pmal c2 expression vector  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    pMAL c5X Vector
    Description:
    pMAL c5X Vector 10 ug
    Catalog Number:
    n8108s
    Price:
    131
    Size:
    10 ug
    Category:
    E coli Expression Vectors
    Buy from Supplier


    Structured Review

    New England Biolabs pmal c2 expression vector
    pMAL c5X Vector
    pMAL c5X Vector 10 ug
    https://www.bioz.com/result/pmal c2 expression vector/product/New England Biolabs
    Average 90 stars, based on 159 article reviews
    Price from $9.99 to $1999.99
    pmal c2 expression vector - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Acetylene Reduction Assay:

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: ATP, UTP, CTP, GTP, 3′-dUTP, 3′-dATP, 3′-dGTP, 3′-dCTP, 2′-dATP, 2′-dCTP, 2′-dGTP, 2′-dTTP, 2′-F-CTP, 2′-F-GTP, 2′-NH2 -GTP, 2′-NH2 -CTP, 2′-F-ATP, 2′-F-UTP, ara-GTP, ara-ATP, 7-deaza-ATP, ara-CTP, ara-UTP, 2′-azido-GTP, and 2′-azido-CTP were purchased as 100 mM solutions from TriLink Biotechnologies (San Diego, CA). .. The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA).

    Centrifugation:

    Article Title: The Type Three Secretion System 2-Encoded Regulator EtrB Modulates Enterohemorrhagic Escherichia coli Virulence Gene Expression
    Article Snippet: The EtrB protein was fused with the maltose-binding protein (MBP) using a pMAL-C5x vector (NEB) with the restriction enzymes NcoI and SbfI (NEB) to create pDL02. .. Cells were then pelleted by centrifugation at 4,000 × g for 10 min and resuspended in column buffer (20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA).

    Amplification:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: .. Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Article Title: A group II intron-encoded protein interacts with the cellular replicative machinery through the β-sliding clamp
    Article Snippet: Plasmid constructs For the construction of pMalFlagIEP, a NotI fragment containing the IEP tagged with 3xFlag was obtained by the NotI digestion of pCEP4FlagIEP ( ) and inserted into the pMAL-c5X vector (New England Biolabs) digested with NotI enzyme and dephosphorylated. .. Flag was then added back to the plasmid as a polymerase chain reaction (PCR) fragment amplified with the oligomers 5′-ACAAGGATGACGATGACAAGACTATAGGCCAATTCGCCCTATA-3′ (GmS-Flg) and CTTGTCATCGTCATCCTTGT (GmS4S-Flg).

    Article Title: Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase. Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase
    Article Snippet: .. The amplified fragment was subcloned into the pMAL‐c5X vector (New England Biolabs) following the manufacturer's instruction. ..

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: .. In brief, ORFs of ScATG4 , HsATG4B , AtATG4a (AT2G44140), and SlATG4 (Solyc01g006230) were amplified and cloned into pMal-C2 expression vector (NEW ENGLAND BIOLABS, current version of this vector is pMal-c5X, N8108), resulting in maltose binding protein (MBP)-ATG4. .. For synthetic substrates, ScATG8 , HsLC3A , AtATG8a (AT4G21980), and SlATG8a (Solyc07g064680) ORFs were amplified and cloned into BamHI (NEW ENGLAND BIOLABS, R0136S) and SalI (NEW ENGLAND BIOLABS, R0138S)-restricted pET28-Citrine-ShR plasmid.

    Article Title: Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W]Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W] [OPEN]
    Article Snippet: The amplified product was purified and cloned into the pCR4-blunt TOPO vector (Life Technologies) and confirmed by sequencing. .. An fusion construct was assembled in pMAL-c5X vector (NEB) using an Infusion strategy (Clontech) by linearizing the vector with Xmn I and Eco ).

    Article Title: A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1 [OPEN]
    Article Snippet: The HY5 coding sequence was amplified and ligated into pEASY-Blunt to generate pEASY-HY5. .. The HY5 fragment was released from pEASY-HY5 (cut with Eco RI and Xho I) and cloned into the Eco RI- Xho I sites of the modified pMAL-c5X vector (New England Biolabs), resulting in MBP-HY5.

