psnaptag  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    pSNAP tag T7 2 Vector
    Description:
    pSNAP tag T7 2 Vector 20 ug
    Catalog Number:
    N9181S
    Price:
    166
    Category:
    Vectors Plasmids
    Size:
    20 ug
    Buy from Supplier


    Structured Review

    New England Biolabs psnaptag
    pSNAP tag T7 2 Vector
    pSNAP tag T7 2 Vector 20 ug
    https://www.bioz.com/result/psnaptag/product/New England Biolabs
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psnaptag - by Bioz Stars, 2021-04
    97/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Engineering a living biomaterial via bacterial surface capture of environmental molecules
    Article Snippet: Promoter PBAD was amplified through polymerase chain reaction (PCR) from plasmid pKLi034. .. The SNAP gene was amplified from pSNAP-tag® (T7)-2 (New England Biolabs, Inc.). .. A cytosolic expression cassette containing the PL, tetO-1 promoter driving mCherry expression was isolated by restriction digestion from plasmid pWR011 , and the promoter was subsequently replaced with PBAD for inducible cytosolic mCherry expression.

    Article Title: Protein-Protein Interaction Inhibition (2P2I)-Oriented Chemical Library Accelerates Hit Discovery.
    Article Snippet: For the cloning of methyltransferase domain of non-structural protein 5 (MTase NS5) we used a modified Gateway® pDEST™17 Vector (Life technologies) (insertion of an XhoI restriction site between His tag and attR1 site by site directed mutagenesis). .. SNAP-tag previously amplified from pSNAP-tag® (T7)-2 Vector (New England Biolabs) (forward primer: GGG GCT CGA GTT ATG GAC AAA GAT TGC GAA ATG AAA C, reverse primer: ATA TAC TCG AGT CCC AGA CCC GGT TTA CCC AG) was inserted by restriction ligation in XhoI site. .. The coding sequence of MTaseNS5 DV3 amplified (forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAAACCTGTACTTCCAGGGTGGTACAG GTAGCCAGGGTG, reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTAATGACGGGTGCCTGCACCCAG) from the synthetic gene was then sub cloned in this vector by Gateway® recombination (Life technologies) resulting in a MTase NS5 fused with His and SNAP-tag on the N-terminal part.

    Plasmid Preparation:

    Article Title: High-Performance Binary Protein Interaction Screening in a Microfluidic Format
    Article Snippet: .. One microgram of p-SNAP-tag (T7) plasmid vector (NEB) and linear PCR products of S100A1, S100B, or eGFP were subjected to restriction using SbfI and BamHI (Open Biosystems). .. After a 1-h incubation at 37 °C, the sample was subjected to QIAGEN MinElute Reaction Cleanup Kit.

    Article Title: Protein-Protein Interaction Inhibition (2P2I)-Oriented Chemical Library Accelerates Hit Discovery.
    Article Snippet: For the cloning of methyltransferase domain of non-structural protein 5 (MTase NS5) we used a modified Gateway® pDEST™17 Vector (Life technologies) (insertion of an XhoI restriction site between His tag and attR1 site by site directed mutagenesis). .. SNAP-tag previously amplified from pSNAP-tag® (T7)-2 Vector (New England Biolabs) (forward primer: GGG GCT CGA GTT ATG GAC AAA GAT TGC GAA ATG AAA C, reverse primer: ATA TAC TCG AGT CCC AGA CCC GGT TTA CCC AG) was inserted by restriction ligation in XhoI site. .. The coding sequence of MTaseNS5 DV3 amplified (forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAAACCTGTACTTCCAGGGTGGTACAG GTAGCCAGGGTG, reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTAATGACGGGTGCCTGCACCCAG) from the synthetic gene was then sub cloned in this vector by Gateway® recombination (Life technologies) resulting in a MTase NS5 fused with His and SNAP-tag on the N-terminal part.

    Article Title: Super-assembly of ER-phagy receptor Atg40 induces local ER remodeling at contacts with forming autophagosomal membranes
    Article Snippet: Plasmids for expression of fusion proteins for crystallization were constructed by inserting the genes encoding Atg40237–252 , human FAM134B450–468 , human SEC62361–376 with the T367D mutation, and human RTN3245–264 isoform e into upstream of the sequence encoding Atg8 K26P of pGEX6P-Atg8 (the K26P mutation was introduced for stabilizing Atg8) or upstream of the sequence encoding GABARAP of pGEX6P-GABARAP (with the F3S V4T mutations for enhancing crystallization). .. For phase-separation experiments, the mCherry and BNDL1 , sequences were inserted into upstream and downstream of the ATG8 gen e in pGEX6P-Atg8 K26P, respectively. pGEX-SNAP-40C was constructed by the removal of the HRV 3C protease recognition site and the insertion of the SNAP sequence from pSNAP-tag(T7) vector (New England Biolabs) with a linker (Gly–Gly–Gly–Ser–Gly–Gly–Gly) and Atg40194–256 following a linker (Ser–Ala–Ser–Ser) to upstream and downstream of GST in pGEX6P-1 vector, respectively. ..

