psnapf  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    pSNAPf Vector
    Description:
    pSNAPf Vector 20 ug
    Catalog Number:
    n9183s
    Price:
    162
    Size:
    20 ug
    Category:
    Vectors Plasmids
    Buy from Supplier


    Structured Review

    New England Biolabs psnapf
    pSNAPf Vector
    pSNAPf Vector 20 ug
    https://www.bioz.com/result/psnapf/product/New England Biolabs
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    psnapf - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: Also, a CHIKV replicon containing the mCherry gene fused to nsP3, referred to as CHIKVrepl mCherry-P3 was used as the starting material for cloning of a SNAP-tagged replicon. .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′).

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech). .. Plasmids for human LRRK2 have been reported elsewhere [ , ] and were further sub-cloned into a pEF vector.

    Article Title: Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres
    Article Snippet: Plasmid construction All cDNAs were cloned using pBlueScript (Stratagene, CA). .. The SNAPf coding region of the hnRNPA1-SNAPf expression vector was prepared with PCR using the pSNAPf-vector (NEB, NA) as the PCR template and primers to add a flexible GGSGGS linker on the N-terminus.

    Article Title: Retargeting of macroH2A following mitosis to cytogenetic-scale heterochromatic domains
    Article Snippet: To generate the plasmids expressing SNAP-H3 and SNAP-macroH2A, the pSNAPf vector produced from New England Biolabs was used. .. After creating the pSNAPf -Zeocin vector, the cDNA of H3.1 isolated from a human cDNA library or the cDNA for macroH2A1.2 from pCS2+ macroH2A1.2-GFP-HA (30515; Addgene) was cloned into the pSNAPf -Zeocin vector.

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). .. The U2OS cells stably expressing SNAP-H2A were generated through G418 selection and clonal isolation. pDEST_Tet_CMV_FLAG-OTUD5 was a gift from Wade Harper (Addgene plasmid # 22610) ( ) and was used for generating HeLa cells stably expressing FLAG-OTUD5. pDEST10-6xHis-UBR5 plasmid was a gift from Sally Kornbluth ( ) and was used for recombinant protein production from SF9 cells.

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: Paragraph title: Rudhira in silico analysis, deletion mutant cloning, plasmid constructs, and transfection ... Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B).

    Article Title: Heparan sulfate antagonism alters bone morphogenetic protein signaling and receptor dynamics, suggesting a mechanism in hereditary multiple exostoses
    Article Snippet: BMPRIa and BMPRII cDNA clones and the pSNAPf vector were purchased from Origene and New England Biolabs, respectively. .. To insert the signal peptide of the receptors into the pSnapf vector, we first digested the vector with NheI and EcoRI and then inserted the signal peptide via ligation using the Quick Ligation Kit according to the manufacturer's protocol (New England Biolabs).

    Amplification:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech). .. Plasmids for human LRRK2 have been reported elsewhere [ , ] and were further sub-cloned into a pEF vector.

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: A linker encoding the signal sequence of EGFR was inserted into 5′ MCS of pSNAPf vector (New England Biolabs) using the unique NheI and EcoRI sites. .. Subsequently, the coding sequence of mature EGFR (GeneCopoeia) was amplified by PCR and subcloned into the plasmid pSNAPf using the unique SbfI and NotI sites creating pSNAPf -EGFR.

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: .. To obtain SNAP-AMPAR (SNAP-GluA2flop (R)), cDNA encoding SNAP-tag was amplified from pSNAPf vector (NEB). .. After DNA sequence analyses, the SNAP-tag cDNA was inserted between HA-tag and GluA2flop (R) in the pCAGGS expression vector.

    Article Title: Correlative Light- and Electron Microscopy with chemical tags
    Article Snippet: .. The coding sequence of SNAPf was amplified by PCR (sense primer: 5′-GCGGCGCGCCATGGACAAAGACTGCGAAATGAAGCG-3′, antisense primer: 5′-GCGGCGCGCCCACCCAGCCCAGGCTTGCCCAG-3′) using the pSNAPf -vector (New England BioLabs) as a template and introducing Asc I sites at both ends. .. The amplified region was inserted via Asc I into the coding region of the extracellular domain of N-cadherin at a site (aa position 151 of the mature protein) previously reported to tolerate insertion of GFP ( ).

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B). .. For deletion mutant cloning, the regions to be cloned were PCR amplified from pCMV-RudhFL-FLAG vector and cloned in pCMV-Tag2B vector (Stratagene) ( and ′).

    Stable Transfection:

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: U2OS cells stably expressing mCherry-LacI-Fok1 fusion protein that induces DSBs at a single genomic locus is previously described ( ). .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    Synthesized:

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech). .. To clone full-length HERC2, total RNA was extracted from HEK293T cells, and cDNA was synthesized using a PrimeScript 1st strand cDNA synthesis kit (Takara Bio).