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: Plasmid Expression Vectors cDNA encoding human ANGPTL8 (hBT) protein without the signal peptide (a.a. 22–197) was amplified by PCR. .. Maltose binding protein (MBP) (a.a.1-367) was produced using pMal-c5x vector (New England BioLabs Inc., Ipswich, MA).

    Binding Assay:

    Article Title: Soybean GmDREBL Increases Lipid Content in Seeds of Transgenic Arabidopsis
    Article Snippet: .. Gel-shift assay The recombinant protein of maltose binding protein–GmDREBL was expressed in Escherichia coli BL21 using pMAL-c5x vector and purified from cells using Amylose Resin (NEB). ..

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: .. In brief, ORFs of ScATG4 , HsATG4B , AtATG4a (AT2G44140), and SlATG4 (Solyc01g006230) were amplified and cloned into pMal-C2 expression vector (NEW ENGLAND BIOLABS, current version of this vector is pMal-c5X, N8108), resulting in maltose binding protein (MBP)-ATG4. .. For synthetic substrates, ScATG8 , HsLC3A , AtATG8a (AT4G21980), and SlATG8a (Solyc07g064680) ORFs were amplified and cloned into BamHI (NEW ENGLAND BIOLABS, R0136S) and SalI (NEW ENGLAND BIOLABS, R0138S)-restricted pET28-Citrine-ShR plasmid.

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: .. Maltose binding protein (MBP) (a.a.1-367) was produced using pMal-c5x vector (New England BioLabs Inc., Ipswich, MA). .. Plasmid encoding MBP+hBT protein was a gift from Evotec A.G. (Hamburg, Germany).

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression. .. To reduce the affinity of MBP for endogenous ligands and allow subsequent testing of maltose binding, we introduced a point mutation, W340A , in all constructs.

    Clone Assay:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: An In-Fusion HD cloning kit and Stellar competent cells were purchased from Clontech (Mountain View, CA). .. The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA).

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: .. In brief, ORFs of ScATG4 , HsATG4B , AtATG4a (AT2G44140), and SlATG4 (Solyc01g006230) were amplified and cloned into pMal-C2 expression vector (NEW ENGLAND BIOLABS, current version of this vector is pMal-c5X, N8108), resulting in maltose binding protein (MBP)-ATG4. .. For synthetic substrates, ScATG8 , HsLC3A , AtATG8a (AT4G21980), and SlATG8a (Solyc07g064680) ORFs were amplified and cloned into BamHI (NEW ENGLAND BIOLABS, R0136S) and SalI (NEW ENGLAND BIOLABS, R0138S)-restricted pET28-Citrine-ShR plasmid.

    Article Title: Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W]Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W] [OPEN]
    Article Snippet: The amplified product was purified and cloned into the pCR4-blunt TOPO vector (Life Technologies) and confirmed by sequencing. .. An fusion construct was assembled in pMAL-c5X vector (NEB) using an Infusion strategy (Clontech) by linearizing the vector with Xmn I and Eco ).

    Article Title: Post-transcriptional regulation of transcript abundance by a conserved member of the tristetraprolin family in Candida albicans
    Article Snippet: .. Full-length C. albicans ZFS1 (orf19.5334) was cloned using the NotI and BamHI sites of a modified pMAL-c5x vector (New England Biolabs), as described in , and was expressed as a fusion protein with maltose-binding protein linked to the N-terminus of Zfs1 (Zfs1:MBP) by a three alanine linker. .. The recombinant fusion protein was expressed in BL21 (DE3) cells after induction with 0.3 mM IPTG for 16 h at 20°C.

    Article Title: A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1 [OPEN]
    Article Snippet: .. The HY5 fragment was released from pEASY-HY5 (cut with Eco RI and Xho I) and cloned into the Eco RI- Xho I sites of the modified pMAL-c5X vector (New England Biolabs), resulting in MBP-HY5. .. The plasmids of AD-HY5, AD-HY5N, AD-HY5C, AD-PIF1, AD-PIF3, His-HY5, YFPC -HY5, GAL4:LUC, and 35S:GUS were produced as described previously ( ; ; ). pEASY-BBX23 was cut with Xba I and Bam HI to release the BBX23 fragment, which was then ligated into the Xba I- Bam HI site of pCAMBIA-nFlag, giving rise to 35S:Flag-BBX23.

