psnap tag t7 2 vector  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    pSNAP tag T7 2 Vector
    Description:
    pSNAP tag T7 2 Vector 20 ug
    Catalog Number:
    n9181s
    Price:
    166
    Size:
    20 ug
    Category:
    Vectors Plasmids
    Buy from Supplier


    Structured Review

    New England Biolabs psnap tag t7 2 vector
    pSNAP tag T7 2 Vector
    pSNAP tag T7 2 Vector 20 ug
    https://www.bioz.com/result/psnap tag t7 2 vector/product/New England Biolabs
    Average 94 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    psnap tag t7 2 vector - by Bioz Stars, 2020-05
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Structural basis of RIP2 activation and signaling
    Article Snippet: .. N-terminal 13 extra amino acids—VDEALREAQTKSA—named 13aa was attached to the N-terminal of RIP2–CARD and then this insert was cloned into the pSnap-tag (T7)-2 vector (New England Biolabs) between the EcoRI and NotI restriction sites after the SNAP sequence. ..

    Article Title: Emerin induces nuclear breakage in Xenopus extract and early embryos
    Article Snippet: .. The SNAP tag was amplified from pSNAP (T7)-2 (NEB) by PCR and cloned into pET30a at Nco I and Sac I to generate pDL96. .. Human emerin was amplified from pDL87 by PCR and cloned into pDL96 at Sal I and Not I to generate SNAP-emerin pET30a (pDL97).

    Article Title: Distinct reaction mechanisms for hyaluronan biosynthesis in different kingdoms of life
    Article Snippet: .. HAS-SNAP fusion constructs were made by cloning HAS genes into the pSNAP-tag (T7)−2 vector (New England Biolabs). .. Cv-HAS was cloned using the NcoI and EcoRV restriction sites, producing a construct with a C- terminal His- and SNAP-tag.

    Amplification:

    Article Title: Galectin‐3 is an amplifier of the interleukin‐1β‐mediated inflammatory response in corneal keratinocytes
    Article Snippet: .. The coding sequence of the SNAP‐tag was amplified by PCR using the pSNAP‐tag(m) vector (New England Biolabs, Ipswich, MA) as template and the primers SNAP‐F 5′‐GGCGGCGGCCATATGGACAAAGACTGCG‐3′) and SNAP‐R (5′‐AAAAATTGTCTGCCATTACCGTTCGTATAA‐3′). .. The coding sequence of galectin‐3 was amplified by PCR using cDNA from telomerase‐immortalized human corneal keratinocytes as template and the primers galectin‐F (5′‐TTATACGAACGGTAATGGCAGACAATTTTT‐3′) and galectin‐R (5′‐GGCGGCGGCGGATCCTTATATCATGGTATA‐3′).

    Article Title: Emerin induces nuclear breakage in Xenopus extract and early embryos
    Article Snippet: .. The SNAP tag was amplified from pSNAP (T7)-2 (NEB) by PCR and cloned into pET30a at Nco I and Sac I to generate pDL96. .. Human emerin was amplified from pDL87 by PCR and cloned into pDL96 at Sal I and Not I to generate SNAP-emerin pET30a (pDL97).

    Mutagenesis:

    Article Title: Designing Cell-Targeted Therapeutic Proteins Reveals the Interplay between Domain Connectivity and Cell Binding
    Article Snippet: .. Human type I IFN α 2a (IFN α ; GenBank ID: ) WT and the R144A mutant were genetically fused via a Gly4 Ser linker to the N-terminus of SNAP-tag (N9181S; NEB, New England Biolabs, Ipswich, MA), which was then followed by a C-terminal 6×His tag ( A, GenBank accession numbers and ). ..

    Construct:

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: .. 2.1 Expression Constructs pSNAPf -tag(T7) and pCLIPf -tag(T7) were constructed by replacing the SNAP-26m coding region of pSNAP-tag(T7)-2 (New England Biolabs) using the unique EcoRI and SbfI sites with the coding regions of SNAPf and CLIPf , respectively. .. The mouse EGF coding sequence was fused in-frame to the 5′ end of CLIPf , and a 6-histidine tag fused to the 3′ end of CLIPf in pCLIPf -tag(T7).

    Article Title: Distinct reaction mechanisms for hyaluronan biosynthesis in different kingdoms of life
    Article Snippet: .. HAS-SNAP fusion constructs were made by cloning HAS genes into the pSNAP-tag (T7)−2 vector (New England Biolabs). .. Cv-HAS was cloned using the NcoI and EcoRV restriction sites, producing a construct with a C- terminal His- and SNAP-tag.