    Article Title: The Interaction of Natural Selection and GC Skew May Drive the Fast Evolution of a Sand Rat Homeobox Gene
    Article Snippet: Plasmid Construction and In Vitro Mutagenesis Full coding sequences for mouse and sand rat Pdx1 genes were synthesized by GenScript, with alterations in sand rat codon usage to lower GC content ( online). .. Mouse Pdx1 was inserted into pSNAPf vector (New England BioLabs) using Bam HI and Xho I restriction sites, and sand rat Pdx1 inserted using Not I and Xho I restriction sites.

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: OTUD5 knockout HeLa clones were generated using the CRISPR-Cas9 plasmid and Double Nickase (Cas9 D10A mutant) plasmid synthesized from Santa Cruz Biotechnology. .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    Construct:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: In this construct, the mCherry gene (Clontech), is between two unique SpeI restriction sites, which were previously introduced into the CHIKV genome. .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′).

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: Paragraph title: 2.1 Expression Constructs ... A linker encoding the signal sequence of EGFR was inserted into 5′ MCS of pSNAPf vector (New England Biolabs) using the unique NheI and EcoRI sites.

    Article Title: Structure of a human intramembrane ceramidase explains enzymatic dysfunction found in leukodystrophy
    Article Snippet: For the ADIPOR2-YFP construct, full-length AdipoR2 was inserted in frame of the N terminus of the YFP in pcDNA 3.1-YFP by PCR using the following specific oligonucleotides: forward 5′ TAAGCAGCTAGCATGAACGAGCCAACAGAAAACC 3′ and reverse 5′ TAAGCAAAGCTTCAGTGCATCCTCTTCAC 3′. .. Full-length ACER3 was inserted in frame of the N terminus of the SNAP tag in the pSNAPf vector (New England Biolabs) by PCR using the following specific oligonucleotides: 5′ AAACGCTAGCGATATCATGGACTACAAGGACGACGACGACAAGGCTCCTGCAGCTGACAG 3′ as forward and 5′ TATGCAACCGGTGTGCTTCCTCAAGGGCT 3′ as reverse.

    Article Title: Lipids Regulate Lck Protein Activity through Their Interactions with the Lck Src Homology 2 Domain
    Article Snippet: Paragraph title: DNA Constructs ... cDNAs of full-length human Lck and TCR-ζ (CD247) were subcloned to the pSNAPf vector (New England Biolabs) using KpnI/XhoI and EcoRI/EcoRV sites, respectively.

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: Paragraph title: Rudhira in silico analysis, deletion mutant cloning, plasmid constructs, and transfection ... Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B).

    Article Title: Heparan sulfate antagonism alters bone morphogenetic protein signaling and receptor dynamics, suggesting a mechanism in hereditary multiple exostoses
    Article Snippet: To insert the signal peptide of the receptors into the pSnapf vector, we first digested the vector with NheI and EcoRI and then inserted the signal peptide via ligation using the Quick Ligation Kit according to the manufacturer's protocol (New England Biolabs). .. The newly constructed plasmids, RIA signal peptide-SNAP and RII signal peptide-SNAP, were cut with BamHI and NotI.

    Activity Assay:

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: Reporter plasmid for Notch signaling activity using a Hes1 promoter (pHes1-luc) was generated in Kageyama’s lab. pCMV-Tag4-mouse Notch1-FLAG was a kind gift from Drs. K. Katsube and K. Sakamoto and subcloned into a pcDNA5/FRT vector. pMXs-rat Dll1-IG was a kind gift from Dr. Y. Goto, and the insert was sub-cloned into a pcDNA5/FRT vector. .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech).

    In Silico:

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: Paragraph title: Rudhira in silico analysis, deletion mutant cloning, plasmid constructs, and transfection ... Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B).

    Expressing:

    Article Title: Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres
    Article Snippet: .. The SNAPf coding region of the hnRNPA1-SNAPf expression vector was prepared with PCR using the pSNAPf-vector (NEB, NA) as the PCR template and primers to add a flexible GGSGGS linker on the N-terminus. .. The hnRNPA1 cDNA was obtained from Addgene (pET9d-hnRNPA1). hnRNPA1 was fused to the N-terminus of SNAPf.

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: Paragraph title: 2.1 Expression Constructs ... A linker encoding the signal sequence of EGFR was inserted into 5′ MCS of pSNAPf vector (New England Biolabs) using the unique NheI and EcoRI sites.

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: Paragraph title: Construction of expression plasmids ... To obtain SNAP-AMPAR (SNAP-GluA2flop (R)), cDNA encoding SNAP-tag was amplified from pSNAPf vector (NEB).

    Article Title: Retargeting of macroH2A following mitosis to cytogenetic-scale heterochromatic domains
    Article Snippet: .. To generate the plasmids expressing SNAP-H3 and SNAP-macroH2A, the pSNAPf vector produced from New England Biolabs was used. .. Due to the drug incompatibility in HEK 293T cells, we replaced the existing Neomycin selection gene with Zeocin.