    Construct:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. After validation of its integrity, the construct was introduced into Escherichia coli BL21(DE3)pLysS cells (TransGen Biotech, Beijing) for protein expression.

    Article Title: A group II intron-encoded protein interacts with the cellular replicative machinery through the β-sliding clamp
    Article Snippet: .. Plasmid constructs For the construction of pMalFlagIEP, a NotI fragment containing the IEP tagged with 3xFlag was obtained by the NotI digestion of pCEP4FlagIEP ( ) and inserted into the pMAL-c5X vector (New England Biolabs) digested with NotI enzyme and dephosphorylated. .. We obtained pMALFlagIEPΔORF in a similar manner, but using a NotI fragment from pCEP4FlagIEPΔORF ( ). pGmS4S2095-Fmal is a derivative of pGmS4S2095 ( ) in which the IEP has been replaced by the fusion protein MBP-FlagIEP (MF-IEP) sequence in the form of a SpeI-AatII fragment from pMALFlagIEP. pGmS4S-Fmal is a derivative of pGmS4S ( ) in which the IEP has been replaced by the MF-IEP sequence as a SpeI-AatII fragment from pMALFlagIEP.

    Article Title: An Engineered Palette of Metal Ion Quenchable Fluorescent Proteins
    Article Snippet: Plasmids EBFP2 (pBad-EBFP2, #14891), mVenus (mVenus-N1, #27793), and mApple (Myo1E-pmAppleC1, #27698) constructs were from addgene. mEmerald (mEmerald-C1) and mCerulean3 (pmCerulean3-C1) constructs were generous gifts provided by John Hammer (Laboratory of Cell Biology, National Heart Lung and Blood Institute, National Institutes of Health) and Mark Rizzo (School of Medicine, University of Maryland), respectively. mKate2 (pmKate2-C) construct was purchased from Evrogen. .. All these FP genes were subcloned into the pMAL-c5x vector (New England Biolabs).

    Article Title: Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W]Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W] [OPEN]
    Article Snippet: .. An fusion construct was assembled in pMAL-c5X vector (NEB) using an Infusion strategy (Clontech) by linearizing the vector with Xmn I and Eco ). .. A single colony of NEB expression Escherichia coli harboring the pMAL-c5X vector alone or the positive vector containing Zm 4 fusion was used to inoculate an overnight starter culture in 4 mL of Luria-Bertani broth incubated at 37°C with vigorous shaking.

    Article Title: A Rapid Induction Mechanism for Lin28a in Trophic Responses
    Article Snippet: MBP-Lin28a in the pMAL-c5X vector was expressed in BL21 bacteria and purified as described, but rotated with amylose resin (NEB E80215). .. Equal amounts of purified Lin28a protein taken from the same protein aliquot were added to each Sepharose-bound GST construct and rotated at 4°C for 2 hr.

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: Paragraph title: Constructs, cell culture, and transfection ... The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression.

    IA:

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA). .. Fluorescently labeled RNA (Cy5.5-RNA) and unlabeled DNA oligonucleotides were chemically synthesized and purified by high-performance liquid chromatography by Integrated DNA Technologies (Coralville, IA).

    Incubation:

    Article Title: Post-transcriptional regulation of transcript abundance by a conserved member of the tristetraprolin family in Candida albicans
    Article Snippet: Full-length C. albicans ZFS1 (orf19.5334) was cloned using the NotI and BamHI sites of a modified pMAL-c5x vector (New England Biolabs), as described in , and was expressed as a fusion protein with maltose-binding protein linked to the N-terminus of Zfs1 (Zfs1:MBP) by a three alanine linker. .. The resulting supernatants were incubated for 1 h at 4°C with amylose resin (New England Biolabs).

    Activity Assay:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: .. Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Expressing:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: .. Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Article Title: The Type Three Secretion System 2-Encoded Regulator EtrB Modulates Enterohemorrhagic Escherichia coli Virulence Gene Expression
    Article Snippet: The EtrB protein was fused with the maltose-binding protein (MBP) using a pMAL-C5x vector (NEB) with the restriction enzymes NcoI and SbfI (NEB) to create pDL02. .. Isopropyl-β- d -thiogalactopyranoside (IPTG) was added to a final concentration of 0.3 M, and protein expression was induced overnight at 16°C.

