onetaq  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    OneTaq DNA Polymerase
    Description:

    Catalog Number:
    M0480L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs onetaq

    https://www.bioz.com/result/onetaq/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    onetaq - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Methylation Sequencing:

    Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses
    Article Snippet: Paragraph title: Bisulfite sequencing. ... In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with OneTaq DNA polymerase (New England BioLabs).

    Clone Assay:

    Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses
    Article Snippet: In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with OneTaq DNA polymerase (New England BioLabs). .. One μl of the product was repeatedly amplified with a second forward primer, bisMLV/F2 (5′-GGTGTTTTAAGGATTTGAAATGATTT-3′), and the same reverse primer under the following conditions: 95°C for 5 min, 12 cycles of 95°C for 50 s, 58°C for 2 min, and 68°C for 1.5 min, and then 8 cycles of 95°C for 45 s, 54°C for 2 min, and 68°C for 1.5 min with an increase of 2 s per cycle.

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: The gDNA of isolated clones of M. florum L1 carrying the pMflT-o3 or pMflT-o4 oriC plasmid was purified using the Quick-gDNA MiniPrep kit (Zymo Research), according to the manufacturer's specifications. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer).

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: To generate the pGX-2attp_WN_Scr_A-B replacement donor [ ], 5.299kb 5'-homology arm and 5.127kb 3'-homology arm were amplified and initially cloned in the pCR4-TOPO Vector (Invitrogen) and pCRII Vector (Invitrogen) respectively. .. The 5'-homology arm was amplified (OneTaq, NEB) with a forward primer containing a NotI site and a reverse primer containing a NheI site.

    Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein
    Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and PCR polymerases were purchased from New England Biolabs unless otherwise stated.

    Amplification:

    Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses
    Article Snippet: We used primers bis3a/F1 (5′-GTTGTTAGTAAATAGGTAGAAGGTT-3′), bis3a/F2 (5′-TTTGGATTTTGTAAAATTGATTGGT-3′), bis3a/R (5′-AAAAATCCCTTTACCTCCAAATC-3′), bis14/220/F1 (5′-TAGGTAAAAGATTAGGTTTTTTGTTG-3′), bis14/220/F2 (5′-GGGAGTTTTTAATTGTTTGTTTAGT-3′), and bis14/220/R (5′-ACTAAAAACAAACACTCAAAACAA-3′) under the following conditions: 10 cycles of heating at 95°C for 20 s and 57°C for 1 min (with a decrease of 0.5°C per cycle) followed by 72°C for 30 s, and then 30 cycles of 95°C for 20 s, 52°C for 1 min, and 72°C for 30 s. One μl of the product was repeatedly amplified with the second forward primer and the same reverse primer. .. In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with OneTaq DNA polymerase (New England BioLabs).

    Article Title: Effects of Land Use Changes from Paddy Fields on Soil Bacterial Communities in a Hilly and Mountainous Area
    Article Snippet: The DGGE profiles of amplified 16S rRNA genes from the soils of natural slopes, including PF3, B1–3, G1, and CF1–2, were similar to each other ( ). .. The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with OneTaq DNA polymerase (New England Biolabs) from upper part (0–2 cm) soil.

    Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation
    Article Snippet: DNA was desalted and purified using Zymo-Spin IC columns (Zymo Research). .. Ten nanograms of bisulfite-treated DNA were PCR amplified using OneTaq DNA Polymerase (New England Biolabs). .. Amplicons were purified, cloned using Zero Blunt TOPO PCR cloning kit (Invitrogen), and sequenced.

    Article Title: Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream
    Article Snippet: For the detection of SaPyV1 and SaPV1, PCR and nested-PCR protocols using specific primers were designed to amplify a fragment of 602 bp of large T antigen gene (Polyo602-F and Polyo602-R) and a 420-bp amplicon (Polyo420-F and Polyo420-R) within this or a fragment of 650 bp of the L1 gene (L1-3′-F and L1-3′-R) and an included 152-bp amplicon (NL1-3′-F and NL1-3′-R). .. The products of the reaction were subsequently used for conventional PCR using OneTaq polymerase (New England BioLabs, Inc.) and oligonucleotides L1F + 336 and L1R + 679 producing fragments of 421 and 349 bp for the predicted precursor and processed sequences, respectively.

    Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development
    Article Snippet: The injected side was visualized by ß-galactosidase staining and in situ hybridizations were carried out, as described by Harland [ ], using chordin [ ], sox2 [ ], twist [ ], msx2, alk3, alk6 or bmpr2 as antisense probes, respectively. .. Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA). .. Primer sequences are provided in Additional file : Table S1.

    Article Title: Secretome Analysis from the Ectomycorrhizal Ascomycete Cenococcum geophilum
    Article Snippet: We validated gene presence–absence polymorphism for some selected C. geophilum MiSSPs using direct amplification of target genes including upstream and downstream regions. .. PCR reactions were performed with OneTaq® DNA Polymerases according to the manufacturer's instructions (New England Biolabs, Mass, USA) and amplicons run on 1% agarose gels.

    Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair
    Article Snippet: OneTaq and Taq enzymes were obtained from New England Biolabs and KOD Hot Start DNA Polymerase was obtained from Novagen/EMD Millipore Biosciences (Billerica, MA). .. PCR amplifications were performed in a total volume of 25 µL and with conditions specific for each assay as described in .

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: To generate the pGX-2attp_WN_Scr_A-B replacement donor [ ], 5.299kb 5'-homology arm and 5.127kb 3'-homology arm were amplified and initially cloned in the pCR4-TOPO Vector (Invitrogen) and pCRII Vector (Invitrogen) respectively. .. The 5'-homology arm was amplified (OneTaq, NEB) with a forward primer containing a NotI site and a reverse primer containing a NheI site. .. The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site.

    Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development
    Article Snippet: Archaeal 16S rRNA genes were amplified with primer pair Cy5-labeled 20F ( ) and 915R ( ) and bacterial 16S rRNA genes with primer pair Cy5-labeled 8F ( ) and 907R ( ). .. The 25 μL PCR reaction volume contained 5 μL OneTaq® Standard Reaction Buffer (New England Biolabs, Ipswich, MA, United States), 5 μL dNTPs (each 1 mM; Fermentas, Thermo Fisher Scientific, Waltham, MA, United States), 1.5 μL BSA (3 g L-1 ), 0.6 μL (Archaea ) or 0.4 μL (Bacteria ) of each primer (10 μM), 0.125 μL OneTaq® Hot Start DNA Polymerase (5 U μL-1 ), 1–2.5 μL sample DNA and was filled up with dH2 O.

    Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae
    Article Snippet: For full-length 16S or 18S rRNA gene amplification, we used 27f/1492r [ ] or 63f/1818r [ ] primers with annealing temperature of 59°C. .. The amplicons were added with A-tails (OneTaq DNA polymerase, New England BioLabs), ligated to the pGEM T-Easy vector (Promega), and transformed into the NEB 5-alpha competent Escherichia coli cells (New England BioLabs).

    Article Title: Horizontal Gene Transfer and Assortative Recombination within the Acinetobacter baumannii Clinical Population Provide Genetic Diversity at the Single carO Gene, Encoding a Major Outer Membrane Protein Channel
    Article Snippet: PCRs for the determination of the sequences of carO and housekeeping genes of the different A. baumannii clinical isolates were conducted using Pfu DNA polymerase (New England BioLabs), and genomic material was obtained by heating whole-bacterial-cell cultures , unless otherwise specified. .. PCRs for the determination of the sequences of carO and housekeeping genes of the different A. baumannii clinical isolates were conducted using Pfu DNA polymerase (New England BioLabs), and genomic material was obtained by heating whole-bacterial-cell cultures , unless otherwise specified.

    Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes
    Article Snippet: The DNA was extracted from gel pieces using the GenScript DNA gel extraction kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Pfu DNA polymerase (New England Biolabs). .. DNA sequencing was performed by Life Technologies (Shanghai Invitrogen, China).

    Article Title: Crossovers are associated with mutation and biased gene conversion at recombination hotspots
    Article Snippet: Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× OneTaq Reaction Buffer (NEB), 0.125 U OneTaq Hot Start DNA polymerase, 0.2 mM dNTPs, and 2.5 mM MgCl2 or 1× Phusion HF Buffer (ThermoFisher Scientific), 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase, and 0.16 mM dNTPs. .. The reactions were carried out with an initial heating step of 95 °C for 2 min, followed by 45 cycles at 95 °C for 30 s, annealing temperature for 30 s, and 68 °C for 15 s when using OneTaq Hot Start DNA polymerase or with 98 °C for 30 s, followed by 45 cycles at 98 °C for 5 s, annealing temperature for 15 s, and 72 °C for 5 s when using Phusion Hot Start II High-Fidelity DNA Polymerase.

    Synthesized:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: DNA was fixed to the membrane by UV cross-linking (700 J) and blot prehybridized for 1 h in Church buffer (0.25 M NaHPO4 , 7% [wt/vol] SDS, 1× Denhardt's reagent, 1 mM EDTA). .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer). .. Radiolabeled DNA probe was separated from unincorporated radioactive nucleotides using Bio-Spin columns (Bio-Rad), according to the manufacturer's recommendations.

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: RNA was then extracted with the Invisorb Spin Virus RNA Mini Kit (Stratec) and cDNA synthesized with the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific, Braunschweig, Germany). .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany).

    Autoradiography:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer). .. After hybridization, the membrane was washed twice for 5 min each using 2× SSC (0.3 M NaCl, 30 mM sodium citrate) containing 1% (wt/vol) SDS at 50°C and washed again using 0.2× SSC containing 1% (wt/vol) SDS at 55°C.

    Quantitative RT-PCR:

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: The reaction product was directly used in a quantitative RT-PCR with the following primers specific for the influenza A virus M gene segment: Forward primer (5′→3′): AGATGAGTCTTCTAACCGAGGTCG, reverse primer (5′→3′): TGCAAAAACATCTTCAAGTCTCTG (Invitrogen). .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany). .. One assay with a total volume of 25 µL contained 5 µL 5× OneTaq-buffer, 16 µl RNAase free water, 0.5 µL dNTPs (100 µM), 0.25µL forward and reverse primer (100 µM), 0.75 µL probe (10µM, 6FAM-TCAGGCCCCCTCAAAGCCGA-TMR), 0.25 µL OneTaq DNA polymerase and 2 µL cDNA as template.

    Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development
    Article Snippet: Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA). .. Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: The reaction product was directly used in a quantitative RT-PCR with the following primers specific for the influenza A virus M gene segment: Forward primer (5′→3′): AGATGAGTCTTCTAACCGAGGTCG, reverse primer (5′→3′): TGCAAAAACATCTTCAAGTCTCTG (Invitrogen). .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany). .. One assay with a total volume of 25 µL contained 5 µL 5× OneTaq-buffer, 16 µl RNAase free water, 0.5 µL dNTPs (100 µM), 0.25µL forward and reverse primer (100 µM), 0.75 µL probe (10µM, 6FAM-TCAGGCCCCCTCAAAGCCGA-TMR), 0.25 µL OneTaq DNA polymerase and 2 µL cDNA as template.

    Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development
    Article Snippet: Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA). .. Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA).