    Article Title: The Interaction of Natural Selection and GC Skew May Drive the Fast Evolution of a Sand Rat Homeobox Gene
    Article Snippet: Mouse Pdx1 was inserted into pSNAPf vector (New England BioLabs) using Bam HI and Xho I restriction sites, and sand rat Pdx1 inserted using Not I and Xho I restriction sites. .. Stop codons were removed to allow expression of Pdx1-SNAP fusion protein.

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: U2OS cells stably expressing mCherry-LacI-Fok1 fusion protein that induces DSBs at a single genomic locus is previously described ( ). .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    Modification:

    Article Title: Structure of a human intramembrane ceramidase explains enzymatic dysfunction found in leukodystrophy
    Article Snippet: Full-length ACER3 was inserted in frame of the N terminus of the SNAP tag in the pSNAPf vector (New England Biolabs) by PCR using the following specific oligonucleotides: 5′ AAACGCTAGCGATATCATGGACTACAAGGACGACGACGACAAGGCTCCTGCAGCTGACAG 3′ as forward and 5′ TATGCAACCGGTGTGCTTCCTCAAGGGCT 3′ as reverse. .. HEK293 cells were grown in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum and antibiotics at 37 °C, 5% CO2 .

    Western Blot:

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: Antibodies, plasmids and reagents Western blot analysis using cultured cells, mouse brain tissue and Drosophila tissue samples was performed as described, using ECL prime solution (GE Healthcare) [ , ]. .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech).

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: In brief, HeLa cells were transfected with these plasmids, transiently selected with Puromycin (1 µg/ml) for 2 days, and surviving cells were isolated into single cells, amplified, then checked by anti-OTUD5 western blots. .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    RNA Binding Assay:

    Article Title: Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres
    Article Snippet: The cDNAs encoding the RNA-binding domain of human PUMILIO1 (PUM-HD) (828–1176 amino acids) and the N-terminal and C-terminal EGFP fragments (GN; 1–157 amino acids, GC; 158–238 amino acids) were generated by polymerase chain reaction (PCR). .. The SNAPf coding region of the hnRNPA1-SNAPf expression vector was prepared with PCR using the pSNAPf-vector (NEB, NA) as the PCR template and primers to add a flexible GGSGGS linker on the N-terminus.

    Transformation Assay:

    Article Title: Heparan sulfate antagonism alters bone morphogenetic protein signaling and receptor dynamics, suggesting a mechanism in hereditary multiple exostoses
    Article Snippet: To insert the signal peptide of the receptors into the pSnapf vector, we first digested the vector with NheI and EcoRI and then inserted the signal peptide via ligation using the Quick Ligation Kit according to the manufacturer's protocol (New England Biolabs). .. After transformation, colonies were selected and subjected to PCR to identify positive colonies for the signal peptide.

    Derivative Assay:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: CHIKVrepl mCherry-P3 sg-ZsGreen was generated by inserting a ZsGreen-containing DNA fragment (derived from CHIKVrepl sg-ZsGreen ) into CHIKVrepl mCherry-P3 after digestion with AvrII and NotI restriction enzymes, purification of the insert and vector DNA, and ligation with T4 DNA ligase. .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′).

    Countercurrent Chromatography:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Transfection:

    Article Title: Structure of a human intramembrane ceramidase explains enzymatic dysfunction found in leukodystrophy
    Article Snippet: Full-length ACER3 was inserted in frame of the N terminus of the SNAP tag in the pSNAPf vector (New England Biolabs) by PCR using the following specific oligonucleotides: 5′ AAACGCTAGCGATATCATGGACTACAAGGACGACGACGACAAGGCTCCTGCAGCTGACAG 3′ as forward and 5′ TATGCAACCGGTGTGCTTCCTCAAGGGCT 3′ as reverse. .. Lipofectamine 2000-based reverse transfection were performed in polyornithine coated black-walled, dark-bottom, 96-well plates.

    Article Title: Soluble CD80 Restores T Cell Activation and Overcomes Tumor Cell Programmed Death Ligand-1-mediated Immune Suppression
    Article Snippet: .. COS/PDL1/CD80 cells were made by transfecting COS cells with the pSNAPf vector (New England Biolabs, Ipswich, MA) containing PDL1, selecting for transfectants by culturing in 2mg/ml G418, followed by transfection with pLHCX/CD80 ( ). .. The resulting COS/PDL1/CD80 cells were selected and maintained in media supplemented and 400μg/ml hygromycin (Calbiochem).

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: In brief, HeLa cells were transfected with these plasmids, transiently selected with Puromycin (1 µg/ml) for 2 days, and surviving cells were isolated into single cells, amplified, then checked by anti-OTUD5 western blots. .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: Paragraph title: Rudhira in silico analysis, deletion mutant cloning, plasmid constructs, and transfection ... Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B).

