onetaq  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    OneTaq 2X Master Mix with Standard Buffer
    Description:
    OneTaq 2X Master Mix with Standard Buffer 500 rxns
    Catalog Number:
    M0482L
    Price:
    188
    Category:
    Thermostable DNA Polymerases
    Size:
    500 rxns
    Buy from Supplier


    Structured Review

    New England Biolabs onetaq
    OneTaq 2X Master Mix with Standard Buffer
    OneTaq 2X Master Mix with Standard Buffer 500 rxns
    https://www.bioz.com/result/onetaq/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    onetaq - by Bioz Stars, 2021-06
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: E. coli ET12567/pUZ8002 was used as the host for intergeneric conjugations . pUWL201PWT, which is a derivative of pUWL201PW containing an oriT sequence that was cloned into its Pst I site, was used as the shuttle vector for gene complementations, biotransformation, and heterologous production of PtmU4 in Streptomyces . .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB). .. For Southern analysis, digoxigenin labeling of DNA probes, hybridization, and detection were performed according to the protocols provided by the manufacturer (Roche Diagnostics Corp.).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Creation of Δ1D2A-GLuc/SGLuc chimeras For construction of Δ1D2A-GLuc/SGLuc chimeras, nucleotide sequence encoding the Δ1D2A-SGLuc sequence was synthesized by GenScript and cloned into the pUC57kan vector. .. PCR amplification was performed using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-2A-F and GLuc-R-NotI (Table ). .. Insertion into the pTarget vector (Promega) followed manufacturer’s instructions for T/A cloning.

    Article Title: Antihyperglycaemia and related gene expressions of aqueous extract of Gongronema latifolium leaf in alloxan-induced diabetic rats
    Article Snippet: ProtoScript First Standard cDNA Synthesis Kit (NEB) was used in converting purified DNA-free RNA into cDNA immediately. .. Also, OneTaq® 2X Master Mix (NEB) was used in PCR amplification using the following primer set: Hexokinase Forward: GTGTACAAGCTGCACCCGA Reverse: CAGCATGCAAGCCTTCTTG Glucose-6-phosphatase Forward: GCTCCGTGCCTCTGATAAA Reverse: CCACGAAAGATAGCGAGAGTAG The expression level of the genes studied was normalized by GADPH, and the band density was measured using ImageJ is plotted as a bar graph as illustrated by Elekofehinti et al. ( ). ..

    Article Title: Combinatorial Strategies for Improving Multiple-Stress Resistance in Industrially Relevant Escherichia coli Strains
    Article Snippet: Saturated overnight cultures were grown in LB medium for each transposon insertion mutant, and genomic DNA was extracted from cell pellets using either the QIAamp DNA minikit (Qiagen, Valencia, CA) or the PureLink genomic DNA minikit (Life Technologies Europe, Nærum, Denmark). .. Tn 5 insertion sites were determined by a single-primer PCR method ( ) using OneTaq 2× master mix (New England BioLabs, Ipswich, MA), 50 ng of genomic DNA template, and 10 μM primer. .. Single primers were designed for PCR amplification outward from either the 5′ or the 3′ end of the Tn 5 cassette (see Table S1 in the supplemental material, primers 1 to 6).

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Each reaction was carried out at least twice Genomic DNA was isolated from the cells 2 days later with the DNeasy Blood and Tissue Mini Kit. .. PCR amplification of the deletion-containing regions was carried out using OneTaq (NEB) and Q5 high fidelity polymerase using 150 ng of gDNA according to the manufacturer's instructions. .. Amplicons were subjected agarose gel electrophoresis, and subsequently the deletion-containing bands, as well as the full-length bands where applicable, were excised and purified using the MinElute Gel Extraction Kit (Qiagen).

