onetaq  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs onetaq
    Onetaq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    onetaq - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    DNA Extraction:

    Article Title: Ubiquity and Diversity of Human-Associated Demodex Mites
    Article Snippet: Paragraph title: (b) DNA Extraction and PCR ... We used either OneTaq (NEB) or TaKaRa Ex Taq (Clontech), which possess proofreading functions, for all PCR reactions to reduce polymerase induced sequence errors.

    Article Title: The jellyfish Cassiopea exhibits a sleep-like state
    Article Snippet: Jellyfish fragments, about 2 mm of tissue from the tentacles, were placed in 400 μL DNA extraction buffer (50% w/v guanidinium isothiocyanate; 50 mM Tris pH 7.6; 10 μM EDTA; 4.2% w/v sarkosyl; 2.1% v/v β-mercaptoethanol). .. COI primers: LCO1490 forward primer: 5′-ggtcaacaaatcataaagatattgg-3′ HC02198 reverse primer: 5′-taaacttcagggtgaccaaaaaatca-3′ Amplifications were performed under the following PCR conditions: 2 min at 92°C, 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 45 s, with a final 72°C extension for 7 min. Amplification products were then TOPO-cloned using OneTaq (NEB) and sequenced.

    Clone Assay:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: Generation of the CRISPR line To generate the pGX-2attp_WN_Scr_A-B replacement donor [ ], 5.299kb 5'-homology arm and 5.127kb 3'-homology arm were amplified and initially cloned in the pCR4-TOPO Vector (Invitrogen) and pCRII Vector (Invitrogen) respectively. .. The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site.

    Centrifugation:

    Article Title: The jellyfish Cassiopea exhibits a sleep-like state
    Article Snippet: The DNA was precipitated by centrifugation at 16,000 g for 15 min and the DNA pellet washed in 70% ethanol and resuspended and stored in water. .. COI primers: LCO1490 forward primer: 5′-ggtcaacaaatcataaagatattgg-3′ HC02198 reverse primer: 5′-taaacttcagggtgaccaaaaaatca-3′ Amplifications were performed under the following PCR conditions: 2 min at 92°C, 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 45 s, with a final 72°C extension for 7 min. Amplification products were then TOPO-cloned using OneTaq (NEB) and sequenced.

    Amplification:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: .. The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site. .. The 3'-homology arm was ligated into AscI and StuI sites of pGX-2attp_WN vector [ ].

    Article Title: Compounds that select against the tetracycline resistance efflux pump
    Article Snippet: .. Detection of tetA , tetR, and marR by PCR The tetA , tetR, and marR genes were amplified with the primers ( ) in 25 μL reactions using 0.2 μL OneTaq (New England Biolabs) according to the supplier’s protocol. ..

    Article Title: Loss of WSTF results in spontaneous fluctuations of heterochromatin formation and resolution, combined with substantial changes to gene expression
    Article Snippet: Standard RT-PCR Analysis Standard RT-PCR was performed using OneTaq (NEB, Ipswich, MA, USA). .. The cDNA samples were denatured at 94°C for 30 seconds, amplified through 40 cycles of 30 seconds at 94°C, 30 seconds at 58°C, and 30 seconds at 68°C, and finally held at 15°C.

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: .. The 5'-homology arm was amplified (OneTaq, NEB) with a forward primer containing a NotI site and a reverse primer containing a NheI site. .. The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site.

    Article Title: The jellyfish Cassiopea exhibits a sleep-like state
    Article Snippet: .. COI primers: LCO1490 forward primer: 5′-ggtcaacaaatcataaagatattgg-3′ HC02198 reverse primer: 5′-taaacttcagggtgaccaaaaaatca-3′ Amplifications were performed under the following PCR conditions: 2 min at 92°C, 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 45 s, with a final 72°C extension for 7 min. Amplification products were then TOPO-cloned using OneTaq (NEB) and sequenced. .. Multiple sequence alignment of Cassiopea spp.

    Agarose Gel Electrophoresis:

    Article Title: Compounds that select against the tetracycline resistance efflux pump
    Article Snippet: Detection of tetA , tetR, and marR by PCR The tetA , tetR, and marR genes were amplified with the primers ( ) in 25 μL reactions using 0.2 μL OneTaq (New England Biolabs) according to the supplier’s protocol. .. PCR product size was determined by gel electrophoresis on a 1% agarose gel ( ).

    Nucleic Acid Electrophoresis:

    Article Title: Compounds that select against the tetracycline resistance efflux pump
    Article Snippet: Detection of tetA , tetR, and marR by PCR The tetA , tetR, and marR genes were amplified with the primers ( ) in 25 μL reactions using 0.2 μL OneTaq (New England Biolabs) according to the supplier’s protocol. .. PCR product size was determined by gel electrophoresis on a 1% agarose gel ( ).

    Sequencing:

    Article Title: A growth‐ and bioluminescence‐based bioreporter for the in vivo detection of novel biocatalysts
    Article Snippet: PCRs were performed with OneTaq (NEB) and primers are presented in Table S4. .. The araC ‐kan CDS exchange was analysed by sequencing at GATC Biotech.