    Ligation:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: CHIKVrepl mCherry-P3 sg-ZsGreen was generated by inserting a ZsGreen-containing DNA fragment (derived from CHIKVrepl sg-ZsGreen ) into CHIKVrepl mCherry-P3 after digestion with AvrII and NotI restriction enzymes, purification of the insert and vector DNA, and ligation with T4 DNA ligase. .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′).

    Article Title: Heparan sulfate antagonism alters bone morphogenetic protein signaling and receptor dynamics, suggesting a mechanism in hereditary multiple exostoses
    Article Snippet: .. To insert the signal peptide of the receptors into the pSnapf vector, we first digested the vector with NheI and EcoRI and then inserted the signal peptide via ligation using the Quick Ligation Kit according to the manufacturer's protocol (New England Biolabs). .. After transformation, colonies were selected and subjected to PCR to identify positive colonies for the signal peptide.

    Cell Culture:

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: Antibodies, plasmids and reagents Western blot analysis using cultured cells, mouse brain tissue and Drosophila tissue samples was performed as described, using ECL prime solution (GE Healthcare) [ , ]. .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech).

    Article Title: Soluble CD80 Restores T Cell Activation and Overcomes Tumor Cell Programmed Death Ligand-1-mediated Immune Suppression
    Article Snippet: COS cells were cultured in DMEM, supplemented with 10% heat-inactivated FCS (Hyclone, Logan, UT), 1% penicillin/streptomycin (BioSource, Rockville, MD), 2mM Glutamax (BRL/Life Sciences, Grand Island, NY), 0.1% gentamicin (BioSource), and 5mg/ml Prophylactic Plasmocin (InvivoGen, San Diego, CA) ( ). .. COS/PDL1/CD80 cells were made by transfecting COS cells with the pSNAPf vector (New England Biolabs, Ipswich, MA) containing PDL1, selecting for transfectants by culturing in 2mg/ml G418, followed by transfection with pLHCX/CD80 ( ).

    Generated:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: CHIKVrepl mCherry-P3 sg-ZsGreen was generated by inserting a ZsGreen-containing DNA fragment (derived from CHIKVrepl sg-ZsGreen ) into CHIKVrepl mCherry-P3 after digestion with AvrII and NotI restriction enzymes, purification of the insert and vector DNA, and ligation with T4 DNA ligase. .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′).

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: Reporter plasmid for Notch signaling activity using a Hes1 promoter (pHes1-luc) was generated in Kageyama’s lab. pCMV-Tag4-mouse Notch1-FLAG was a kind gift from Drs. K. Katsube and K. Sakamoto and subcloned into a pcDNA5/FRT vector. pMXs-rat Dll1-IG was a kind gift from Dr. Y. Goto, and the insert was sub-cloned into a pcDNA5/FRT vector. .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech).

    Article Title: Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres
    Article Snippet: The cDNAs encoding the RNA-binding domain of human PUMILIO1 (PUM-HD) (828–1176 amino acids) and the N-terminal and C-terminal EGFP fragments (GN; 1–157 amino acids, GC; 158–238 amino acids) were generated by polymerase chain reaction (PCR). .. The SNAPf coding region of the hnRNPA1-SNAPf expression vector was prepared with PCR using the pSNAPf-vector (NEB, NA) as the PCR template and primers to add a flexible GGSGGS linker on the N-terminus.

    Article Title: Soluble CD80 Restores T Cell Activation and Overcomes Tumor Cell Programmed Death Ligand-1-mediated Immune Suppression
    Article Snippet: C8161/CD80, 4T1/CD80, and MELF10/CD80 transfectants were generated and maintained as described ( , , , ). .. COS/PDL1/CD80 cells were made by transfecting COS cells with the pSNAPf vector (New England Biolabs, Ipswich, MA) containing PDL1, selecting for transfectants by culturing in 2mg/ml G418, followed by transfection with pLHCX/CD80 ( ).

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: OTUD5 knockout HeLa clones were generated using the CRISPR-Cas9 plasmid and Double Nickase (Cas9 D10A mutant) plasmid synthesized from Santa Cruz Biotechnology. .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    DNA Sequencing:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. All constructs were verified by DNA sequencing of nsP3 regions and the subgenomic region, as well as analysis of EcoRI/BamHI restriction digest patterns to test for the overall integrity of CHIKV replicons.

    Polymerase Chain Reaction:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech). .. Plasmids for human LRRK2 have been reported elsewhere [ , ] and were further sub-cloned into a pEF vector.

    Article Title: Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres
    Article Snippet: .. The SNAPf coding region of the hnRNPA1-SNAPf expression vector was prepared with PCR using the pSNAPf-vector (NEB, NA) as the PCR template and primers to add a flexible GGSGGS linker on the N-terminus. .. The hnRNPA1 cDNA was obtained from Addgene (pET9d-hnRNPA1). hnRNPA1 was fused to the N-terminus of SNAPf.