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: .. In brief, ORFs of ScATG4 , HsATG4B , AtATG4a (AT2G44140), and SlATG4 (Solyc01g006230) were amplified and cloned into pMal-C2 expression vector (NEW ENGLAND BIOLABS, current version of this vector is pMal-c5X, N8108), resulting in maltose binding protein (MBP)-ATG4. .. For synthetic substrates, ScATG8 , HsLC3A , AtATG8a (AT4G21980), and SlATG8a (Solyc07g064680) ORFs were amplified and cloned into BamHI (NEW ENGLAND BIOLABS, R0136S) and SalI (NEW ENGLAND BIOLABS, R0138S)-restricted pET28-Citrine-ShR plasmid.

    Article Title: Post-transcriptional regulation of transcript abundance by a conserved member of the tristetraprolin family in Candida albicans
    Article Snippet: Paragraph title: Expression and purification of recombinant Zfs1 ... Full-length C. albicans ZFS1 (orf19.5334) was cloned using the NotI and BamHI sites of a modified pMAL-c5x vector (New England Biolabs), as described in , and was expressed as a fusion protein with maltose-binding protein linked to the N-terminus of Zfs1 (Zfs1:MBP) by a three alanine linker.

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: Paragraph title: Plasmid Expression Vectors ... Maltose binding protein (MBP) (a.a.1-367) was produced using pMal-c5x vector (New England BioLabs Inc., Ipswich, MA).

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: .. The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression. .. To reduce the affinity of MBP for endogenous ligands and allow subsequent testing of maltose binding, we introduced a point mutation, W340A , in all constructs.

    Modification:

    Article Title: Post-transcriptional regulation of transcript abundance by a conserved member of the tristetraprolin family in Candida albicans
    Article Snippet: .. Full-length C. albicans ZFS1 (orf19.5334) was cloned using the NotI and BamHI sites of a modified pMAL-c5x vector (New England Biolabs), as described in , and was expressed as a fusion protein with maltose-binding protein linked to the N-terminus of Zfs1 (Zfs1:MBP) by a three alanine linker. .. The recombinant fusion protein was expressed in BL21 (DE3) cells after induction with 0.3 mM IPTG for 16 h at 20°C.

    Article Title: A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1 [OPEN]
    Article Snippet: .. The HY5 fragment was released from pEASY-HY5 (cut with Eco RI and Xho I) and cloned into the Eco RI- Xho I sites of the modified pMAL-c5X vector (New England Biolabs), resulting in MBP-HY5. .. The plasmids of AD-HY5, AD-HY5N, AD-HY5C, AD-PIF1, AD-PIF3, His-HY5, YFPC -HY5, GAL4:LUC, and 35S:GUS were produced as described previously ( ; ; ). pEASY-BBX23 was cut with Xba I and Bam HI to release the BBX23 fragment, which was then ligated into the Xba I- Bam HI site of pCAMBIA-nFlag, giving rise to 35S:Flag-BBX23.

    Transformation Assay:

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: In brief, ORFs of ScATG4 , HsATG4B , AtATG4a (AT2G44140), and SlATG4 (Solyc01g006230) were amplified and cloned into pMal-C2 expression vector (NEW ENGLAND BIOLABS, current version of this vector is pMal-c5X, N8108), resulting in maltose binding protein (MBP)-ATG4. .. Plasmids of (HIS)6 -C-ATG8-ShR synthetic substrates and MBP-ATG4 were transformed into E. coli strain BL21 (DE3).

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: Maltose binding protein (MBP) (a.a.1-367) was produced using pMal-c5x vector (New England BioLabs Inc., Ipswich, MA). .. The plasmids were transformed into NEB express E .coli ER2523 (New England BioLabs Inc.) for protein expression.

    High Performance Liquid Chromatography:

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA). .. Fluorescently labeled RNA (Cy5.5-RNA) and unlabeled DNA oligonucleotides were chemically synthesized and purified by high-performance liquid chromatography by Integrated DNA Technologies (Coralville, IA).