    Article Title: Ubiquity and Diversity of Human-Associated Demodex Mites
    Article Snippet: .. We used either OneTaq (NEB) or TaKaRa Ex Taq (Clontech), which possess proofreading functions, for all PCR reactions to reduce polymerase induced sequence errors. ..

    Article Title: Cell type-dependent axonal localization of translational regulators and mRNA in mouse peripheral olfactory neurons
    Article Snippet: PCR from each cDNA sample was performed as indicated in Results using OneTaq (New England Biolab) for 30 cycles as per the manufacturer directions. .. Primers, designed to specifically target the Omp sequence using NCBI Primer-BLAST, were as follows: OMP 6 forward, ATTCCCTGACGCTGGTGGTAG; OMP 608 reverse, AAGGAGATCCAGGCAAGGGA; OMP 506 forward, TGGAGCCTGCCAACCTAAAG; OMP 2119 reverse, AGGGCACACAGTCTTTATTGTGA.

    Article Title: The jellyfish Cassiopea exhibits a sleep-like state
    Article Snippet: To assess the diversity of Cassiopea spp. within our population we genotyped several animals by amplification and sequencing of the Mitochondrial cytochrome c oxidase I (COI). .. COI primers: LCO1490 forward primer: 5′-ggtcaacaaatcataaagatattgg-3′ HC02198 reverse primer: 5′-taaacttcagggtgaccaaaaaatca-3′ Amplifications were performed under the following PCR conditions: 2 min at 92°C, 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 45 s, with a final 72°C extension for 7 min. Amplification products were then TOPO-cloned using OneTaq (NEB) and sequenced.

    Generated:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site. .. Transgenic flies were generated by The Best Gene, Inc., using y[ ] M{vasCas9.RFP}ZH-2A w[1118] strain (BDSC#55821) as a donor for germline transformation and identified using the w[+] marker present in the donor construct.

    Article Title: The jellyfish Cassiopea exhibits a sleep-like state
    Article Snippet: COI primers: LCO1490 forward primer: 5′-ggtcaacaaatcataaagatattgg-3′ HC02198 reverse primer: 5′-taaacttcagggtgaccaaaaaatca-3′ Amplifications were performed under the following PCR conditions: 2 min at 92°C, 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 45 s, with a final 72°C extension for 7 min. Amplification products were then TOPO-cloned using OneTaq (NEB) and sequenced. .. COI sequences were generated using Clustal Omega software.

    Construct:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site. .. Transgenic flies were generated by The Best Gene, Inc., using y[ ] M{vasCas9.RFP}ZH-2A w[1118] strain (BDSC#55821) as a donor for germline transformation and identified using the w[+] marker present in the donor construct.

    Mouse Assay:

    Article Title: Cell type-dependent axonal localization of translational regulators and mRNA in mouse peripheral olfactory neurons
    Article Snippet: Tissue was dissected from 75-day-old mice, and RNA was prepared using Trizol (Thermo Fisher). .. PCR from each cDNA sample was performed as indicated in Results using OneTaq (New England Biolab) for 30 cycles as per the manufacturer directions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Loss of WSTF results in spontaneous fluctuations of heterochromatin formation and resolution, combined with substantial changes to gene expression
    Article Snippet: .. Standard RT-PCR Analysis Standard RT-PCR was performed using OneTaq (NEB, Ipswich, MA, USA). .. The cDNA samples were denatured at 94°C for 30 seconds, amplified through 40 cycles of 30 seconds at 94°C, 30 seconds at 58°C, and 30 seconds at 68°C, and finally held at 15°C.

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: .. RT-PCR was performed on P. syringae pv. tomato DC3000 genomic DNA, cDNA, and an RNA control without reverse transcriptase on a Bio-Rad T100 thermocycler using OneTaq (NEB). .. PCR products were then run on an agar gel and visualized using a ChemiDoc transilluminator (Bio-Rad).

    Marker:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site. .. Transgenic flies were generated by The Best Gene, Inc., using y[ ] M{vasCas9.RFP}ZH-2A w[1118] strain (BDSC#55821) as a donor for germline transformation and identified using the w[+] marker present in the donor construct.

    Incubation:

    Article Title: Ubiquity and Diversity of Human-Associated Demodex Mites
    Article Snippet: The samples were incubated overnight at 56°C with 180 µl of ATL buffer and 20 µl proteinase K. The final elution step was performed with 150 µl of elution buffer warmed to 56°C. .. We used either OneTaq (NEB) or TaKaRa Ex Taq (Clontech), which possess proofreading functions, for all PCR reactions to reduce polymerase induced sequence errors.

    Activity Assay:

    Article Title: A growth‐ and bioluminescence‐based bioreporter for the in vivo detection of novel biocatalysts
    Article Snippet: Paragraph title: Enrichment for cells with l ‐arabinose isomerase activity ... PCRs were performed with OneTaq (NEB) and primers are presented in Table S4.

    CRISPR:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: Paragraph title: Generation of the CRISPR line ... The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site.