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: A linker encoding the signal sequence of EGFR was inserted into 5′ MCS of pSNAPf vector (New England Biolabs) using the unique NheI and EcoRI sites. .. Subsequently, the coding sequence of mature EGFR (GeneCopoeia) was amplified by PCR and subcloned into the plasmid pSNAPf using the unique SbfI and NotI sites creating pSNAPf -EGFR.

    Article Title: Structure of a human intramembrane ceramidase explains enzymatic dysfunction found in leukodystrophy
    Article Snippet: .. Full-length ACER3 was inserted in frame of the N terminus of the SNAP tag in the pSNAPf vector (New England Biolabs) by PCR using the following specific oligonucleotides: 5′ AAACGCTAGCGATATCATGGACTACAAGGACGACGACGACAAGGCTCCTGCAGCTGACAG 3′ as forward and 5′ TATGCAACCGGTGTGCTTCCTCAAGGGCT 3′ as reverse. .. HEK293 cells were grown in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum and antibiotics at 37 °C, 5% CO2 .

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: All PCR-amplified DNAs were confirmed by DNA sequence analyses. .. To obtain SNAP-AMPAR (SNAP-GluA2flop (R)), cDNA encoding SNAP-tag was amplified from pSNAPf vector (NEB).

    Article Title: Correlative Light- and Electron Microscopy with chemical tags
    Article Snippet: .. The coding sequence of SNAPf was amplified by PCR (sense primer: 5′-GCGGCGCGCCATGGACAAAGACTGCGAAATGAAGCG-3′, antisense primer: 5′-GCGGCGCGCCCACCCAGCCCAGGCTTGCCCAG-3′) using the pSNAPf -vector (New England BioLabs) as a template and introducing Asc I sites at both ends. .. The amplified region was inserted via Asc I into the coding region of the extracellular domain of N-cadherin at a site (aa position 151 of the mature protein) previously reported to tolerate insertion of GFP ( ).

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B). .. For deletion mutant cloning, the regions to be cloned were PCR amplified from pCMV-RudhFL-FLAG vector and cloned in pCMV-Tag2B vector (Stratagene) ( and ′).

    Article Title: Heparan sulfate antagonism alters bone morphogenetic protein signaling and receptor dynamics, suggesting a mechanism in hereditary multiple exostoses
    Article Snippet: To insert the signal peptide of the receptors into the pSnapf vector, we first digested the vector with NheI and EcoRI and then inserted the signal peptide via ligation using the Quick Ligation Kit according to the manufacturer's protocol (New England Biolabs). .. After transformation, colonies were selected and subjected to PCR to identify positive colonies for the signal peptide.

    Affinity Purification:

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: The resulting plasmid, pEGF-CLIPf -6xHis, was used for expression of EGF-CLIPf fusion protein in E. coli and subsequent affinity purification by Ni-NTA agarose (Qiagen). .. A linker encoding the signal sequence of EGFR was inserted into 5′ MCS of pSNAPf vector (New England Biolabs) using the unique NheI and EcoRI sites.

    Recombinant:

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). .. The U2OS cells stably expressing SNAP-H2A were generated through G418 selection and clonal isolation. pDEST_Tet_CMV_FLAG-OTUD5 was a gift from Wade Harper (Addgene plasmid # 22610) ( ) and was used for generating HeLa cells stably expressing FLAG-OTUD5. pDEST10-6xHis-UBR5 plasmid was a gift from Sally Kornbluth ( ) and was used for recombinant protein production from SF9 cells.

    Cellular Antioxidant Activity Assay:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Molecular Cloning:

    Article Title: Correlative Light- and Electron Microscopy with chemical tags
    Article Snippet: Paragraph title: 4.1. Molecular cloning ... The coding sequence of SNAPf was amplified by PCR (sense primer: 5′-GCGGCGCGCCATGGACAAAGACTGCGAAATGAAGCG-3′, antisense primer: 5′-GCGGCGCGCCCACCCAGCCCAGGCTTGCCCAG-3′) using the pSNAPf -vector (New England BioLabs) as a template and introducing Asc I sites at both ends.

    Mutagenesis:

    Article Title: The Interaction of Natural Selection and GC Skew May Drive the Fast Evolution of a Sand Rat Homeobox Gene
    Article Snippet: Paragraph title: Plasmid Construction and In Vitro Mutagenesis ... Mouse Pdx1 was inserted into pSNAPf vector (New England BioLabs) using Bam HI and Xho I restriction sites, and sand rat Pdx1 inserted using Not I and Xho I restriction sites.

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: OTUD5 knockout HeLa clones were generated using the CRISPR-Cas9 plasmid and Double Nickase (Cas9 D10A mutant) plasmid synthesized from Santa Cruz Biotechnology. .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: Paragraph title: Rudhira in silico analysis, deletion mutant cloning, plasmid constructs, and transfection ... Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B).