    Transfection:

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: Paragraph title: Constructs, cell culture, and transfection ... The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression.

    Ligation:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Protease Inhibitor:

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: LB medium, bovine serum albumin (BSA), NaCl, Triton X-100, glycerol, protease inhibitor cocktail, Tris-HCl (pH 7.5), and HisPur Ni-NTA agarose resin were purchased from Thermo Fisher Scientific (Waltham, MA). .. The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA).

    Synthesized:

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA). .. Fluorescently labeled RNA (Cy5.5-RNA) and unlabeled DNA oligonucleotides were chemically synthesized and purified by high-performance liquid chromatography by Integrated DNA Technologies (Coralville, IA).

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression. .. FLAG-MBP cDNA was synthesized by Bio Basic (Amherst, NY).

    Cell Culture:

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: Paragraph title: Constructs, cell culture, and transfection ... The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression.

    Generated:

    Article Title: An Engineered Palette of Metal Ion Quenchable Fluorescent Proteins
    Article Snippet: All these FP genes were subcloned into the pMAL-c5x vector (New England Biolabs). .. The iq-FP constructs were generated by using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies).

    Polymerase Chain Reaction:

    Article Title: A group II intron-encoded protein interacts with the cellular replicative machinery through the β-sliding clamp
    Article Snippet: Plasmid constructs For the construction of pMalFlagIEP, a NotI fragment containing the IEP tagged with 3xFlag was obtained by the NotI digestion of pCEP4FlagIEP ( ) and inserted into the pMAL-c5X vector (New England Biolabs) digested with NotI enzyme and dephosphorylated. .. Flag was then added back to the plasmid as a polymerase chain reaction (PCR) fragment amplified with the oligomers 5′-ACAAGGATGACGATGACAAGACTATAGGCCAATTCGCCCTATA-3′ (GmS-Flg) and CTTGTCATCGTCATCCTTGT (GmS4S-Flg).

    Article Title: Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase. Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase
    Article Snippet: 2.6 Preparation and purification of recombinant proteins Full‐length ORF sequences of OsGS1 and OsGS2 were amplified by PCR using Prime Star DNA polymerase (TaKaRa Bio), “Nipponbare” cDNA as the template, and the primer sets, GS1.proF and GS1.proR, or GS2.proF and GS2.proR (Table ). .. The amplified fragment was subcloned into the pMAL‐c5X vector (New England Biolabs) following the manufacturer's instruction.

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: Plasmid Expression Vectors cDNA encoding human ANGPTL8 (hBT) protein without the signal peptide (a.a. 22–197) was amplified by PCR. .. Maltose binding protein (MBP) (a.a.1-367) was produced using pMal-c5x vector (New England BioLabs Inc., Ipswich, MA).

    Sonication:

    Article Title: A Rapid Induction Mechanism for Lin28a in Trophic Responses
    Article Snippet: Cultures were centrifuged at 4,000 × g for 20 min at 4°C and lysed in phosphate-buffered saline (PBS) pH = 7.8 with lysozyme (0.5 mg/ml) for 30 min, followed by sonication 5 times with 20 s pulses at 20% amplitude. .. MBP-Lin28a in the pMAL-c5X vector was expressed in BL21 bacteria and purified as described, but rotated with amylose resin (NEB E80215).

    Recombinant:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: .. Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Article Title: Soybean GmDREBL Increases Lipid Content in Seeds of Transgenic Arabidopsis
    Article Snippet: .. Gel-shift assay The recombinant protein of maltose binding protein–GmDREBL was expressed in Escherichia coli BL21 using pMAL-c5x vector and purified from cells using Amylose Resin (NEB). ..

    Article Title: Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase. Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase
    Article Snippet: Paragraph title: Preparation and purification of recombinant proteins ... The amplified fragment was subcloned into the pMAL‐c5X vector (New England Biolabs) following the manufacturer's instruction.

    Article Title: Post-transcriptional regulation of transcript abundance by a conserved member of the tristetraprolin family in Candida albicans
    Article Snippet: Paragraph title: Expression and purification of recombinant Zfs1 ... Full-length C. albicans ZFS1 (orf19.5334) was cloned using the NotI and BamHI sites of a modified pMAL-c5x vector (New England Biolabs), as described in , and was expressed as a fusion protein with maltose-binding protein linked to the N-terminus of Zfs1 (Zfs1:MBP) by a three alanine linker.