    Amplification:

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Creation of Δ1D2A-GLuc/SGLuc chimeras For construction of Δ1D2A-GLuc/SGLuc chimeras, nucleotide sequence encoding the Δ1D2A-SGLuc sequence was synthesized by GenScript and cloned into the pUC57kan vector. .. PCR amplification was performed using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-2A-F and GLuc-R-NotI (Table ). .. Insertion into the pTarget vector (Promega) followed manufacturer’s instructions for T/A cloning.

    Article Title: Antihyperglycaemia and related gene expressions of aqueous extract of Gongronema latifolium leaf in alloxan-induced diabetic rats
    Article Snippet: ProtoScript First Standard cDNA Synthesis Kit (NEB) was used in converting purified DNA-free RNA into cDNA immediately. .. Also, OneTaq® 2X Master Mix (NEB) was used in PCR amplification using the following primer set: Hexokinase Forward: GTGTACAAGCTGCACCCGA Reverse: CAGCATGCAAGCCTTCTTG Glucose-6-phosphatase Forward: GCTCCGTGCCTCTGATAAA Reverse: CCACGAAAGATAGCGAGAGTAG The expression level of the genes studied was normalized by GADPH, and the band density was measured using ImageJ is plotted as a bar graph as illustrated by Elekofehinti et al. ( ). ..

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Each reaction was carried out at least twice Genomic DNA was isolated from the cells 2 days later with the DNeasy Blood and Tissue Mini Kit. .. PCR amplification of the deletion-containing regions was carried out using OneTaq (NEB) and Q5 high fidelity polymerase using 150 ng of gDNA according to the manufacturer's instructions. .. Amplicons were subjected agarose gel electrophoresis, and subsequently the deletion-containing bands, as well as the full-length bands where applicable, were excised and purified using the MinElute Gel Extraction Kit (Qiagen).

    Expressing:

    Article Title: Antihyperglycaemia and related gene expressions of aqueous extract of Gongronema latifolium leaf in alloxan-induced diabetic rats
    Article Snippet: ProtoScript First Standard cDNA Synthesis Kit (NEB) was used in converting purified DNA-free RNA into cDNA immediately. .. Also, OneTaq® 2X Master Mix (NEB) was used in PCR amplification using the following primer set: Hexokinase Forward: GTGTACAAGCTGCACCCGA Reverse: CAGCATGCAAGCCTTCTTG Glucose-6-phosphatase Forward: GCTCCGTGCCTCTGATAAA Reverse: CCACGAAAGATAGCGAGAGTAG The expression level of the genes studied was normalized by GADPH, and the band density was measured using ImageJ is plotted as a bar graph as illustrated by Elekofehinti et al. ( ). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Shared αβ T Cell Receptor Usage in Lungs of Sarcoidosis Patients with Löfgren’s Syndrome
    Article Snippet: Cells for emulsion and non-emulsion reactions were washed twice in MACS buffer: DPBS (Hyclone, Logan, UT) with 0.5% FBS (Hyclone) and 1% HEPES (Gibco, Carlsbad, CA). .. Cells were centrifuged and resuspended in 50 μl of RT-PCR master mix [1x OneTaq One-Step RT-PCR buffer and enzyme (New England Biolabs, Ipswich, MA), 10 U RNase out (Invitrogen, Carlsbad, CA), 2.5 mg/ml acetylated BSA (Sigma-Aldrich, St. Louis, MO), 400 nM each of the C region primers and Stepout primers, and 40 nM each of the V region primers as described in ]. .. The emulsion cells had 300 μl of the oil mixture added according to the specifications in the Micellula Emulsion and Purification Kit (CHIMERx, Milwaukee, WI).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs neb onetaq
    Macerprepped DNA is good template for PCR. 1-3, PCR product by <t>NEB</t> Q5® HiFi polymerase. 4-6, PCR product by NEB <t>Onetaq</t> polymerase. I, 4, Miraprepped DNA. 2, 5, Macerprepped DNA with Solution 3 process. 3, 6, Macerprepped DNA with Solution N3 process. M, marker.
    Neb Onetaq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/neb onetaq/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    neb onetaq - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    95
    New England Biolabs onetaq hot start 2x master mix
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); <t>OneTaq</t> = OneTaq Hot Start <t>2X</t> Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Onetaq Hot Start 2x Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq hot start 2x master mix/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    onetaq hot start 2x master mix - by Bioz Stars, 2021-06
    95/100 stars
      Buy from Supplier