    Isolation:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: Construction of DNA plasmids containing CHIKV replicons DNA constructs containing the CHIKV-replicon cDNA from the LR2006 OPY1 strain, which was originally isolated from the serum of a febrile patient travelling from La Réunion , with or without ZsGreen in the region 3′ of the subgenomic promoter, were constructed previously , and are referred to as CHIKVrepl and CHIKVrepl sg-ZsGreen . .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′).

    Article Title: Retargeting of macroH2A following mitosis to cytogenetic-scale heterochromatic domains
    Article Snippet: To generate the plasmids expressing SNAP-H3 and SNAP-macroH2A, the pSNAPf vector produced from New England Biolabs was used. .. After creating the pSNAPf -Zeocin vector, the cDNA of H3.1 isolated from a human cDNA library or the cDNA for macroH2A1.2 from pCS2+ macroH2A1.2-GFP-HA (30515; Addgene) was cloned into the pSNAPf -Zeocin vector.

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). .. The U2OS cells stably expressing SNAP-H2A were generated through G418 selection and clonal isolation. pDEST_Tet_CMV_FLAG-OTUD5 was a gift from Wade Harper (Addgene plasmid # 22610) ( ) and was used for generating HeLa cells stably expressing FLAG-OTUD5. pDEST10-6xHis-UBR5 plasmid was a gift from Sally Kornbluth ( ) and was used for recombinant protein production from SF9 cells.

    Purification:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: CHIKVrepl mCherry-P3 sg-ZsGreen was generated by inserting a ZsGreen-containing DNA fragment (derived from CHIKVrepl sg-ZsGreen ) into CHIKVrepl mCherry-P3 after digestion with AvrII and NotI restriction enzymes, purification of the insert and vector DNA, and ligation with T4 DNA ligase. .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′).

    Sequencing:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Article Title: Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres
    Article Snippet: Three tandem repeats of the NLS sequence DPKKKRKV were connected with the N-terminus of the GN portion ( ). .. The SNAPf coding region of the hnRNPA1-SNAPf expression vector was prepared with PCR using the pSNAPf-vector (NEB, NA) as the PCR template and primers to add a flexible GGSGGS linker on the N-terminus.

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: .. A linker encoding the signal sequence of EGFR was inserted into 5′ MCS of pSNAPf vector (New England Biolabs) using the unique NheI and EcoRI sites. .. Subsequently, the coding sequence of mature EGFR (GeneCopoeia) was amplified by PCR and subcloned into the plasmid pSNAPf using the unique SbfI and NotI sites creating pSNAPf -EGFR.

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: All PCR-amplified DNAs were confirmed by DNA sequence analyses. .. To obtain SNAP-AMPAR (SNAP-GluA2flop (R)), cDNA encoding SNAP-tag was amplified from pSNAPf vector (NEB).

    Article Title: Correlative Light- and Electron Microscopy with chemical tags
    Article Snippet: .. The coding sequence of SNAPf was amplified by PCR (sense primer: 5′-GCGGCGCGCCATGGACAAAGACTGCGAAATGAAGCG-3′, antisense primer: 5′-GCGGCGCGCCCACCCAGCCCAGGCTTGCCCAG-3′) using the pSNAPf -vector (New England BioLabs) as a template and introducing Asc I sites at both ends. .. The amplified region was inserted via Asc I into the coding region of the extracellular domain of N-cadherin at a site (aa position 151 of the mature protein) previously reported to tolerate insertion of GFP ( ).

    Article Title: The Interaction of Natural Selection and GC Skew May Drive the Fast Evolution of a Sand Rat Homeobox Gene
    Article Snippet: Mouse Pdx1 was inserted into pSNAPf vector (New England BioLabs) using Bam HI and Xho I restriction sites, and sand rat Pdx1 inserted using Not I and Xho I restriction sites. .. Successful insertion was verified by Sanger sequencing.

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). .. The U2OS cells stably expressing SNAP-H2A were generated through G418 selection and clonal isolation. pDEST_Tet_CMV_FLAG-OTUD5 was a gift from Wade Harper (Addgene plasmid # 22610) ( ) and was used for generating HeLa cells stably expressing FLAG-OTUD5. pDEST10-6xHis-UBR5 plasmid was a gift from Sally Kornbluth ( ) and was used for recombinant protein production from SF9 cells.

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: Rudhira in silico analysis, deletion mutant cloning, plasmid constructs, and transfection Domain/motif prediction analysis of mouse Rudhira protein sequence (Uniprot Id Q8CCN5.2) was performed using various bioinformatics tools, namely Superfamily ( https://supfam.org/SUPERFAMILY/ ), Motif Scan ( https://myhits.isb-sib.ch/cgi-bin/motif_scan ), Pfam ( https://pfam.xfam.org/ ), NCBI-CDD ( www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi?INPUT_TYPE =precalc & SEQUENCE=33300978), Motif Finder ( www.genome.jp/tools/motif/ ), Interpro ( www.ebi.ac.uk/interpro/ ), and epestfind in the EMBOSS package of ExPASy ( www.expasy.org/tools/ ). .. Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B).