    Article Title: A Rapid Induction Mechanism for Lin28a in Trophic Responses
    Article Snippet: Paragraph title: Purification and pull-down of recombinant bacterial proteins ... MBP-Lin28a in the pMAL-c5X vector was expressed in BL21 bacteria and purified as described, but rotated with amylose resin (NEB E80215).

    Mutagenesis:

    Article Title: An Engineered Palette of Metal Ion Quenchable Fluorescent Proteins
    Article Snippet: All these FP genes were subcloned into the pMAL-c5x vector (New England Biolabs). .. The iq-FP constructs were generated by using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies).

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression. .. To reduce the affinity of MBP for endogenous ligands and allow subsequent testing of maltose binding, we introduced a point mutation, W340A , in all constructs.

    Isolation:

    Article Title: Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W]Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W] [OPEN]
    Article Snippet: Paragraph title: Isolation of the Maize Embryo-Specific Zm 4 ... An fusion construct was assembled in pMAL-c5X vector (NEB) using an Infusion strategy (Clontech) by linearizing the vector with Xmn I and Eco ).

    Labeling:

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA). .. Fluorescently labeled RNA (Cy5.5-RNA) and unlabeled DNA oligonucleotides were chemically synthesized and purified by high-performance liquid chromatography by Integrated DNA Technologies (Coralville, IA).

    Purification:

    Article Title: The Type Three Secretion System 2-Encoded Regulator EtrB Modulates Enterohemorrhagic Escherichia coli Virulence Gene Expression
    Article Snippet: Paragraph title: Purification of EtrB and QseA. ... The EtrB protein was fused with the maltose-binding protein (MBP) using a pMAL-C5x vector (NEB) with the restriction enzymes NcoI and SbfI (NEB) to create pDL02.

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA). .. Fluorescently labeled RNA (Cy5.5-RNA) and unlabeled DNA oligonucleotides were chemically synthesized and purified by high-performance liquid chromatography by Integrated DNA Technologies (Coralville, IA).

    Article Title: Soybean GmDREBL Increases Lipid Content in Seeds of Transgenic Arabidopsis
    Article Snippet: .. Gel-shift assay The recombinant protein of maltose binding protein–GmDREBL was expressed in Escherichia coli BL21 using pMAL-c5x vector and purified from cells using Amylose Resin (NEB). ..

    Article Title: Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase. Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase
    Article Snippet: Paragraph title: Preparation and purification of recombinant proteins ... The amplified fragment was subcloned into the pMAL‐c5X vector (New England Biolabs) following the manufacturer's instruction.

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: Paragraph title: Plasmid construction and purification of ATG4s and ATG8 synthetic substrates ... In brief, ORFs of ScATG4 , HsATG4B , AtATG4a (AT2G44140), and SlATG4 (Solyc01g006230) were amplified and cloned into pMal-C2 expression vector (NEW ENGLAND BIOLABS, current version of this vector is pMal-c5X, N8108), resulting in maltose binding protein (MBP)-ATG4.

    Article Title: Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W]Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W] [OPEN]
    Article Snippet: The amplified product was purified and cloned into the pCR4-blunt TOPO vector (Life Technologies) and confirmed by sequencing. .. An fusion construct was assembled in pMAL-c5X vector (NEB) using an Infusion strategy (Clontech) by linearizing the vector with Xmn I and Eco ).

    Article Title: Post-transcriptional regulation of transcript abundance by a conserved member of the tristetraprolin family in Candida albicans
    Article Snippet: Paragraph title: Expression and purification of recombinant Zfs1 ... Full-length C. albicans ZFS1 (orf19.5334) was cloned using the NotI and BamHI sites of a modified pMAL-c5x vector (New England Biolabs), as described in , and was expressed as a fusion protein with maltose-binding protein linked to the N-terminus of Zfs1 (Zfs1:MBP) by a three alanine linker.

