt Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq one step rt pcr kit/product/New England Biolabs
    Average 96 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    onetaq one step rt pcr kit - by Bioz Stars, 2020-09
    96/100 stars
      Buy from Supplier

    90
    New England Biolabs neb onetaq
    Macerprepped DNA is good template for PCR. 1-3, PCR product by <t>NEB</t> Q5® HiFi polymerase. 4-6, PCR product by NEB <t>Onetaq</t> polymerase. I, 4, Miraprepped DNA. 2, 5, Macerprepped DNA with Solution 3 process. 3, 6, Macerprepped DNA with Solution N3 process. M, marker.
    Neb Onetaq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/neb onetaq/product/New England Biolabs
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    neb onetaq - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    96
    New England Biolabs onetaq hot start 2x master mix
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); <t>OneTaq</t> = OneTaq Hot Start <t>2X</t> Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Onetaq Hot Start 2x Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq hot start 2x master mix/product/New England Biolabs
    Average 96 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    onetaq hot start 2x master mix - by Bioz Stars, 2020-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to RT-PCR master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and OneTaq polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.

    Journal: bioRxiv

    Article Title: A Highly Scalable and Rapidly Deployable RNA Extraction-Free COVID-19 Assay by Quantitative Sanger Sequencing

    doi: 10.1101/2020.04.07.029199

    Figure Lengend Snippet: qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to RT-PCR master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and OneTaq polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.

    Article Snippet: qSanger Amplification Reverse transcription and amplification for was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S).

    Techniques: Amplification, Negative Control, Sequencing, Reverse Transcription Polymerase Chain Reaction, Purification, RNA Extraction

    Macerprepped DNA is good template for PCR. 1-3, PCR product by NEB Q5® HiFi polymerase. 4-6, PCR product by NEB Onetaq polymerase. I, 4, Miraprepped DNA. 2, 5, Macerprepped DNA with Solution 3 process. 3, 6, Macerprepped DNA with Solution N3 process. M, marker.

    Journal: bioRxiv

    Article Title: The Macerprep: a minimalist kit- and enzyme-free high-yield miniprep utilising alkaline lysis and alkaline hydrolysis principles

    doi: 10.1101/2020.08.13.249607

    Figure Lengend Snippet: Macerprepped DNA is good template for PCR. 1-3, PCR product by NEB Q5® HiFi polymerase. 4-6, PCR product by NEB Onetaq polymerase. I, 4, Miraprepped DNA. 2, 5, Macerprepped DNA with Solution 3 process. 3, 6, Macerprepped DNA with Solution N3 process. M, marker.

    Article Snippet: According to the NEB calculator (NEB, online tool), Tm for NEB Q5 and NEB Onetaq was determined to be 52°C and 61°C.

    Techniques: Polymerase Chain Reaction, Marker

    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Journal: Scientific Reports

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay

    doi: 10.1038/s41598-019-40035-5

    Figure Lengend Snippet: Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Article Snippet: Several master mixes were tested in the optimization experiments, namely AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA), AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA), OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA), Platinum Hot Start PCR Master Mix (Invitrogen, California, USA), and HotStarTaq DNA Polymerase (Qiagen, Germany).

    Techniques: Polymerase Chain Reaction, Hot Start PCR