    CRISPR:

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: OTUD5 knockout HeLa clones were generated using the CRISPR-Cas9 plasmid and Double Nickase (Cas9 D10A mutant) plasmid synthesized from Santa Cruz Biotechnology. .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    cDNA Library Assay:

    Article Title: Retargeting of macroH2A following mitosis to cytogenetic-scale heterochromatic domains
    Article Snippet: To generate the plasmids expressing SNAP-H3 and SNAP-macroH2A, the pSNAPf vector produced from New England Biolabs was used. .. After creating the pSNAPf -Zeocin vector, the cDNA of H3.1 isolated from a human cDNA library or the cDNA for macroH2A1.2 from pCS2+ macroH2A1.2-GFP-HA (30515; Addgene) was cloned into the pSNAPf -Zeocin vector.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Plasmid Preparation:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech). .. Plasmids for human LRRK2 have been reported elsewhere [ , ] and were further sub-cloned into a pEF vector.

    Article Title: Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres
    Article Snippet: .. The SNAPf coding region of the hnRNPA1-SNAPf expression vector was prepared with PCR using the pSNAPf-vector (NEB, NA) as the PCR template and primers to add a flexible GGSGGS linker on the N-terminus. .. The hnRNPA1 cDNA was obtained from Addgene (pET9d-hnRNPA1). hnRNPA1 was fused to the N-terminus of SNAPf.

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: .. A linker encoding the signal sequence of EGFR was inserted into 5′ MCS of pSNAPf vector (New England Biolabs) using the unique NheI and EcoRI sites. .. Subsequently, the coding sequence of mature EGFR (GeneCopoeia) was amplified by PCR and subcloned into the plasmid pSNAPf using the unique SbfI and NotI sites creating pSNAPf -EGFR.

    Article Title: Structure of a human intramembrane ceramidase explains enzymatic dysfunction found in leukodystrophy
    Article Snippet: .. Full-length ACER3 was inserted in frame of the N terminus of the SNAP tag in the pSNAPf vector (New England Biolabs) by PCR using the following specific oligonucleotides: 5′ AAACGCTAGCGATATCATGGACTACAAGGACGACGACGACAAGGCTCCTGCAGCTGACAG 3′ as forward and 5′ TATGCAACCGGTGTGCTTCCTCAAGGGCT 3′ as reverse. .. HEK293 cells were grown in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum and antibiotics at 37 °C, 5% CO2 .

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: .. To obtain SNAP-AMPAR (SNAP-GluA2flop (R)), cDNA encoding SNAP-tag was amplified from pSNAPf vector (NEB). .. After DNA sequence analyses, the SNAP-tag cDNA was inserted between HA-tag and GluA2flop (R) in the pCAGGS expression vector.

    Article Title: Retargeting of macroH2A following mitosis to cytogenetic-scale heterochromatic domains
    Article Snippet: .. To generate the plasmids expressing SNAP-H3 and SNAP-macroH2A, the pSNAPf vector produced from New England Biolabs was used. .. Due to the drug incompatibility in HEK 293T cells, we replaced the existing Neomycin selection gene with Zeocin.

    Article Title: Soluble CD80 Restores T Cell Activation and Overcomes Tumor Cell Programmed Death Ligand-1-mediated Immune Suppression
    Article Snippet: .. COS/PDL1/CD80 cells were made by transfecting COS cells with the pSNAPf vector (New England Biolabs, Ipswich, MA) containing PDL1, selecting for transfectants by culturing in 2mg/ml G418, followed by transfection with pLHCX/CD80 ( ). .. The resulting COS/PDL1/CD80 cells were selected and maintained in media supplemented and 400μg/ml hygromycin (Calbiochem).

    Article Title: Lipids Regulate Lck Protein Activity through Their Interactions with the Lck Src Homology 2 Domain
    Article Snippet: .. cDNAs of full-length human Lck and TCR-ζ (CD247) were subcloned to the pSNAPf vector (New England Biolabs) using KpnI/XhoI and EcoRI/EcoRV sites, respectively. .. All EGFP-tagged Lck-SH2 and full-length Lck proteins were expressed as His6 -tagged proteins in Escherichia coli BL21 (DE3) pLysS (Novagen).

    Article Title: Correlative Light- and Electron Microscopy with chemical tags
    Article Snippet: .. The coding sequence of SNAPf was amplified by PCR (sense primer: 5′-GCGGCGCGCCATGGACAAAGACTGCGAAATGAAGCG-3′, antisense primer: 5′-GCGGCGCGCCCACCCAGCCCAGGCTTGCCCAG-3′) using the pSNAPf -vector (New England BioLabs) as a template and introducing Asc I sites at both ends. .. The amplified region was inserted via Asc I into the coding region of the extracellular domain of N-cadherin at a site (aa position 151 of the mature protein) previously reported to tolerate insertion of GFP ( ).