    Polymerase Chain Reaction:

    Article Title: Ubiquity and Diversity of Human-Associated Demodex Mites
    Article Snippet: .. We used either OneTaq (NEB) or TaKaRa Ex Taq (Clontech), which possess proofreading functions, for all PCR reactions to reduce polymerase induced sequence errors. ..

    Article Title: Compounds that select against the tetracycline resistance efflux pump
    Article Snippet: .. Detection of tetA , tetR, and marR by PCR The tetA , tetR, and marR genes were amplified with the primers ( ) in 25 μL reactions using 0.2 μL OneTaq (New England Biolabs) according to the supplier’s protocol. ..

    Article Title: Cell type-dependent axonal localization of translational regulators and mRNA in mouse peripheral olfactory neurons
    Article Snippet: .. PCR from each cDNA sample was performed as indicated in Results using OneTaq (New England Biolab) for 30 cycles as per the manufacturer directions. .. Primers, designed to specifically target the Omp sequence using NCBI Primer-BLAST, were as follows: OMP 6 forward, ATTCCCTGACGCTGGTGGTAG; OMP 608 reverse, AAGGAGATCCAGGCAAGGGA; OMP 506 forward, TGGAGCCTGCCAACCTAAAG; OMP 2119 reverse, AGGGCACACAGTCTTTATTGTGA.

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: RT-PCR was performed on P. syringae pv. tomato DC3000 genomic DNA, cDNA, and an RNA control without reverse transcriptase on a Bio-Rad T100 thermocycler using OneTaq (NEB). .. PCR products were then run on an agar gel and visualized using a ChemiDoc transilluminator (Bio-Rad).

    Article Title: The jellyfish Cassiopea exhibits a sleep-like state
    Article Snippet: .. COI primers: LCO1490 forward primer: 5′-ggtcaacaaatcataaagatattgg-3′ HC02198 reverse primer: 5′-taaacttcagggtgaccaaaaaatca-3′ Amplifications were performed under the following PCR conditions: 2 min at 92°C, 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 45 s, with a final 72°C extension for 7 min. Amplification products were then TOPO-cloned using OneTaq (NEB) and sequenced. .. Multiple sequence alignment of Cassiopea spp.

    Transgenic Assay:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site. .. Transgenic flies were generated by The Best Gene, Inc., using y[ ] M{vasCas9.RFP}ZH-2A w[1118] strain (BDSC#55821) as a donor for germline transformation and identified using the w[+] marker present in the donor construct.

    Transformation Assay:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site. .. Transgenic flies were generated by The Best Gene, Inc., using y[ ] M{vasCas9.RFP}ZH-2A w[1118] strain (BDSC#55821) as a donor for germline transformation and identified using the w[+] marker present in the donor construct.

    Plasmid Preparation:

    Article Title: A Distalless-responsive enhancer of the Hox gene Sex combs reduced is required for segment- and sex-specific sensory organ development in Drosophila
    Article Snippet: Generation of the CRISPR line To generate the pGX-2attp_WN_Scr_A-B replacement donor [ ], 5.299kb 5'-homology arm and 5.127kb 3'-homology arm were amplified and initially cloned in the pCR4-TOPO Vector (Invitrogen) and pCRII Vector (Invitrogen) respectively. .. The 3'-homology arm was amplified (OneTaq, NEB) with a forward primer containing an AscI site and a reverse primer containing a StuI site.

    Software:

    Article Title: The jellyfish Cassiopea exhibits a sleep-like state
    Article Snippet: COI primers: LCO1490 forward primer: 5′-ggtcaacaaatcataaagatattgg-3′ HC02198 reverse primer: 5′-taaacttcagggtgaccaaaaaatca-3′ Amplifications were performed under the following PCR conditions: 2 min at 92°C, 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 45 s, with a final 72°C extension for 7 min. Amplification products were then TOPO-cloned using OneTaq (NEB) and sequenced. .. COI sequences were generated using Clustal Omega software.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs onetaq hot start 2x master mix
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); <t>OneTaq</t> = OneTaq Hot Start <t>2X</t> Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Onetaq Hot Start 2x Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq hot start 2x master mix/product/New England Biolabs
    Average 94 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    onetaq hot start 2x master mix - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    78
    New England Biolabs 1x onetaq standard reaction buffer
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); <t>OneTaq</t> = OneTaq Hot Start <t>2X</t> Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    1x Onetaq Standard Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x onetaq standard reaction buffer/product/New England Biolabs
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1x onetaq standard reaction buffer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    99
    New England Biolabs onetaq
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); <t>OneTaq</t> = OneTaq Hot Start <t>2X</t> Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Onetaq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    onetaq - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Journal: Scientific Reports

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay

    doi: 10.1038/s41598-019-40035-5

    Figure Lengend Snippet: Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Article Snippet: Several master mixes were tested in the optimization experiments, namely AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA), AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA), OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA), Platinum Hot Start PCR Master Mix (Invitrogen, California, USA), and HotStarTaq DNA Polymerase (Qiagen, Germany).

    Techniques: Polymerase Chain Reaction, Hot Start PCR