    Article Title: Crossovers are associated with mutation and biased gene conversion at recombination hotspots
    Article Snippet: Genotyping was carried out in-house by real-time PCR (CFX384 System, Bio-Rad), as described previously ( ). .. Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× OneTaq Reaction Buffer (NEB), 0.125 U OneTaq Hot Start DNA polymerase, 0.2 mM dNTPs, and 2.5 mM MgCl2 or 1× Phusion HF Buffer (ThermoFisher Scientific), 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase, and 0.16 mM dNTPs.

    Incubation:

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: 4 µL 5× RT-Buffer, 1µL dNTPs (10 mM), 1 µL Oligo(dT)18 Primer (100 µM), 1 µL Maxima H Minus Enzyme mix and 13 µL RNA were used per sample, which were incubated at 50 °C for 30 min. .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany).

    Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation
    Article Snippet: DNA was incubated 1 min at 95°C and 4 h at 55°C. .. Ten nanograms of bisulfite-treated DNA were PCR amplified using OneTaq DNA Polymerase (New England Biolabs).

    Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development
    Article Snippet: Paragraph title: Community Profiling of Incubation Samples via T-RFLP ... The 25 μL PCR reaction volume contained 5 μL OneTaq® Standard Reaction Buffer (New England Biolabs, Ipswich, MA, United States), 5 μL dNTPs (each 1 mM; Fermentas, Thermo Fisher Scientific, Waltham, MA, United States), 1.5 μL BSA (3 g L-1 ), 0.6 μL (Archaea ) or 0.4 μL (Bacteria ) of each primer (10 μM), 0.125 μL OneTaq® Hot Start DNA Polymerase (5 U μL-1 ), 1–2.5 μL sample DNA and was filled up with dH2 O.

    Gel Extraction:

    Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes
    Article Snippet: The DNA was extracted from gel pieces using the GenScript DNA gel extraction kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Pfu DNA polymerase (New England Biolabs).

    Cell Culture:

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    Knock-In:

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    Transformation Assay:

    Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae
    Article Snippet: For full-length 16S or 18S rRNA gene amplification, we used 27f/1492r [ ] or 63f/1818r [ ] primers with annealing temperature of 59°C. .. The amplicons were added with A-tails (OneTaq DNA polymerase, New England BioLabs), ligated to the pGEM T-Easy vector (Promega), and transformed into the NEB 5-alpha competent Escherichia coli cells (New England BioLabs). .. Plasmids from the positive colonies were sequenced with T7 and SP6 primers to cover the full amplicon length.

    Hybridization:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: Paragraph title: Southern blot hybridization. ... Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer).

    Flow Cytometry:

    Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae
    Article Snippet: For molecular analyses, 20 × 103 to 50 × 103 PES cells were flow sorted into sterile 1.5-ml microcentrifuge tubes. .. The amplicons were added with A-tails (OneTaq DNA polymerase, New England BioLabs), ligated to the pGEM T-Easy vector (Promega), and transformed into the NEB 5-alpha competent Escherichia coli cells (New England BioLabs).

    Sequencing:

    Article Title: Effects of Land Use Changes from Paddy Fields on Soil Bacterial Communities in a Hilly and Mountainous Area
    Article Snippet: The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with OneTaq DNA polymerase (New England Biolabs) from upper part (0–2 cm) soil. .. The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with OneTaq DNA polymerase (New England Biolabs) from upper part (0–2 cm) soil.

    Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair
    Article Snippet: The sequence of the d 5SICS template strand is 5’-d- GAAATTAATACGACTCACTA TAGG GTTAAG CTTAACTTTA AGAAGGAGAT TTACTATGGG TCCCGNNN 5SICS N NNCGTCTGGT GAATTCCAAG TGCTAGCGCA TGTAATAACC CGG GTCATAG CTGTTTCCTGTGTG -3’, where N is randomized nucleotide and primer regions are underlined. .. OneTaq and Taq enzymes were obtained from New England Biolabs and KOD Hot Start DNA Polymerase was obtained from Novagen/EMD Millipore Biosciences (Billerica, MA).

    Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae
    Article Snippet: The amplicons were added with A-tails (OneTaq DNA polymerase, New England BioLabs), ligated to the pGEM T-Easy vector (Promega), and transformed into the NEB 5-alpha competent Escherichia coli cells (New England BioLabs). .. The 18S rRNA gene sequences were aligned with 18 reference sequences of haptophytes (1,400 positions), and phylogenetic relationships for the dataset were calculated with MrBayes software [ ].

    Article Title: Horizontal Gene Transfer and Assortative Recombination within the Acinetobacter baumannii Clinical Population Provide Genetic Diversity at the Single carO Gene, Encoding a Major Outer Membrane Protein Channel
    Article Snippet: Paragraph title: Bacterial culture, PCRs, and DNA sequence determinations. ... PCRs for the determination of the sequences of carO and housekeeping genes of the different A. baumannii clinical isolates were conducted using Pfu DNA polymerase (New England BioLabs), and genomic material was obtained by heating whole-bacterial-cell cultures , unless otherwise specified.

    Article Title: ATP/ADP Binding to a Novel Nucleotide Binding Domain of the Reticulocyte-binding Protein Py235 of Plasmodium yoelii
    Article Snippet: Pfu DNA polymerase and restriction enzymes were purchased from New England Biolabs. .. Pfu DNA polymerase and restriction enzymes were purchased from New England Biolabs.

    Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein
    Article Snippet: Point mutations of the NLS sequence were introduced to Htt 1–465-eYFP by either QuikChange II XL site-directed mutagenesis (Stratagene) or the inverse PCR method. .. All restriction enzymes and PCR polymerases were purchased from New England Biolabs unless otherwise stated.

