psnapf  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    pSNAPf Vector
    Description:
    pSNAPf Vector 20 ug
    Catalog Number:
    N9183S
    Price:
    166
    Category:
    Vectors Plasmids
    Size:
    20 ug
    Buy from Supplier


    Structured Review

    New England Biolabs psnapf
    pSNAPf Vector
    pSNAPf Vector 20 ug
    https://www.bioz.com/result/psnapf/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psnapf - by Bioz Stars, 2021-08
    95/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Structure of a human intramembrane ceramidase explains enzymatic dysfunction found in leukodystrophy
    Article Snippet: .. Full-length ACER3 was inserted in frame of the N terminus of the SNAP tag in the pSNAPf vector (New England Biolabs) by PCR using the following specific oligonucleotides: 5′ AAACGCTAGCGATATCATGGACTACAAGGACGACGACGACAAGGCTCCTGCAGCTGACAG 3′ as forward and 5′ TATGCAACCGGTGTGCTTCCTCAAGGGCT 3′ as reverse. ..

    Article Title: Quantitative Kinetic Analyses of Histone Turnover Using Imaging and Flow Cytometry
    Article Snippet: .. A plasmid that encodes desired histone with SNAP-tag needs to be cloned by general cloning methods. pSNAPf Vector (catalog # N9183S from NEB) is useful to establish your construct and stably expressing cell line since it contains neomycin resistance gene for efficient drug selection. ..

    Article Title: Direct Profiling the Post-Translational Modification Codes of a Single Protein Immobilized on a Surface Using Cu-free Click Chemistry
    Article Snippet: .. The SNAP-tag DNA fragment was prepared by PCR using vector pSNAPf (NEB) as the template and the following primers: forward ( AscI ): 5′- GGCGCGCC ACATCATCACCATCACCAT ATGGACAAAGACTGCGAAATG-3′; reverse ( SacII ): 5′-TCC CCGCGG CCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG-3′. ..

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). ..

    Article Title: Direct visualization of single-molecule membrane protein interactions in living cells
    Article Snippet: .. To construct SNAP-tagged EGFR, the SNAP tag gene from the pSNAPf vector (N9183S, New England Biolabs) was subcloned into pcDNA3.1/mEos3.2-EGFR with the following primers 7–8. ..

    Polymerase Chain Reaction:

    Article Title: Structure of a human intramembrane ceramidase explains enzymatic dysfunction found in leukodystrophy
    Article Snippet: .. Full-length ACER3 was inserted in frame of the N terminus of the SNAP tag in the pSNAPf vector (New England Biolabs) by PCR using the following specific oligonucleotides: 5′ AAACGCTAGCGATATCATGGACTACAAGGACGACGACGACAAGGCTCCTGCAGCTGACAG 3′ as forward and 5′ TATGCAACCGGTGTGCTTCCTCAAGGGCT 3′ as reverse. ..

    Article Title: Direct Profiling the Post-Translational Modification Codes of a Single Protein Immobilized on a Surface Using Cu-free Click Chemistry
    Article Snippet: .. The SNAP-tag DNA fragment was prepared by PCR using vector pSNAPf (NEB) as the template and the following primers: forward ( AscI ): 5′- GGCGCGCC ACATCATCACCATCACCAT ATGGACAAAGACTGCGAAATG-3′; reverse ( SacII ): 5′-TCC CCGCGG CCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG-3′. ..

    Clone Assay:

    Article Title: Quantitative Kinetic Analyses of Histone Turnover Using Imaging and Flow Cytometry
    Article Snippet: .. A plasmid that encodes desired histone with SNAP-tag needs to be cloned by general cloning methods. pSNAPf Vector (catalog # N9183S from NEB) is useful to establish your construct and stably expressing cell line since it contains neomycin resistance gene for efficient drug selection. ..

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). ..

    Construct:

    Article Title: Quantitative Kinetic Analyses of Histone Turnover Using Imaging and Flow Cytometry
    Article Snippet: .. A plasmid that encodes desired histone with SNAP-tag needs to be cloned by general cloning methods. pSNAPf Vector (catalog # N9183S from NEB) is useful to establish your construct and stably expressing cell line since it contains neomycin resistance gene for efficient drug selection. ..

    Article Title: Direct visualization of single-molecule membrane protein interactions in living cells
    Article Snippet: .. To construct SNAP-tagged EGFR, the SNAP tag gene from the pSNAPf vector (N9183S, New England Biolabs) was subcloned into pcDNA3.1/mEos3.2-EGFR with the following primers 7–8. ..

    Stable Transfection:

    Article Title: Quantitative Kinetic Analyses of Histone Turnover Using Imaging and Flow Cytometry
    Article Snippet: .. A plasmid that encodes desired histone with SNAP-tag needs to be cloned by general cloning methods. pSNAPf Vector (catalog # N9183S from NEB) is useful to establish your construct and stably expressing cell line since it contains neomycin resistance gene for efficient drug selection. ..

    Expressing:

    Article Title: Quantitative Kinetic Analyses of Histone Turnover Using Imaging and Flow Cytometry
    Article Snippet: .. A plasmid that encodes desired histone with SNAP-tag needs to be cloned by general cloning methods. pSNAPf Vector (catalog # N9183S from NEB) is useful to establish your construct and stably expressing cell line since it contains neomycin resistance gene for efficient drug selection. ..

    Selection:

    Article Title: Quantitative Kinetic Analyses of Histone Turnover Using Imaging and Flow Cytometry
    Article Snippet: .. A plasmid that encodes desired histone with SNAP-tag needs to be cloned by general cloning methods. pSNAPf Vector (catalog # N9183S from NEB) is useful to establish your construct and stably expressing cell line since it contains neomycin resistance gene for efficient drug selection. ..

    Sequencing:

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). ..

    Isolation:

    Article Title: The OTUD5–UBR5 complex regulates FACT-mediated transcription at damaged chromatin
    Article Snippet: .. The coding sequence for histone H2A (isolated from T80 ovarian cells) was cloned into the pSNAPf Vector (NEB). ..

    Generated:

    Article Title: Mechanical loading of desmosomes depends on the magnitude and orientation of external stress
    Article Snippet: .. Donor-only controls were generated by Gibson assembly and used TagBFP (Evrogen), SNAP (NEB, N9183S), and fluorescently dead mCherry(Y72L) . ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs psnapf vector
    Psnapf Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psnapf vector/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psnapf vector - by Bioz Stars, 2021-08
    95/100 stars
      Buy from Supplier

    Image Search Results