    Article Title: A Rapid Induction Mechanism for Lin28a in Trophic Responses
    Article Snippet: .. MBP-Lin28a in the pMAL-c5X vector was expressed in BL21 bacteria and purified as described, but rotated with amylose resin (NEB E80215). .. Lin28a was cleaved from the amylose-bound MBP tag with factor Xa protease (NEB P8010).

    Protein Purification:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: .. Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Sequencing:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: .. Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Article Title: A group II intron-encoded protein interacts with the cellular replicative machinery through the β-sliding clamp
    Article Snippet: Plasmid constructs For the construction of pMalFlagIEP, a NotI fragment containing the IEP tagged with 3xFlag was obtained by the NotI digestion of pCEP4FlagIEP ( ) and inserted into the pMAL-c5X vector (New England Biolabs) digested with NotI enzyme and dephosphorylated. .. We obtained pMALFlagIEPΔORF in a similar manner, but using a NotI fragment from pCEP4FlagIEPΔORF ( ). pGmS4S2095-Fmal is a derivative of pGmS4S2095 ( ) in which the IEP has been replaced by the fusion protein MBP-FlagIEP (MF-IEP) sequence in the form of a SpeI-AatII fragment from pMALFlagIEP. pGmS4S-Fmal is a derivative of pGmS4S ( ) in which the IEP has been replaced by the MF-IEP sequence as a SpeI-AatII fragment from pMALFlagIEP.

    Article Title: Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase. Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase
    Article Snippet: The reverse primers contained a recognition sequence for SbfI (GGACGTCC) at the 5′ end. .. The amplified fragment was subcloned into the pMAL‐c5X vector (New England Biolabs) following the manufacturer's instruction.

    Article Title: Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W]Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W] [OPEN]
    Article Snippet: The amplified product was purified and cloned into the pCR4-blunt TOPO vector (Life Technologies) and confirmed by sequencing. .. An fusion construct was assembled in pMAL-c5X vector (NEB) using an Infusion strategy (Clontech) by linearizing the vector with Xmn I and Eco ).

    Article Title: A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1 [OPEN]
    Article Snippet: The HY5 coding sequence was amplified and ligated into pEASY-Blunt to generate pEASY-HY5. .. The HY5 fragment was released from pEASY-HY5 (cut with Eco RI and Xho I) and cloned into the Eco RI- Xho I sites of the modified pMAL-c5X vector (New England Biolabs), resulting in MBP-HY5.

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: .. The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression. .. To reduce the affinity of MBP for endogenous ligands and allow subsequent testing of maltose binding, we introduced a point mutation, W340A , in all constructs.

    Electrophoretic Mobility Shift Assay:

    Article Title: Soybean GmDREBL Increases Lipid Content in Seeds of Transgenic Arabidopsis
    Article Snippet: .. Gel-shift assay The recombinant protein of maltose binding protein–GmDREBL was expressed in Escherichia coli BL21 using pMAL-c5x vector and purified from cells using Amylose Resin (NEB). ..

    Bradford Protein Assay:

    Article Title: A Rapid Induction Mechanism for Lin28a in Trophic Responses
    Article Snippet: MBP-Lin28a in the pMAL-c5X vector was expressed in BL21 bacteria and purified as described, but rotated with amylose resin (NEB E80215). .. Purified protein concentrations were determined by Bradford Protein Assay, and equivalent amounts of GST-TRBPWT, GST-TRBPSΔD, and GST alone were re-bound to glutathione Sepharose beads by rotation at 4°C for 2 hr.

    Nested PCR:

    Article Title: Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase. Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase
    Article Snippet: The OsGS3 full‐length sequence was amplified by nested PCR using the following primer sets: step 1, GS3.seqF and GS3.proR; step 2, GS3.proF and GS3.proR. .. The amplified fragment was subcloned into the pMAL‐c5X vector (New England Biolabs) following the manufacturer's instruction.

