onetaq (New England Biolabs)
New England Biolabs is a verified supplier 
99
|
Name:
OneTaq DNA Polymerase
Description:
Catalog Number:
M0480L
Price:
None
Score:
85
|
Buy from Supplier |
Structured Review
New England Biolabs
onetaq
https://www.bioz.com/result/onetaq/product/New England Biolabs
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
https://www.bioz.com/result/onetaq/product/New England Biolabs
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
onetaq - by Bioz Stars,
2019-12
99/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Methylation Sequencing:Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses Article Snippet: Paragraph title: Bisulfite sequencing. ... In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with Clone Assay:Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses Article Snippet: In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: The gDNA of isolated clones of M. florum L1 carrying the pMflT-o3 or pMflT-o4 oriC plasmid was purified using the Quick-gDNA MiniPrep kit (Zymo Research), according to the manufacturer's specifications. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila Article Snippet: To generate the pGX-2attp_WN_Scr_A-B replacement donor [ ], 5.299kb 5'-homology arm and 5.127kb 3'-homology arm were amplified and initially cloned in the pCR4-TOPO Vector (Invitrogen) and pCRII Vector (Invitrogen) respectively. .. The 5'-homology arm was amplified ( Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and Amplification:Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses Article Snippet: We used primers bis3a/F1 (5′-GTTGTTAGTAAATAGGTAGAAGGTT-3′), bis3a/F2 (5′-TTTGGATTTTGTAAAATTGATTGGT-3′), bis3a/R (5′-AAAAATCCCTTTACCTCCAAATC-3′), bis14/220/F1 (5′-TAGGTAAAAGATTAGGTTTTTTGTTG-3′), bis14/220/F2 (5′-GGGAGTTTTTAATTGTTTGTTTAGT-3′), and bis14/220/R (5′-ACTAAAAACAAACACTCAAAACAA-3′) under the following conditions: 10 cycles of heating at 95°C for 20 s and 57°C for 1 min (with a decrease of 0.5°C per cycle) followed by 72°C for 30 s, and then 30 cycles of 95°C for 20 s, 52°C for 1 min, and 72°C for 30 s. One μl of the product was repeatedly amplified with the second forward primer and the same reverse primer. .. In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with Article Title: Effects of Land Use Changes from Paddy Fields on Soil Bacterial Communities in a Hilly and Mountainous Area Article Snippet: The DGGE profiles of amplified 16S rRNA genes from the soils of natural slopes, including PF3, B1–3, G1, and CF1–2, were similar to each other ( ). .. The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation Article Snippet: DNA was desalted and purified using Zymo-Spin IC columns (Zymo Research). .. Ten nanograms of bisulfite-treated DNA were PCR amplified using Article Title: Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream Article Snippet: For the detection of SaPyV1 and SaPV1, PCR and nested-PCR protocols using specific primers were designed to amplify a fragment of 602 bp of large T antigen gene (Polyo602-F and Polyo602-R) and a 420-bp amplicon (Polyo420-F and Polyo420-R) within this or a fragment of 650 bp of the L1 gene (L1-3′-F and L1-3′-R) and an included 152-bp amplicon (NL1-3′-F and NL1-3′-R). .. The products of the reaction were subsequently used for conventional PCR using Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development Article Snippet: The injected side was visualized by ß-galactosidase staining and in situ hybridizations were carried out, as described by Harland [ ], using chordin [ ], sox2 [ ], twist [ ], msx2, alk3, alk6 or bmpr2 as antisense probes, respectively. .. Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using Article Title: Secretome Analysis from the Ectomycorrhizal Ascomycete Cenococcum geophilum Article Snippet: We validated gene presence–absence polymorphism for some selected C. geophilum MiSSPs using direct amplification of target genes including upstream and downstream regions. .. PCR reactions were performed with Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair Article Snippet: Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila Article Snippet: To generate the pGX-2attp_WN_Scr_A-B replacement donor [ ], 5.299kb 5'-homology arm and 5.127kb 3'-homology arm were amplified and initially cloned in the pCR4-TOPO Vector (Invitrogen) and pCRII Vector (Invitrogen) respectively. .. The 5'-homology arm was amplified ( Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development Article Snippet: Archaeal 16S rRNA genes were amplified with primer pair Cy5-labeled 20F ( ) and 915R ( ) and bacterial 16S rRNA genes with primer pair Cy5-labeled 8F ( ) and 907R ( ). .. The 25 μL PCR reaction volume contained 5 μL Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae Article Snippet: For full-length 16S or 18S rRNA gene amplification, we used 27f/1492r [ ] or 63f/1818r [ ] primers with annealing temperature of 59°C. .. The amplicons were added with Article Title: Horizontal Gene Transfer and Assortative