    Inverse PCR:

    Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein
    Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and PCR polymerases were purchased from New England Biolabs unless otherwise stated.

    Southern Blot:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: Paragraph title: Southern blot hybridization. ... Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer).

    Ligation:

    Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein
    Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and PCR polymerases were purchased from New England Biolabs unless otherwise stated.

    Infection:

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: In order to analyze an equivalent number of virions the supernatants from infected MDCK cells were adjusted to an HA titer of 26 . .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany).

    Hemagglutination Assay:

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: In order to analyze an equivalent number of virions the supernatants from infected MDCK cells were adjusted to an HA titer of 26 . .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany).

    Generated:

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany). .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany).

    Imaging:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer). .. After hybridization, the membrane was washed twice for 5 min each using 2× SSC (0.3 M NaCl, 30 mM sodium citrate) containing 1% (wt/vol) SDS at 50°C and washed again using 0.2× SSC containing 1% (wt/vol) SDS at 55°C.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream
    Article Snippet: Paragraph title: Nucleic acid extraction, PCR, and reverse transcription (RT)-PCR analyses. ... The products of the reaction were subsequently used for conventional PCR using OneTaq polymerase (New England BioLabs, Inc.) and oligonucleotides L1F + 336 and L1R + 679 producing fragments of 421 and 349 bp for the predicted precursor and processed sequences, respectively.

    Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development
    Article Snippet: Paragraph title: RT-PCR ... Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA).

    Binding Assay:

    Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair
    Article Snippet: OneTaq and Taq enzymes were obtained from New England Biolabs and KOD Hot Start DNA Polymerase was obtained from Novagen/EMD Millipore Biosciences (Billerica, MA). .. After amplification, a 5 µL aliquot was analyzed on a 2% agarose gel to confirm amplicon size (134 bp).

    Nucleic Acid Electrophoresis:

    Article Title: ATP/ADP Binding to a Novel Nucleotide Binding Domain of the Reticulocyte-binding Protein Py235 of Plasmodium yoelii
    Article Snippet: Pfu DNA polymerase and restriction enzymes were purchased from New England Biolabs. .. Ni2+ -Sepharose™ High Performance chromatography resin was obtained from GE Healthcare.

    Fluorescence:

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany). .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany).

    Methylation:

    Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation
    Article Snippet: Paragraph title: Methylation pattern of differentially methylated regions at IG loci ... Ten nanograms of bisulfite-treated DNA were PCR amplified using OneTaq DNA Polymerase (New England Biolabs).

    Mutagenesis:

    Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein
    Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and PCR polymerases were purchased from New England Biolabs unless otherwise stated.

    Isolation:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: The gDNA of isolated clones of M. florum L1 carrying the pMflT-o3 or pMflT-o4 oriC plasmid was purified using the Quick-gDNA MiniPrep kit (Zymo Research), according to the manufacturer's specifications. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer).

    Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development
    Article Snippet: The injected side was visualized by ß-galactosidase staining and in situ hybridizations were carried out, as described by Harland [ ], using chordin [ ], sox2 [ ], twist [ ], msx2, alk3, alk6 or bmpr2 as antisense probes, respectively. .. Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA). .. Primer sequences are provided in Additional file : Table S1.

    Labeling:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: DNA was fixed to the membrane by UV cross-linking (700 J) and blot prehybridized for 1 h in Church buffer (0.25 M NaHPO4 , 7% [wt/vol] SDS, 1× Denhardt's reagent, 1 mM EDTA). .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer). .. Radiolabeled DNA probe was separated from unincorporated radioactive nucleotides using Bio-Spin columns (Bio-Rad), according to the manufacturer's recommendations.

    Purification:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: The gDNA of isolated clones of M. florum L1 carrying the pMflT-o3 or pMflT-o4 oriC plasmid was purified using the Quick-gDNA MiniPrep kit (Zymo Research), according to the manufacturer's specifications. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer).

    Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation
    Article Snippet: DNA was desalted and purified using Zymo-Spin IC columns (Zymo Research). .. Ten nanograms of bisulfite-treated DNA were PCR amplified using OneTaq DNA Polymerase (New England Biolabs).

    Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair
    Article Snippet: OneTaq and Taq enzymes were obtained from New England Biolabs and KOD Hot Start DNA Polymerase was obtained from Novagen/EMD Millipore Biosciences (Billerica, MA). .. After amplification, a 5 µL aliquot was analyzed on a 2% agarose gel to confirm amplicon size (134 bp).

    Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development
    Article Snippet: For amplification, DNA extracts were purified and concentrated with PowerClean® Pro DNA Clean-Up Kit (MO BIO Laboratories, Carlsbad, CA, United States). .. The 25 μL PCR reaction volume contained 5 μL OneTaq® Standard Reaction Buffer (New England Biolabs, Ipswich, MA, United States), 5 μL dNTPs (each 1 mM; Fermentas, Thermo Fisher Scientific, Waltham, MA, United States), 1.5 μL BSA (3 g L-1 ), 0.6 μL (Archaea ) or 0.4 μL (Bacteria ) of each primer (10 μM), 0.125 μL OneTaq® Hot Start DNA Polymerase (5 U μL-1 ), 1–2.5 μL sample DNA and was filled up with dH2 O.

    Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes
    Article Snippet: Plasmid DNA was purified using the QIAprep Spin Miniprep kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Pfu DNA polymerase (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses
    Article Snippet: We used primers bis3a/F1 (5′-GTTGTTAGTAAATAGGTAGAAGGTT-3′), bis3a/F2 (5′-TTTGGATTTTGTAAAATTGATTGGT-3′), bis3a/R (5′-AAAAATCCCTTTACCTCCAAATC-3′), bis14/220/F1 (5′-TAGGTAAAAGATTAGGTTTTTTGTTG-3′), bis14/220/F2 (5′-GGGAGTTTTTAATTGTTTGTTTAGT-3′), and bis14/220/R (5′-ACTAAAAACAAACACTCAAAACAA-3′) under the following conditions: 10 cycles of heating at 95°C for 20 s and 57°C for 1 min (with a decrease of 0.5°C per cycle) followed by 72°C for 30 s, and then 30 cycles of 95°C for 20 s, 52°C for 1 min, and 72°C for 30 s. One μl of the product was repeatedly amplified with the second forward primer and the same reverse primer. .. In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with OneTaq DNA polymerase (New England BioLabs). .. We used forward bisMLV/F1 (5′-GGTTAAATAGGATATTTGTGGTAAGT-3′) and reverse bisMLV/R (5′-ATAATCCCTAAACAAAAATCTCCAAA-3′) primers under the following conditions: 95°C for 5 min and then 10 cycles of 95°C for 50 s, 58°C for 2 min, and 68°C for 1.5 min, followed by 25 cycles of 95°C for 45 s, 54°C for 2 min, and 68°C for 1.5 min, with an increase of 2 s per cycle.

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: DNA was fixed to the membrane by UV cross-linking (700 J) and blot prehybridized for 1 h in Church buffer (0.25 M NaHPO4 , 7% [wt/vol] SDS, 1× Denhardt's reagent, 1 mM EDTA). .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer). .. Radiolabeled DNA probe was separated from unincorporated radioactive nucleotides using Bio-Spin columns (Bio-Rad), according to the manufacturer's recommendations.

    Article Title: Effects of Land Use Changes from Paddy Fields on Soil Bacterial Communities in a Hilly and Mountainous Area
    Article Snippet: The pyrosequencing technique was considered to have high levels of robustness, consistency, and resolution ( ). .. The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with OneTaq DNA polymerase (New England Biolabs) from upper part (0–2 cm) soil. .. PCR products were purified by Agencourt AMPure XP with sizing buffer (7% PEG6000 and 1 M NaCl).

    Article Title: A systems-level approach to parental genomic imprinting: the imprinted gene network includes extracellular matrix genes and regulates cell cycle exit and differentiation
    Article Snippet: DNA was desalted and purified using Zymo-Spin IC columns (Zymo Research). .. Ten nanograms of bisulfite-treated DNA were PCR amplified using OneTaq DNA Polymerase (New England Biolabs). .. Amplicons were purified, cloned using Zero Blunt TOPO PCR cloning kit (Invitrogen), and sequenced.

    Article Title: Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream
    Article Snippet: For RT-PCR analyses, first-strand synthesis was carried out using Superscript III reverse transcriptase (Invitrogen, Carlsband, CA, USA) and the gene-specific reverse oligonucleotide L1R + 679. .. The products of the reaction were subsequently used for conventional PCR using OneTaq polymerase (New England BioLabs, Inc.) and oligonucleotides L1F + 336 and L1R + 679 producing fragments of 421 and 349 bp for the predicted precursor and processed sequences, respectively. .. All oligonucleotide sequences and PCR amplification procedures used in this work are available upon request.

    Article Title: Secretome Analysis from the Ectomycorrhizal Ascomycete Cenococcum geophilum
    Article Snippet: The primers were designed using Primer 3.0 (Untergasser et al., ) from a conserved flanking sequences of each gene (Supplementary Table ). .. PCR reactions were performed with OneTaq® DNA Polymerases according to the manufacturer's instructions (New England Biolabs, Mass, USA) and amplicons run on 1% agarose gels. .. Each PCR reaction was purified with QIAquick PCR Purification Kit (Qiagen, Courtaboeuf, France) and the PCR product verified by sequencing (Eurofins, Ebersberg, Germany).

    Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair
    Article Snippet: Paragraph title: PCR assay ... OneTaq and Taq enzymes were obtained from New England Biolabs and KOD Hot Start DNA Polymerase was obtained from Novagen/EMD Millipore Biosciences (Billerica, MA).

    Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development
    Article Snippet: Archaeal 16S rRNA genes were amplified with primer pair Cy5-labeled 20F ( ) and 915R ( ) and bacterial 16S rRNA genes with primer pair Cy5-labeled 8F ( ) and 907R ( ). .. The 25 μL PCR reaction volume contained 5 μL OneTaq® Standard Reaction Buffer (New England Biolabs, Ipswich, MA, United States), 5 μL dNTPs (each 1 mM; Fermentas, Thermo Fisher Scientific, Waltham, MA, United States), 1.5 μL BSA (3 g L-1 ), 0.6 μL (Archaea ) or 0.4 μL (Bacteria ) of each primer (10 μM), 0.125 μL OneTaq® Hot Start DNA Polymerase (5 U μL-1 ), 1–2.5 μL sample DNA and was filled up with dH2 O. .. The thermal cycling protocol was 95°C for 5 min, 30 cycles of 95°C for 30 s, 57°C (Archaea ) or 52°C (Bacteria ) for 30 s, 68°C for 1 min 10 s and the final extension at 68°C for 10 min on a Biometra TProfessional Thermocycler (Analytik Jena AG, Jena, D).

    Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae
    Article Snippet: An aliquot of 2 μl containing approximately 2 × 103 cells was added into a 0.2-ml PCR tube containing 30 μl of Q5 High Fidelity Master Mix (New England BioLabs) complemented with primers and nuclease-free water (Ambion). .. The amplicons were added with A-tails (OneTaq DNA polymerase, New England BioLabs), ligated to the pGEM T-Easy vector (Promega), and transformed into the NEB 5-alpha competent Escherichia coli cells (New England BioLabs).

    Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes
    Article Snippet: The DNA was extracted from gel pieces using the GenScript DNA gel extraction kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Pfu DNA polymerase (New England Biolabs). .. DNA sequencing was performed by Life Technologies (Shanghai Invitrogen, China).

    Article Title: Crossovers are associated with mutation and biased gene conversion at recombination hotspots
    Article Snippet: Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× OneTaq Reaction Buffer (NEB), 0.125 U OneTaq Hot Start DNA polymerase, 0.2 mM dNTPs, and 2.5 mM MgCl2 or 1× Phusion HF Buffer (ThermoFisher Scientific), 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase, and 0.16 mM dNTPs. .. Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× OneTaq Reaction Buffer (NEB), 0.125 U OneTaq Hot Start DNA polymerase, 0.2 mM dNTPs, and 2.5 mM MgCl2 or 1× Phusion HF Buffer (ThermoFisher Scientific), 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase, and 0.16 mM dNTPs.

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein
    Article Snippet: The inverse PCR method is similar to the deletion method described above, but alternatively the point mutation is introduced as an overhang on the forward primer. mCherry-karyopherin β2(541–890) was created by PCR of the karyopherin β2 fragment and ligation into the p-mCherry-C1 vector using the restriction sites SmaI and XhoI. mCherry-karyopherin β1(256–876) was cloned in the same way, except using the restriction sites XhoI and SacII. .. All restriction enzymes and PCR polymerases were purchased from New England Biolabs unless otherwise stated. .. Conditionally immortalized ST Hdh Q7/Q7 striatal progenitor cells (a kind gift from M. E. MacDonald) were originally derived from a wild-type (7 glutamine) knock-in transgenic HD mouse containing a humanized Exon 1 and G418 resistance cassette.

    Terminal Restriction Fragment Length Polymorphism:

    Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development
    Article Snippet: Paragraph title: Community Profiling of Incubation Samples via T-RFLP ... The 25 μL PCR reaction volume contained 5 μL OneTaq® Standard Reaction Buffer (New England Biolabs, Ipswich, MA, United States), 5 μL dNTPs (each 1 mM; Fermentas, Thermo Fisher Scientific, Waltham, MA, United States), 1.5 μL BSA (3 g L-1 ), 0.6 μL (Archaea ) or 0.4 μL (Bacteria ) of each primer (10 μM), 0.125 μL OneTaq® Hot Start DNA Polymerase (5 U μL-1 ), 1–2.5 μL sample DNA and was filled up with dH2 O.

    CRISPR:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: Paragraph title: Generation of the CRISPR line ... The 5'-homology arm was amplified (OneTaq, NEB) with a forward primer containing a NotI site and a reverse primer containing a NheI site.

    Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes
    Article Snippet: Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Pfu DNA polymerase (New England Biolabs). .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Pfu DNA polymerase (New England Biolabs).

    Nested PCR:

    Article Title: Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream
    Article Snippet: For the detection of SaPyV1 and SaPV1, PCR and nested-PCR protocols using specific primers were designed to amplify a fragment of 602 bp of large T antigen gene (Polyo602-F and Polyo602-R) and a 420-bp amplicon (Polyo420-F and Polyo420-R) within this or a fragment of 650 bp of the L1 gene (L1-3′-F and L1-3′-R) and an included 152-bp amplicon (NL1-3′-F and NL1-3′-R). .. The products of the reaction were subsequently used for conventional PCR using OneTaq polymerase (New England BioLabs, Inc.) and oligonucleotides L1F + 336 and L1R + 679 producing fragments of 421 and 349 bp for the predicted precursor and processed sequences, respectively.

    Plasmid Preparation:

    Article Title: Role of DNA Methylation in Expression and Transmission of Porcine Endogenous Retroviruses
    Article Snippet: We used primers bis3a/F1 (5′-GTTGTTAGTAAATAGGTAGAAGGTT-3′), bis3a/F2 (5′-TTTGGATTTTGTAAAATTGATTGGT-3′), bis3a/R (5′-AAAAATCCCTTTACCTCCAAATC-3′), bis14/220/F1 (5′-TAGGTAAAAGATTAGGTTTTTTGTTG-3′), bis14/220/F2 (5′-GGGAGTTTTTAATTGTTTGTTTAGT-3′), and bis14/220/R (5′-ACTAAAAACAAACACTCAAAACAA-3′) under the following conditions: 10 cycles of heating at 95°C for 20 s and 57°C for 1 min (with a decrease of 0.5°C per cycle) followed by 72°C for 30 s, and then 30 cycles of 95°C for 20 s, 52°C for 1 min, and 72°C for 30 s. One μl of the product was repeatedly amplified with the second forward primer and the same reverse primer. .. In order to amplify the 5′LTR of pLG vector ( ) based on murine leukemia virus (MLV), we performed seminested PCR with OneTaq DNA polymerase (New England BioLabs). .. We used forward bisMLV/F1 (5′-GGTTAAATAGGATATTTGTGGTAAGT-3′) and reverse bisMLV/R (5′-ATAATCCCTAAACAAAAATCTCCAAA-3′) primers under the following conditions: 95°C for 5 min and then 10 cycles of 95°C for 50 s, 58°C for 2 min, and 68°C for 1.5 min, followed by 25 cycles of 95°C for 45 s, 54°C for 2 min, and 68°C for 1.5 min, with an increase of 2 s per cycle.

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: The gDNA of isolated clones of M. florum L1 carrying the pMflT-o3 or pMflT-o4 oriC plasmid was purified using the Quick-gDNA MiniPrep kit (Zymo Research), according to the manufacturer's specifications. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer).