    99
    New England Biolabs onetaq one step rt pcr kit
    qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to <t>RT-PCR</t> master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and <t>OneTaq</t> polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.
    Onetaq One Step Rt Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq one step rt pcr kit/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    onetaq one step rt pcr kit - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    Image Search Results


    Macerprepped DNA is good template for PCR. 1-3, PCR product by NEB Q5® HiFi polymerase. 4-6, PCR product by NEB Onetaq polymerase. I, 4, Miraprepped DNA. 2, 5, Macerprepped DNA with Solution 3 process. 3, 6, Macerprepped DNA with Solution N3 process. M, marker.

    Journal: bioRxiv

    Article Title: The Macerprep: a minimalist kit- and enzyme-free high-yield miniprep utilising alkaline lysis and alkaline hydrolysis principles

    doi: 10.1101/2020.08.13.249607

    Figure Lengend Snippet: Macerprepped DNA is good template for PCR. 1-3, PCR product by NEB Q5® HiFi polymerase. 4-6, PCR product by NEB Onetaq polymerase. I, 4, Miraprepped DNA. 2, 5, Macerprepped DNA with Solution 3 process. 3, 6, Macerprepped DNA with Solution N3 process. M, marker.

    Article Snippet: According to the NEB calculator (NEB, online tool), Tm for NEB Q5 and NEB Onetaq was determined to be 52°C and 61°C.

    Techniques: Polymerase Chain Reaction, Marker

    Pairing of TRAV12-1 + and TRBV2 + CD4 + T cells as determined by emulsion PCR PBMCs were labeled with CFSE, spun, and resuspended in RT-PCR master mix. 300 μl of the oil mixture from the Micellula kit was added on top, and the contents were vortexed for 2.5 minutes. Image was taken at 20× (A). CD4 + T cells were purified from BAL cells or PBMCs from one patient and utilized in emulsion (em) or non-emulsion (non) PCR reactions. A representative 2% agarose gel is shown displaying a DNA ladder (L) and the products obtained after PCR 3 (B). Six DR3 + LS BAL samples were subjected to ePCR, and Vβ usage on TRAV12-1-utilizing BAL CD4 + T cells is shown (C). Vα usage on TRBV2-utilizing BAL CD4 + T cells from six DR3 + LS patients is shown (D). Shown are thirteen αβTCR pairs as determined by ePCR (E). The percentage that the listed TCRα is paired with the listed TCRβ is shown (% α paired with β), as opposed to pairing with other TCRβ in a given patient sample, and vice versa (% β paired with α). Amino acids forming shared or similar CDR3 motifs colored and bolded. TRAV12-1 usage on TRBV2 + cells, TRBV2 usage on TRAV12-1 + cells, TRAV26-1 usage on TRBV20-1 + cells, and TRBV20-1 usage on TRAV26-1 + cells are shown for comparison amongst patient groups (F). Bars represent means ± SD. p values were calculated based on Kruskal-Wallis tests with Dunn’s post-test; * = p