Recombination within the Acinetobacter baumannii Clinical Population Provide Genetic Diversity at the Single carO Gene, Encoding a Major Outer Membrane Protein Channel Article Snippet: PCRs for the determination of the sequences of carO and housekeeping genes of the different A. baumannii clinical isolates were conducted using Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes Article Snippet: The DNA was extracted from gel pieces using the GenScript DNA gel extraction kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Article Title: Crossovers are associated with mutation and biased gene conversion at recombination hotspots Article Snippet: Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× Synthesized:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: DNA was fixed to the membrane by UV cross-linking (700 J) and blot prehybridized for 1 h in Church buffer (0.25 M NaHPO4 , 7% [wt/vol] SDS, 1× Denhardt's reagent, 1 mM EDTA). .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: RNA was then extracted with the Invisorb Spin Virus RNA Mini Kit (Stratec) and cDNA synthesized with the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific, Braunschweig, Germany). .. Real-time RT-PCR was performed utilizing a TaqMan probe, Autoradiography:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Quantitative RT-PCR:Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: The reaction product was directly used in a quantitative RT-PCR with the following primers specific for the influenza A virus M gene segment: Forward primer (5′→3′): AGATGAGTCTTCTAACCGAGGTCG, reverse primer (5′→3′): TGCAAAAACATCTTCAAGTCTCTG (Invitrogen). .. Real-time RT-PCR was performed utilizing a TaqMan probe, Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development Article Snippet: Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using Real-time Polymerase Chain Reaction:Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: The reaction product was directly used in a quantitative RT-PCR with the following primers specific for the influenza A virus M gene segment: Forward primer (5′→3′): AGATGAGTCTTCTAACCGAGGTCG, reverse primer (5′→3′): TGCAAAAACATCTTCAAGTCTCTG (Invitrogen). .. Real-time RT-PCR was performed utilizing a TaqMan probe, Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development Article Snippet: Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using Article Title: Crossovers are associated with mutation and biased gene conversion at recombination hotspots Article Snippet: Genotyping was carried out in-house by real-time PCR (CFX384 System, Bio-Rad), as described previously ( ). .. Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× Incubation:Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: 4 µL 5× RT-Buffer, 1µL dNTPs (10 mM), 1 µL Oligo(dT)18 Primer (100 µM), 1 µL Maxima H Minus Enzyme mix and 13 µL RNA were used per sample, which were incubated at 50 °C for 30 min. .. Real-time RT-PCR was performed utilizing a TaqMan probe, Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation Article Snippet: DNA was incubated 1 min at 95°C and 4 h at 55°C. .. Ten nanograms of bisulfite-treated DNA were PCR amplified using Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development Article Snippet: Paragraph title: Community Profiling of Incubation Samples via T-RFLP ... The 25 μL PCR reaction volume contained 5 μL Gel Extraction:Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes Article Snippet: The DNA was extracted from gel pieces using the GenScript DNA gel extraction kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Cell Culture:Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading Knock-In:Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading Transformation Assay:Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae Article Snippet: For full-length 16S or 18S rRNA gene amplification, we used 27f/1492r [ ] or 63f/1818r [ ] primers with annealing temperature of 59°C. .. The amplicons were added with Hybridization:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: Paragraph title: Southern blot hybridization. ... Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Flow Cytometry:Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae Article Snippet: For molecular analyses, 20 × 103 to 50 × 103 PES cells were flow sorted into sterile 1.5-ml microcentrifuge tubes. .. The amplicons were added with Sequencing:Article Title: Effects of Land Use Changes from Paddy Fields on Soil Bacterial Communities in a Hilly and Mountainous Area Article Snippet: The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with OneTaq DNA polymerase (New England Biolabs) from upper part (0–2 cm) soil. .. The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair Article Snippet: The sequence of the d 5SICS template strand is 5’-d- GAAATTAATACGACTCACTA TAGG GTTAAG CTTAACTTTA AGAAGGAGAT TTACTATGGG TCCCGNNN 5SICS N NNCGTCTGGT GAATTCCAAG TGCTAGCGCA TGTAATAACC CGG GTCATAG CTGTTTCCTGTGTG -3’, where N is randomized nucleotide and primer regions are underlined. .. Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae Article Snippet: The amplicons were added with Article Title: Horizontal Gene Transfer and Assortative Recombination within the Acinetobacter baumannii Clinical Population Provide Genetic Diversity at the Single carO Gene, Encoding a Major Outer Membrane Protein Channel Article Snippet: Paragraph title: Bacterial culture, PCRs, and DNA sequence determinations. ... PCRs for the determination of the sequences of carO and housekeeping genes of the different A. baumannii clinical isolates were conducted using Article Title: ATP/ADP Binding to a Novel Nucleotide Binding Domain of the Reticulocyte-binding Protein Py235 of Plasmodium yoelii Article Snippet: Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein Article Snippet: Point mutations of the NLS sequence were introduced to Htt 1–465-eYFP by either QuikChange II XL site-directed mutagenesis (Stratagene) or the inverse PCR method. .. All restriction enzymes and Inverse PCR:Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and Southern Blot:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: Paragraph title: Southern blot hybridization. ... Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Ligation:Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and Infection:Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: In order to analyze an equivalent number of virions the supernatants from infected MDCK cells were adjusted to an HA titer of 26 . .. Real-time RT-PCR was performed utilizing a TaqMan probe, Hemagglutination Assay:Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: In order to analyze an equivalent number of virions the supernatants from infected MDCK cells were adjusted to an HA titer of 26 . .. Real-time RT-PCR was performed utilizing a TaqMan probe, Generated:Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: Real-time RT-PCR was performed utilizing a TaqMan probe, Imaging:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Reverse Transcription Polymerase Chain Reaction:Article Title: Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream Article Snippet: Paragraph title: Nucleic acid extraction, PCR, and reverse transcription (RT)-PCR analyses. ... The products of the reaction were subsequently used for conventional PCR using Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development Article Snippet: Paragraph title: RT-PCR ... Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using Binding Assay:Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair Article Snippet: Nucleic Acid Electrophoresis:Article Title: ATP/ADP Binding to a Novel Nucleotide Binding Domain of the Reticulocyte-binding Protein Py235 of Plasmodium yoelii Article Snippet: Fluorescence:Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: Real-time RT-PCR was performed utilizing a TaqMan probe, Methylation:Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation Article Snippet: Paragraph title: Methylation pattern of differentially methylated regions at IG loci ... Ten nanograms of bisulfite-treated DNA were PCR amplified using Mutagenesis:Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and Isolation:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: The gDNA of isolated clones of M. florum L1 carrying the pMflT-o3 or pMflT-o4 oriC plasmid was purified using the Quick-gDNA MiniPrep kit (Zymo Research), according to the manufacturer's specifications. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development Article Snippet: The injected side was visualized by ß-galactosidase staining and in situ hybridizations were carried out, as described by Harland [ ], using chordin [ ], sox2 [ ], twist [ ], msx2, alk3, alk6 or bmpr2 as antisense probes, respectively. .. Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using Labeling:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: DNA was fixed to the membrane by UV cross-linking (700 J) and blot prehybridized for 1 h in Church buffer (0.25 M NaHPO4 , 7% [wt/vol] SDS, 1× Denhardt's reagent, 1 mM EDTA). .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Purification:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: The gDNA of isolated clones of M. florum L1 carrying the pMflT-o3 or pMflT-o4 oriC plasmid was purified using the Quick-gDNA MiniPrep kit (Zymo Research), according to the manufacturer's specifications. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation Article Snippet: DNA was desalted and purified using Zymo-Spin IC columns (Zymo Research). .. Ten nanograms of bisulfite-treated DNA were PCR amplified using Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair Article Snippet: Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development Article Snippet: For amplification, DNA extracts were purified and concentrated with PowerClean® Pro DNA Clean-Up Kit (MO BIO Laboratories, Carlsbad, CA, United States). .. The 25 μL PCR reaction volume contained 5 μL Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes Article Snippet: Plasmid DNA was purified using the QIAprep Spin Miniprep kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Polymerase Chain Reaction:Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses Article Snippet: We used primers bis3a/F1 (5′-GTTGTTAGTAAATAGGTAGAAGGTT-3′), bis3a/F2 (5′-TTTGGATTTTGTAAAATTGATTGGT-3′), bis3a/R (5′-AAAAATCCCTTTACCTCCAAATC-3′), bis14/220/F1 (5′-TAGGTAAAAGATTAGGTTTTTTGTTG-3′), bis14/220/F2 (5′-GGGAGTTTTTAATTGTTTGTTTAGT-3′), and bis14/220/R (5′-ACTAAAAACAAACACTCAAAACAA-3′) under the following conditions: 10 cycles of heating at 95°C for 20 s and 57°C for 1 min (with a decrease of 0.5°C per cycle) followed by 72°C for 30 s, and then 30 cycles of 95°C for 20 s, 52°C for 1 min, and 72°C for 30 s. One μl of the product was repeatedly amplified with the second forward primer and the same reverse primer. .. In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: DNA was fixed to the membrane by UV cross-linking (700 J) and blot prehybridized for 1 h in Church buffer (0.25 M NaHPO4 , 7% [wt/vol] SDS, 1× Denhardt's reagent, 1 mM EDTA). .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Article Title: Effects of Land Use Changes from Paddy Fields on Soil Bacterial Communities in a Hilly and Mountainous Area Article Snippet: The pyrosequencing technique was considered to have high levels of robustness, consistency, and resolution ( ). .. The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation Article Snippet: DNA was desalted and purified using Zymo-Spin IC columns (Zymo Research). .. Ten nanograms of bisulfite-treated DNA were PCR amplified using Article Title: Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream Article Snippet: For RT-PCR analyses, first-strand synthesis was carried out using Superscript III reverse transcriptase (Invitrogen, Carlsband, CA, USA) and the gene-specific reverse oligonucleotide L1R + 679. .. The products of the reaction were subsequently used for conventional PCR using Article Title: Secretome Analysis from the Ectomycorrhizal Ascomycete Cenococcum geophilum Article Snippet: The primers were designed using Primer 3.0 (Untergasser et al., ) from a conserved flanking sequences of each gene (Supplementary Table ). .. PCR reactions were performed with Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair Article Snippet: Paragraph title: PCR assay ... Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development Article Snippet: Archaeal 16S rRNA genes were amplified with primer pair Cy5-labeled 20F ( ) and 915R ( ) and bacterial 16S rRNA genes with primer pair Cy5-labeled 8F ( ) and 907R ( ). .. The 25 μL PCR reaction volume contained 5 μL Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae Article Snippet: An aliquot of 2 μl containing approximately 2 × 103 cells was added into a 0.2-ml PCR tube containing 30 μl of Q5 High Fidelity Master Mix (New England BioLabs) complemented with primers and nuclease-free water (Ambion). .. The amplicons were added with Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes Article Snippet: The DNA was extracted from gel pieces using the GenScript DNA gel extraction kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Article Title: Crossovers are associated with mutation and biased gene conversion at recombination hotspots Article Snippet: Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and Terminal Restriction Fragment Length Polymorphism:Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development Article Snippet: Paragraph title: Community Profiling of Incubation Samples via T-RFLP ... The 25 μL PCR reaction volume contained 5 μL CRISPR:Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila Article Snippet: Paragraph title: Generation of the CRISPR line ... The 5'-homology arm was amplified ( Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes Article Snippet: Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Nested PCR:Article Title: Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream Article Snippet: For the detection of SaPyV1 and SaPV1, PCR and nested-PCR protocols using specific primers were designed to amplify a fragment of 602 bp of large T antigen gene (Polyo602-F and Polyo602-R) and a 420-bp amplicon (Polyo420-F and Polyo420-R) within this or a fragment of 650 bp of the L1 gene (L1-3′-F and L1-3′-R) and an included 152-bp amplicon (NL1-3′-F and NL1-3′-R). .. The products of the reaction were subsequently used for conventional PCR using Plasmid Preparation:Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses Article Snippet: We used primers bis3a/F1 (5′-GTTGTTAGTAAATAGGTAGAAGGTT-3′), bis3a/F2 (5′-TTTGGATTTTGTAAAATTGATTGGT-3′), bis3a/R (5′-AAAAATCCCTTTACCTCCAAATC-3′), bis14/220/F1 (5′-TAGGTAAAAGATTAGGTTTTTTGTTG-3′), bis14/220/F2 (5′-GGGAGTTTTTAATTGTTTGTTTAGT-3′), and bis14/220/R (5′-ACTAAAAACAAACACTCAAAACAA-3′) under the following conditions: 10 cycles of heating at 95°C for 20 s and 57°C for 1 min (with a decrease of 0.5°C per cycle) followed by 72°C for 30 s, and then 30 cycles of 95°C for 20 s, 52°C for 1 min, and 72°C for 30 s. One μl of the product was repeatedly amplified with the second forward primer and the same reverse primer. .. In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: The gDNA of isolated clones of M. florum L1 carrying the pMflT-o3 or pMflT-o4 oriC plasmid was purified using the Quick-gDNA MiniPrep kit (Zymo Research), according to the manufacturer's specifications. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila Article Snippet: To generate the pGX-2attp_WN_Scr_A-B replacement donor [ ], 5.299kb 5'-homology arm and 5.127kb 3'-homology arm were amplified and initially cloned in the pCR4-TOPO Vector (Invitrogen) and pCRII Vector (Invitrogen) respectively. .. The 5'-homology arm was amplified ( Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae Article Snippet: For full-length 16S or 18S rRNA gene amplification, we used 27f/1492r [ ] or 63f/1818r [ ] primers with annealing temperature of 59°C. .. The amplicons were added with Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes Article Snippet: Plasmid DNA was purified using the QIAprep Spin Miniprep kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading Article Title: Expression, crystallization and preliminary X-ray analysis of the phosphoribosylglycinamide formyltransferase from Streptococcus mutans Article Snippet: Enzymes for recombinant DNA technology such as Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein Article Snippet: Paragraph title: Plasmid Constructs ... All restriction enzymes and Software:Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae Article Snippet: The amplicons were added with SYBR Green Assay:Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development Article Snippet: Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using Article Title: Crossovers are associated with mutation and biased gene conversion at recombination hotspots Article Snippet: PCRs for genotyping were carried out in a volume of 10 µL, using OneTaq DNA Polymerase (NEB) or Phusion Hot Start II High-Fidelity DNA Polymerase (ThermoFisher Scientific). .. Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× Denaturing Gradient Gel Electrophoresis:Article Title: Effects of Land Use Changes from Paddy Fields on Soil Bacterial Communities in a Hilly and Mountainous Area Article Snippet: The DGGE profiles of amplified 16S rRNA genes from the soils of natural slopes, including PF3, B1–3, G1, and CF1–2, were similar to each other ( ). .. The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with Agarose Gel Electrophoresis:Article Title: Development of oriC-Based Plasmids for Mesoplasma florum Article Snippet: After digestion, restriction fragments were separated on a 0.8% agarose gel, and DNA was depurinated and denatured by soaking the gel for 15 min in 0.25 M HCl and 0.4 M NaOH, respectively. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair Article Snippet: Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development Article Snippet: The 25 μL PCR reaction volume contained 5 μL Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading In Vitro:Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication Article Snippet: Real-time RT-PCR was performed utilizing a TaqMan probe, Electrophoresis:Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading Concentration Assay:Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading Construct:Article Title: Horizontal Gene Transfer of Functional Type VI Killing Genes by Natural Transformation Article Snippet: In-frame deletions and promoter-replacement mutants in V. cholerae were constructed by previously described allelic exchange methods ( ). .. DNA-modifying enzymes and restriction nucleases (Promega and New England Biolabs); Gibson assembly mix (New England Biolabs); and Q5, Phusion, and Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes Article Snippet: Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein Article Snippet: Paragraph title: Plasmid Constructs ... All restriction enzymes and DNA Purification:Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading Lysis:Article Title: Self-Cloning CRISPR Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading Recombinant:Article Title: Horizontal Gene Transfer of Functional Type VI Killing Genes by Natural Transformation Article Snippet: Paragraph title: Recombinant DNA techniques and construction of V. cholerae mutants. ... DNA-modifying enzymes and restriction nucleases (Promega and New England Biolabs); Gibson assembly mix (New England Biolabs); and Q5, Phusion, and Article Title: Expression, crystallization and preliminary X-ray analysis of the phosphoribosylglycinamide formyltransferase from Streptococcus mutans Article Snippet: In this study, we report the expression, crystallization and preliminary crystallographic analysis of phosphoribosylglycinamide formyltransferase from S. mutans . .. Enzymes for recombinant DNA technology such as |