    Article Title: The Interaction of Natural Selection and GC Skew May Drive the Fast Evolution of a Sand Rat Homeobox Gene
    Article Snippet: .. Mouse Pdx1 was inserted into pSNAPf vector (New England BioLabs) using Bam HI and Xho I restriction sites, and sand rat Pdx1 inserted using Not I and Xho I restriction sites. .. Stop codons were removed to allow expression of Pdx1-SNAP fusion protein.

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). .. The U2OS cells stably expressing SNAP-H2A were generated through G418 selection and clonal isolation. pDEST_Tet_CMV_FLAG-OTUD5 was a gift from Wade Harper (Addgene plasmid # 22610) ( ) and was used for generating HeLa cells stably expressing FLAG-OTUD5. pDEST10-6xHis-UBR5 plasmid was a gift from Sally Kornbluth ( ) and was used for recombinant protein production from SF9 cells.

    Article Title: Rudhira/BCAS3 couples microtubules and intermediate filaments to promote cell migration for angiogenic remodeling
    Article Snippet: .. Rudhira ORF was subcloned from pCMV-RudhFL-FLAG vector into pSNAPf vector (New England Biolabs) using Nhe I-Eco RI sites to obtain Rudhira-SNAP (Supplemental Figure S3B). .. For deletion mutant cloning, the regions to be cloned were PCR amplified from pCMV-RudhFL-FLAG vector and cloned in pCMV-Tag2B vector (Stratagene) ( and ′).

    Software:

    Article Title: The Parkinson’s Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway
    Article Snippet: All densitometry was performed using ImageJ software. .. For SNAP-Dll1, the SNAP-tag was PCR amplified from a pSNAPf vector (New England Biolabs) and inserted into the extracellular domain of rat Dll1 using In-Fusion cloning kit (Clontech).

    Selection:

    Article Title: Retargeting of macroH2A following mitosis to cytogenetic-scale heterochromatic domains
    Article Snippet: To generate the plasmids expressing SNAP-H3 and SNAP-macroH2A, the pSNAPf vector produced from New England Biolabs was used. .. Due to the drug incompatibility in HEK 293T cells, we replaced the existing Neomycin selection gene with Zeocin.

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). .. The U2OS cells stably expressing SNAP-H2A were generated through G418 selection and clonal isolation. pDEST_Tet_CMV_FLAG-OTUD5 was a gift from Wade Harper (Addgene plasmid # 22610) ( ) and was used for generating HeLa cells stably expressing FLAG-OTUD5. pDEST10-6xHis-UBR5 plasmid was a gift from Sally Kornbluth ( ) and was used for recombinant protein production from SF9 cells.

    In Vitro:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: Briefly, cDNA fragments (Geneart) were synthesised based on the published sequence of the LR2006 OPY1 strain and assembled in vitro to generate these fully synthetic replicons. .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′).

    Article Title: The Interaction of Natural Selection and GC Skew May Drive the Fast Evolution of a Sand Rat Homeobox Gene
    Article Snippet: Paragraph title: Plasmid Construction and In Vitro Mutagenesis ... Mouse Pdx1 was inserted into pSNAPf vector (New England BioLabs) using Bam HI and Xho I restriction sites, and sand rat Pdx1 inserted using Not I and Xho I restriction sites.

    Knock-Out:

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: OTUD5 knockout HeLa clones were generated using the CRISPR-Cas9 plasmid and Double Nickase (Cas9 D10A mutant) plasmid synthesized from Santa Cruz Biotechnology. .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB).

    Produced:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Article Title: Retargeting of macroH2A following mitosis to cytogenetic-scale heterochromatic domains
    Article Snippet: .. To generate the plasmids expressing SNAP-H3 and SNAP-macroH2A, the pSNAPf vector produced from New England Biolabs was used. .. Due to the drug incompatibility in HEK 293T cells, we replaced the existing Neomycin selection gene with Zeocin.

    CTG Assay:

    Article Title: SNAP-tagged Chikungunya Virus Replicons Improve Visualisation of Non-Structural Protein 3 by Fluorescence Microscopy
    Article Snippet: .. The SNAP sequence was produced by PCR amplification of the pSNAPf vector (New England Biolabs, NEB) with primers containing SpeI sites and a sequence encoding short amino acid linkers (5′-GCC ATC CAC AAC TAG TGG TGG CGG CAT GGA CAA AGA CTG CGA AAT GAA-3′ and 5′-GCA AGG TTT CCA CTA GTC CCT CCA CCC AGC CCA GGC TTG CCC A-3′). .. The purified PCR product was used to replace mCherry from the CHIKVrepl mCherry-P3 sg-ZsGreen construct by restriction digestion and ligation of the SpeI sites.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs psnapf vector
    Psnapf Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psnapf vector/product/New England Biolabs
    Average 90 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    psnapf vector - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results