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    Article Title: Shared αβ T Cell Receptor Usage in Lungs of Sarcoidosis Patients with Löfgren’s Syndrome

    doi: 10.4049/jimmunol.1700570

    Figure Lengend Snippet: Pairing of TRAV12-1 + and TRBV2 + CD4 + T cells as determined by emulsion PCR PBMCs were labeled with CFSE, spun, and resuspended in RT-PCR master mix. 300 μl of the oil mixture from the Micellula kit was added on top, and the contents were vortexed for 2.5 minutes. Image was taken at 20× (A). CD4 + T cells were purified from BAL cells or PBMCs from one patient and utilized in emulsion (em) or non-emulsion (non) PCR reactions. A representative 2% agarose gel is shown displaying a DNA ladder (L) and the products obtained after PCR 3 (B). Six DR3 + LS BAL samples were subjected to ePCR, and Vβ usage on TRAV12-1-utilizing BAL CD4 + T cells is shown (C). Vα usage on TRBV2-utilizing BAL CD4 + T cells from six DR3 + LS patients is shown (D). Shown are thirteen αβTCR pairs as determined by ePCR (E). The percentage that the listed TCRα is paired with the listed TCRβ is shown (% α paired with β), as opposed to pairing with other TCRβ in a given patient sample, and vice versa (% β paired with α). Amino acids forming shared or similar CDR3 motifs colored and bolded. TRAV12-1 usage on TRBV2 + cells, TRBV2 usage on TRAV12-1 + cells, TRAV26-1 usage on TRBV20-1 + cells, and TRBV20-1 usage on TRAV26-1 + cells are shown for comparison amongst patient groups (F). Bars represent means ± SD. p values were calculated based on Kruskal-Wallis tests with Dunn’s post-test; * = p

    Article Snippet: Cells were centrifuged and resuspended in 50 μl of RT-PCR master mix [1x OneTaq One-Step RT-PCR buffer and enzyme (New England Biolabs, Ipswich, MA), 10 U RNase out (Invitrogen, Carlsbad, CA), 2.5 mg/ml acetylated BSA (Sigma-Aldrich, St. Louis, MO), 400 nM each of the C region primers and Stepout primers, and 40 nM each of the V region primers as described in ].

    Techniques: Polymerase Chain Reaction, Labeling, Reverse Transcription Polymerase Chain Reaction, Purification, Agarose Gel Electrophoresis

    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Journal: Scientific Reports

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay

    doi: 10.1038/s41598-019-40035-5

    Figure Lengend Snippet: Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Article Snippet: Several master mixes were tested in the optimization experiments, namely AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA), AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA), OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA), Platinum Hot Start PCR Master Mix (Invitrogen, California, USA), and HotStarTaq DNA Polymerase (Qiagen, Germany).

    Techniques: Polymerase Chain Reaction, Hot Start PCR

    qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to RT-PCR master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and OneTaq polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.

    Journal: bioRxiv

    Article Title: A Highly Scalable and Rapidly Deployable RNA Extraction-Free COVID-19 Assay by Quantitative Sanger Sequencing

    doi: 10.1101/2020.04.07.029199

    Figure Lengend Snippet: qSanger detects SARS-COV-2 RNA when amplified directly from viral particles in transport medium. ( A ) A total of 32 no-template controls, 32 negative control samples (Seracare) and 32 positive samples (Seracare) were assayed. All results were concordant with Seracare and NTC. Three samples were no-calls (undetermined) due to low signal-to-noise ratio in the sequencing results. ( B ) Positive Seracare samples were added to RT-PCR master mix either directly from the VTM or after purification with RNA extraction kit at 125 GCE. The ratio of reference and spike-in intensities were measured by custom data analysis. The mean qSanger ratio was 0.745 (± 0.043 s.e.m., n=8) for direct addition, and 0.97 (± 0.041 s.e.m., n=8) for purified. The coefficient of variation (CV) of positive seracare samples were measured for both Luna and OneTaq polymerase mixes. The CV for Luna direct VTM was 16.4% (n=8), and for Luna purified was 12.1% (n=8). This is consistent with the theoretical counting noise associated with quantifying ~100 molecules.

    Article Snippet: qSanger Amplification Reverse transcription and amplification for was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S).

    Techniques: Amplification, Negative Control, Sequencing, Reverse Transcription Polymerase Chain Reaction, Purification, RNA Extraction