    Polymerase Chain Reaction:

    Article Title: High-Performance Binary Protein Interaction Screening in a Microfluidic Format
    Article Snippet: .. One microgram of p-SNAP-tag (T7) plasmid vector (NEB) and linear PCR products of S100A1, S100B, or eGFP were subjected to restriction using SbfI and BamHI (Open Biosystems). .. After a 1-h incubation at 37 °C, the sample was subjected to QIAGEN MinElute Reaction Cleanup Kit.

    Article Title: Tet Proteins Regulate Neutrophil Granulation in Zebrafish through Demethylation of socs3b mRNA
    Article Snippet: Editing was assessed using a T7 endonuclease assay (NEB labs) per manufacturer instructions in pooled groups of 10 embryos. .. PCR primers for the T7 assay are provided in . .. WT and mutant socs3b RNA synthesis and microinjection Zebrafish csf3a and socs3b were cloned from cDNA generated from 2 dpf wild-type neutrophils.

    Article Title: The bacterial virulence factors VopL and VopF nucleate actin from the pointed end
    Article Snippet: Plasmid construction VopL/F constructs were prepared by infusion (Takara Bio Inc.) after PCR amplification (iProof; Bio-Rad Laboratories) from plasmid DNA for VopL and from codon-optimized plasmid DNA for VopF (provided by E. Kerkhoff, University of Regensburg, Regensburg, Germany), with a 6xHis tag included in the reverse primer. .. PCR products were cloned into the SNAP-tag-T7-2vector (New England Biolabs, Inc.) at the XmaI/PacI sites, but the PacI site is not maintained. .. A flexible linker (GGSGGS) was included in the forward primer sequences of the SNAP constructs between the SNAP and the VopL/F DNA sequences.

    Clone Assay:

    Article Title: The bacterial virulence factors VopL and VopF nucleate actin from the pointed end
    Article Snippet: Plasmid construction VopL/F constructs were prepared by infusion (Takara Bio Inc.) after PCR amplification (iProof; Bio-Rad Laboratories) from plasmid DNA for VopL and from codon-optimized plasmid DNA for VopF (provided by E. Kerkhoff, University of Regensburg, Regensburg, Germany), with a 6xHis tag included in the reverse primer. .. PCR products were cloned into the SNAP-tag-T7-2vector (New England Biolabs, Inc.) at the XmaI/PacI sites, but the PacI site is not maintained. .. A flexible linker (GGSGGS) was included in the forward primer sequences of the SNAP constructs between the SNAP and the VopL/F DNA sequences.

    Countercurrent Chromatography:

    Article Title: Protein-Protein Interaction Inhibition (2P2I)-Oriented Chemical Library Accelerates Hit Discovery.
    Article Snippet: For the cloning of methyltransferase domain of non-structural protein 5 (MTase NS5) we used a modified Gateway® pDEST™17 Vector (Life technologies) (insertion of an XhoI restriction site between His tag and attR1 site by site directed mutagenesis). .. SNAP-tag previously amplified from pSNAP-tag® (T7)-2 Vector (New England Biolabs) (forward primer: GGG GCT CGA GTT ATG GAC AAA GAT TGC GAA ATG AAA C, reverse primer: ATA TAC TCG AGT CCC AGA CCC GGT TTA CCC AG) was inserted by restriction ligation in XhoI site. .. The coding sequence of MTaseNS5 DV3 amplified (forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAAACCTGTACTTCCAGGGTGGTACAG GTAGCCAGGGTG, reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTAATGACGGGTGCCTGCACCCAG) from the synthetic gene was then sub cloned in this vector by Gateway® recombination (Life technologies) resulting in a MTase NS5 fused with His and SNAP-tag on the N-terminal part.

    Ligation:

    Article Title: Protein-Protein Interaction Inhibition (2P2I)-Oriented Chemical Library Accelerates Hit Discovery.
    Article Snippet: For the cloning of methyltransferase domain of non-structural protein 5 (MTase NS5) we used a modified Gateway® pDEST™17 Vector (Life technologies) (insertion of an XhoI restriction site between His tag and attR1 site by site directed mutagenesis). .. SNAP-tag previously amplified from pSNAP-tag® (T7)-2 Vector (New England Biolabs) (forward primer: GGG GCT CGA GTT ATG GAC AAA GAT TGC GAA ATG AAA C, reverse primer: ATA TAC TCG AGT CCC AGA CCC GGT TTA CCC AG) was inserted by restriction ligation in XhoI site. .. The coding sequence of MTaseNS5 DV3 amplified (forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAAACCTGTACTTCCAGGGTGGTACAG GTAGCCAGGGTG, reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTAATGACGGGTGCCTGCACCCAG) from the synthetic gene was then sub cloned in this vector by Gateway® recombination (Life technologies) resulting in a MTase NS5 fused with His and SNAP-tag on the N-terminal part.