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: To generate the pGX-2attp_WN_Scr_A-B replacement donor [ ], 5.299kb 5'-homology arm and 5.127kb 3'-homology arm were amplified and initially cloned in the pCR4-TOPO Vector (Invitrogen) and pCRII Vector (Invitrogen) respectively. .. The 5'-homology arm was amplified (OneTaq, NEB) with a forward primer containing a NotI site and a reverse primer containing a NheI site.

    Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae
    Article Snippet: For full-length 16S or 18S rRNA gene amplification, we used 27f/1492r [ ] or 63f/1818r [ ] primers with annealing temperature of 59°C. .. The amplicons were added with A-tails (OneTaq DNA polymerase, New England BioLabs), ligated to the pGEM T-Easy vector (Promega), and transformed into the NEB 5-alpha competent Escherichia coli cells (New England BioLabs). .. Plasmids from the positive colonies were sequenced with T7 and SP6 primers to cover the full amplicon length.

    Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes
    Article Snippet: Plasmid DNA was purified using the QIAprep Spin Miniprep kit. .. Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Pfu DNA polymerase (New England Biolabs).

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    Article Title: Expression, crystallization and preliminary X-ray analysis of the phosphoribosylglycinamide formyltransferase from Streptococcus mutans
    Article Snippet: Enzymes for recombinant DNA technology such as Pfu polymerase, T4p DNA ligase, Bam HI and Xho I were purchased from New England Biolabs. .. PCR amplification kits (including PCR buffer and dNTP Mix) were also obtained from New England Biolabs.

    Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein
    Article Snippet: Paragraph title: Plasmid Constructs ... All restriction enzymes and PCR polymerases were purchased from New England Biolabs unless otherwise stated.

    Software:

    Article Title: “Pomacytosis”—Semi-extracellular phagocytosis of cyanobacteria by the smallest marine algae
    Article Snippet: The amplicons were added with A-tails (OneTaq DNA polymerase, New England BioLabs), ligated to the pGEM T-Easy vector (Promega), and transformed into the NEB 5-alpha competent Escherichia coli cells (New England BioLabs). .. Plasmids from the positive colonies were sequenced with T7 and SP6 primers to cover the full amplicon length.

    SYBR Green Assay:

    Article Title: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development
    Article Snippet: Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA). .. Total RNA was extracted from Xenopus embryos of the indicated developmental stages (High Pure RNA Isolation Kit, Roche, Germany), reverse transcribed using MMLV reverse transcriptase (New England Biolabs, USA) and the indicated transcripts were amplified from the resulting cDNA using OneTaq Polymerase (New England Biolabs, USA).

    Article Title: Crossovers are associated with mutation and biased gene conversion at recombination hotspots
    Article Snippet: PCRs for genotyping were carried out in a volume of 10 µL, using OneTaq DNA Polymerase (NEB) or Phusion Hot Start II High-Fidelity DNA Polymerase (ThermoFisher Scientific). .. Reactions contained 5 µL total genomic DNA (blood or sperm) (2 ng/µL), 0.2 µM allele-specific primer, 0.2 µM outer primer, 1× SYBR Green I (Invitrogen), and either 1× OneTaq Reaction Buffer (NEB), 0.125 U OneTaq Hot Start DNA polymerase, 0.2 mM dNTPs, and 2.5 mM MgCl2 or 1× Phusion HF Buffer (ThermoFisher Scientific), 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase, and 0.16 mM dNTPs. .. The reactions were carried out with an initial heating step of 95 °C for 2 min, followed by 45 cycles at 95 °C for 30 s, annealing temperature for 30 s, and 68 °C for 15 s when using OneTaq Hot Start DNA polymerase or with 98 °C for 30 s, followed by 45 cycles at 98 °C for 5 s, annealing temperature for 15 s, and 72 °C for 5 s when using Phusion Hot Start II High-Fidelity DNA Polymerase.

    Denaturing Gradient Gel Electrophoresis:

    Article Title: Effects of Land Use Changes from Paddy Fields on Soil Bacterial Communities in a Hilly and Mountainous Area
    Article Snippet: The DGGE profiles of amplified 16S rRNA genes from the soils of natural slopes, including PF3, B1–3, G1, and CF1–2, were similar to each other ( ). .. The hypervariable V4–V5 regions of the 16S rRNA gene were PCR-amplified using the primer pairs, F563-LXA and BSR926-LB , with OneTaq DNA polymerase (New England Biolabs) from upper part (0–2 cm) soil.

    Agarose Gel Electrophoresis:

    Article Title: Development of oriC-Based Plasmids for Mesoplasma florum
    Article Snippet: After digestion, restriction fragments were separated on a 0.8% agarose gel, and DNA was depurinated and denatured by soaking the gel for 15 min in 0.25 M HCl and 0.4 M NaOH, respectively. .. Labeled probe for tetM was synthesized by PCR from the pMflT-o4 DNA template using OneTaq DNA polymerase (New England BioLabs), the pBOT2-F/ tetM -probe-R primer pair (Table S1), and 0.008 μM EasyTide-dCTP, [α-32 P]-3000 Ci/mmol 10 mCi/ml (PerkinElmer).

    Article Title: Expanding the Scope of Replicable Unnatural DNA: Stepwise Optimization of a Predominantly Hydrophobic Base Pair
    Article Snippet: OneTaq and Taq enzymes were obtained from New England Biolabs and KOD Hot Start DNA Polymerase was obtained from Novagen/EMD Millipore Biosciences (Billerica, MA). .. PCR amplifications were performed in a total volume of 25 µL and with conditions specific for each assay as described in .