    Sequencing:

    Article Title: Galectin‐3 is an amplifier of the interleukin‐1β‐mediated inflammatory response in corneal keratinocytes
    Article Snippet: .. The coding sequence of the SNAP‐tag was amplified by PCR using the pSNAP‐tag(m) vector (New England Biolabs, Ipswich, MA) as template and the primers SNAP‐F 5′‐GGCGGCGGCCATATGGACAAAGACTGCG‐3′) and SNAP‐R (5′‐AAAAATTGTCTGCCATTACCGTTCGTATAA‐3′). .. The coding sequence of galectin‐3 was amplified by PCR using cDNA from telomerase‐immortalized human corneal keratinocytes as template and the primers galectin‐F (5′‐TTATACGAACGGTAATGGCAGACAATTTTT‐3′) and galectin‐R (5′‐GGCGGCGGCGGATCCTTATATCATGGTATA‐3′).

    Article Title: Structural basis of RIP2 activation and signaling
    Article Snippet: .. N-terminal 13 extra amino acids—VDEALREAQTKSA—named 13aa was attached to the N-terminal of RIP2–CARD and then this insert was cloned into the pSnap-tag (T7)-2 vector (New England Biolabs) between the EcoRI and NotI restriction sites after the SNAP sequence. ..

    Expressing:

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: .. 2.1 Expression Constructs pSNAPf -tag(T7) and pCLIPf -tag(T7) were constructed by replacing the SNAP-26m coding region of pSNAP-tag(T7)-2 (New England Biolabs) using the unique EcoRI and SbfI sites with the coding regions of SNAPf and CLIPf , respectively. .. The mouse EGF coding sequence was fused in-frame to the 5′ end of CLIPf , and a 6-histidine tag fused to the 3′ end of CLIPf in pCLIPf -tag(T7).

    Polymerase Chain Reaction:

    Article Title: Galectin‐3 is an amplifier of the interleukin‐1β‐mediated inflammatory response in corneal keratinocytes
    Article Snippet: .. The coding sequence of the SNAP‐tag was amplified by PCR using the pSNAP‐tag(m) vector (New England Biolabs, Ipswich, MA) as template and the primers SNAP‐F 5′‐GGCGGCGGCCATATGGACAAAGACTGCG‐3′) and SNAP‐R (5′‐AAAAATTGTCTGCCATTACCGTTCGTATAA‐3′). .. The coding sequence of galectin‐3 was amplified by PCR using cDNA from telomerase‐immortalized human corneal keratinocytes as template and the primers galectin‐F (5′‐TTATACGAACGGTAATGGCAGACAATTTTT‐3′) and galectin‐R (5′‐GGCGGCGGCGGATCCTTATATCATGGTATA‐3′).

    Article Title: Emerin induces nuclear breakage in Xenopus extract and early embryos
    Article Snippet: .. The SNAP tag was amplified from pSNAP (T7)-2 (NEB) by PCR and cloned into pET30a at Nco I and Sac I to generate pDL96. .. Human emerin was amplified from pDL87 by PCR and cloned into pDL96 at Sal I and Not I to generate SNAP-emerin pET30a (pDL97).

    Plasmid Preparation:

    Article Title: Galectin‐3 is an amplifier of the interleukin‐1β‐mediated inflammatory response in corneal keratinocytes
    Article Snippet: .. The coding sequence of the SNAP‐tag was amplified by PCR using the pSNAP‐tag(m) vector (New England Biolabs, Ipswich, MA) as template and the primers SNAP‐F 5′‐GGCGGCGGCCATATGGACAAAGACTGCG‐3′) and SNAP‐R (5′‐AAAAATTGTCTGCCATTACCGTTCGTATAA‐3′). .. The coding sequence of galectin‐3 was amplified by PCR using cDNA from telomerase‐immortalized human corneal keratinocytes as template and the primers galectin‐F (5′‐TTATACGAACGGTAATGGCAGACAATTTTT‐3′) and galectin‐R (5′‐GGCGGCGGCGGATCCTTATATCATGGTATA‐3′).

    Article Title: Structural basis of RIP2 activation and signaling
    Article Snippet: .. N-terminal 13 extra amino acids—VDEALREAQTKSA—named 13aa was attached to the N-terminal of RIP2–CARD and then this insert was cloned into the pSnap-tag (T7)-2 vector (New England Biolabs) between the EcoRI and NotI restriction sites after the SNAP sequence. ..

    Article Title: Distinct reaction mechanisms for hyaluronan biosynthesis in different kingdoms of life
    Article Snippet: .. HAS-SNAP fusion constructs were made by cloning HAS genes into the pSNAP-tag (T7)−2 vector (New England Biolabs). .. Cv-HAS was cloned using the NcoI and EcoRV restriction sites, producing a construct with a C- terminal His- and SNAP-tag.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs psnap tag t7 2 vector
    Psnap Tag T7 2 Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psnap tag t7 2 vector/product/New England Biolabs
    Average 94 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    psnap tag t7 2 vector - by Bioz Stars, 2020-05
    94/100 stars
      Buy from Supplier

    Image Search Results