    Expressing:

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: Combining these approaches with an imaging scheme that alternates line by line between different excitation beams to acquire two STED images quasi-simultaneously, we report the first example of two-color STED microscopy in living cells. .. 2.1 Expression Constructs pSNAPf -tag(T7) and pCLIPf -tag(T7) were constructed by replacing the SNAP-26m coding region of pSNAP-tag(T7)-2 (New England Biolabs) using the unique EcoRI and SbfI sites with the coding regions of SNAPf and CLIPf , respectively. .. The mouse EGF coding sequence was fused in-frame to the 5′ end of CLIPf , and a 6-histidine tag fused to the 3′ end of CLIPf in pCLIPf -tag(T7).

    Construct:

    Article Title: Two-color STED microscopy in living cells
    Article Snippet: Combining these approaches with an imaging scheme that alternates line by line between different excitation beams to acquire two STED images quasi-simultaneously, we report the first example of two-color STED microscopy in living cells. .. 2.1 Expression Constructs pSNAPf -tag(T7) and pCLIPf -tag(T7) were constructed by replacing the SNAP-26m coding region of pSNAP-tag(T7)-2 (New England Biolabs) using the unique EcoRI and SbfI sites with the coding regions of SNAPf and CLIPf , respectively. .. The mouse EGF coding sequence was fused in-frame to the 5′ end of CLIPf , and a 6-histidine tag fused to the 3′ end of CLIPf in pCLIPf -tag(T7).

    Article Title: Super-assembly of ER-phagy receptor Atg40 induces local ER remodeling at contacts with forming autophagosomal membranes
    Article Snippet: Plasmids for expression of fusion proteins for crystallization were constructed by inserting the genes encoding Atg40237–252 , human FAM134B450–468 , human SEC62361–376 with the T367D mutation, and human RTN3245–264 isoform e into upstream of the sequence encoding Atg8 K26P of pGEX6P-Atg8 (the K26P mutation was introduced for stabilizing Atg8) or upstream of the sequence encoding GABARAP of pGEX6P-GABARAP (with the F3S V4T mutations for enhancing crystallization). .. For phase-separation experiments, the mCherry and BNDL1 , sequences were inserted into upstream and downstream of the ATG8 gen e in pGEX6P-Atg8 K26P, respectively. pGEX-SNAP-40C was constructed by the removal of the HRV 3C protease recognition site and the insertion of the SNAP sequence from pSNAP-tag(T7) vector (New England Biolabs) with a linker (Gly–Gly–Gly–Ser–Gly–Gly–Gly) and Atg40194–256 following a linker (Ser–Ala–Ser–Ser) to upstream and downstream of GST in pGEX6P-1 vector, respectively. ..

    Sequencing:

    Article Title: Super-assembly of ER-phagy receptor Atg40 induces local ER remodeling at contacts with forming autophagosomal membranes
    Article Snippet: Plasmids for expression of fusion proteins for crystallization were constructed by inserting the genes encoding Atg40237–252 , human FAM134B450–468 , human SEC62361–376 with the T367D mutation, and human RTN3245–264 isoform e into upstream of the sequence encoding Atg8 K26P of pGEX6P-Atg8 (the K26P mutation was introduced for stabilizing Atg8) or upstream of the sequence encoding GABARAP of pGEX6P-GABARAP (with the F3S V4T mutations for enhancing crystallization). .. For phase-separation experiments, the mCherry and BNDL1 , sequences were inserted into upstream and downstream of the ATG8 gen e in pGEX6P-Atg8 K26P, respectively. pGEX-SNAP-40C was constructed by the removal of the HRV 3C protease recognition site and the insertion of the SNAP sequence from pSNAP-tag(T7) vector (New England Biolabs) with a linker (Gly–Gly–Gly–Ser–Gly–Gly–Gly) and Atg40194–256 following a linker (Ser–Ala–Ser–Ser) to upstream and downstream of GST in pGEX6P-1 vector, respectively. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    New England Biolabs psnap tag t7 2
    Psnap Tag T7 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psnap tag t7 2/product/New England Biolabs
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psnap tag t7 2 - by Bioz Stars, 2021-04
    97/100 stars
      Buy from Supplier

    Image Search Results