    Article Title: Microbial Community Dynamics in Soil Depth Profiles Over 120,000 Years of Ecosystem Development
    Article Snippet: The 25 μL PCR reaction volume contained 5 μL OneTaq® Standard Reaction Buffer (New England Biolabs, Ipswich, MA, United States), 5 μL dNTPs (each 1 mM; Fermentas, Thermo Fisher Scientific, Waltham, MA, United States), 1.5 μL BSA (3 g L-1 ), 0.6 μL (Archaea ) or 0.4 μL (Bacteria ) of each primer (10 μM), 0.125 μL OneTaq® Hot Start DNA Polymerase (5 U μL-1 ), 1–2.5 μL sample DNA and was filled up with dH2 O. .. The thermal cycling protocol was 95°C for 5 min, 30 cycles of 95°C for 30 s, 57°C (Archaea ) or 52°C (Bacteria ) for 30 s, 68°C for 1 min 10 s and the final extension at 68°C for 10 min on a Biometra TProfessional Thermocycler (Analytik Jena AG, Jena, D).

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    In Vitro:

    Article Title: Two Cytoplasmic Acylation Sites and an Adjacent Hydrophobic Residue, but No Other Conserved Amino Acids in the Cytoplasmic Tail of HA from Influenza A Virus Are Crucial for Virus Replication
    Article Snippet: Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany). .. Real-time RT-PCR was performed utilizing a TaqMan probe, OneTaq DNA polymerase (NEB) and the ICYCLER-IQ5 Multicolor Real Time PCR Detection System (BIO-RAD, München, Germany).

    Electrophoresis:

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    Concentration Assay:

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    Construct:

    Article Title: Horizontal Gene Transfer of Functional Type VI Killing Genes by Natural Transformation
    Article Snippet: In-frame deletions and promoter-replacement mutants in V. cholerae were constructed by previously described allelic exchange methods ( ). .. DNA-modifying enzymes and restriction nucleases (Promega and New England Biolabs); Gibson assembly mix (New England Biolabs); and Q5, Phusion, and OneTaq DNA polymerases (New England Biolabs) were used according to the manufacturer’s instructions.

    Article Title: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes
    Article Snippet: Amplification was carried out using a PCR apparatus from Bio-Rad (Hercules, CA, USA) with a final volume of 50 µL containing 5 µL of 10× PCR reaction buffer, 10 mM of each dNTP, 30–60 ng DNA template, 10 pmol each of the appropriate primers, and 0.5 U each of Taq polymerase and Pfu DNA polymerase (New England Biolabs). .. The linear upstream-homologous arm (nuoB ) fragment and downstream-homologous arm (nuoE ) fragment were amplified from the IAM1183 genome using the primers F-CDuh and R-CDuh as well as F-CDdh and R-CDdh.

    Article Title: Identification of a Karyopherin ?1/?2 Proline-Tyrosine Nuclear Localization Signal in Huntingtin Protein
    Article Snippet: Paragraph title: Plasmid Constructs ... All restriction enzymes and PCR polymerases were purchased from New England Biolabs unless otherwise stated.

    DNA Purification:

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    Lysis:

    Article Title: Self-Cloning CRISPR
    Article Snippet: Homologous recombination (HR) replacement of short regions such as SNP repair is possible using this protocol and facilitates knock-in in 20–50% of cells. .. - sgRNA oligos - Proofreading PCR polymerase (NEBNext) - Agarose - Gel electrophoresis unit - Minelute DNA purification kit (or standard DNA purification followed by vacuum concentration) - sgPal7-HygR plasmid maxiprep DNA (Addgene #71484) - CBH-Cas9-BlastR plasmid maxiprep DNA (Addgene (#71489) - Knock-in template - Sterile eppendorff 1.5ml microcentrifuge tubes - Cell electroporator and cuvettes - Cells and appropriate cell culture media and reagents - Y-27632 ROCK-inhibitor - Hygromycin - Blasticidin - Purelink Genomic DNA Mini Kit - gDNA Lysis Buffer (10 mM TrisHCl (pH7.5 or pH 8.0), 10 mM EDTA, 10 mM NaCl, 0.5% SDS) with 1mg/ml Proteinase K added fresh .. Use UCSC genome browser ( ) to identify the genomic sequence surrounding the gene of interest.

    Recombinant:

    Article Title: Horizontal Gene Transfer of Functional Type VI Killing Genes by Natural Transformation
    Article Snippet: Paragraph title: Recombinant DNA techniques and construction of V. cholerae mutants. ... DNA-modifying enzymes and restriction nucleases (Promega and New England Biolabs); Gibson assembly mix (New England Biolabs); and Q5, Phusion, and OneTaq DNA polymerases (New England Biolabs) were used according to the manufacturer’s instructions.

    Article Title: Expression, crystallization and preliminary X-ray analysis of the phosphoribosylglycinamide formyltransferase from Streptococcus mutans
    Article Snippet: In this study, we report the expression, crystallization and pre­liminary crystallographic analysis of phosphoribosylglycinamide formyltransferase from S. mutans . .. Enzymes for recombinant DNA technology such as Pfu polymerase, T4p DNA ligase, Bam HI and Xho I were purchased from New England Biolabs. .. PCR amplification kits (including PCR buffer and dNTP Mix) were also obtained from New England Biolabs.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs onetaq hot start master mix
    Onetaq Hot Start Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq hot start master mix/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    onetaq hot start master mix - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs onetaq polymerase
    Onetaq Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq polymerase/product/New England Biolabs
    Average 99 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    onetaq polymerase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    98
    New England Biolabs onetaq hot start
    Onetaq Hot Start, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq hot start/product/New England Biolabs
    Average 98 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    onetaq hot start - by Bioz Stars, 2019-12
    98/100 stars
      Buy from Supplier

    Image Search Results