    Plasmid Preparation:

    Article Title: Molecular characterization of flavanone 3-hydroxylase gene and flavonoid accumulation in two chemotyped safflower lines in response to methyl jasmonate stimulation
    Article Snippet: .. Expression of recombinant Ct F3H protein, purification, and activity assay The coding region of Ct F3H was amplified from the pMD19 (Takara) into the pMAL-C5x vector (NEB, New England) by using KOD DNA polymerase (Toyobo, Japan) and the primer pair Ct F3H-F/R (forward: 5′-CAAAGAACGTGCcatatgAAACCTAT-3′ with an added NdeI restriction site; reverse: 5′-TCTTAAGCAGATATTTTCTCGATGGGT-3′with an added EcoRI restriction site), which were designed from the sequence of Ct F3H mRNA submitted by our laboratory (GenBank accession no. AEG64806.1). .. The amplified product was sequenced and then digested with restriction enzymes (NEB, New England) to facilitate ligation with the appropriate cloning site of the linearized plasmid pMAL-C5x encoding a maltose-binding protein (MBP).

    Article Title: A group II intron-encoded protein interacts with the cellular replicative machinery through the β-sliding clamp
    Article Snippet: .. Plasmid constructs For the construction of pMalFlagIEP, a NotI fragment containing the IEP tagged with 3xFlag was obtained by the NotI digestion of pCEP4FlagIEP ( ) and inserted into the pMAL-c5X vector (New England Biolabs) digested with NotI enzyme and dephosphorylated. .. We obtained pMALFlagIEPΔORF in a similar manner, but using a NotI fragment from pCEP4FlagIEPΔORF ( ). pGmS4S2095-Fmal is a derivative of pGmS4S2095 ( ) in which the IEP has been replaced by the fusion protein MBP-FlagIEP (MF-IEP) sequence in the form of a SpeI-AatII fragment from pMALFlagIEP. pGmS4S-Fmal is a derivative of pGmS4S ( ) in which the IEP has been replaced by the MF-IEP sequence as a SpeI-AatII fragment from pMALFlagIEP.

    Article Title: An Engineered Palette of Metal Ion Quenchable Fluorescent Proteins
    Article Snippet: .. All these FP genes were subcloned into the pMAL-c5x vector (New England Biolabs). .. The iq-FP constructs were generated by using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies).

    Article Title: The Type Three Secretion System 2-Encoded Regulator EtrB Modulates Enterohemorrhagic Escherichia coli Virulence Gene Expression
    Article Snippet: .. The EtrB protein was fused with the maltose-binding protein (MBP) using a pMAL-C5x vector (NEB) with the restriction enzymes NcoI and SbfI (NEB) to create pDL02. .. E. coli strain BL21(DE3) containing pDL02 was grown at 37°C in LB broth with glucose (0.2% final concentration) and ampicillin (100 μg/ml) to an OD600 of 0.5.

    Article Title: Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5′-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase
    Article Snippet: .. The pMal-c5X vector was purchased from New England Bioscience (NEB; Ipswich, MA). .. Fluorescently labeled RNA (Cy5.5-RNA) and unlabeled DNA oligonucleotides were chemically synthesized and purified by high-performance liquid chromatography by Integrated DNA Technologies (Coralville, IA).

    Article Title: Expression and Purification of the Arabidopsis E4 SUMO Ligases PIAL1 and PIAL2
    Article Snippet: .. Rosetta DE3 pLysS strain (Merck KGaA, catalog number: 70956) Vector pMAL-c2X (New England Biolabs, catalog number: N8076S; the current version of the vector sold by NEB is pMAL-c5X, catalog number: N8108S) Peptone (ForMedium, catalog number: PEP03) Yeast extract (ForMedium, catalog number: YEM03) NaCl (Sigma-Aldrich, catalog number: S3014) Chloramphenicol (Sigma-Aldrich, catalog number: C0378) Ampicillin (Sigma-Aldrich, catalog number: A9518) Isopropyl β-D-1-thiogalactopyranoside (IPTG) (GERBU Biotechnik GmbH, catalog number: 1010) KCl (Sigma-Aldrich, catalog number: P5405) Na2 HPO4 (Sigma-Aldrich, catalog number: 71505) KH2 PO4 (Sigma-Aldrich, catalog number: P3786) Aprotinin (Sigma-Aldrich, catalog number: A6279) (solution stored at 4 °C) Leupeptin (Sigma-Aldrich, catalog number: L2884) (stock solution of 1 mg/ml stored in aliquots at -20 °C) Amylose resin (New England Biolabs, catalog number: E8021S) DNase I (Roche Diagnostics, catalog number: 10104159001) Glycerol (GERBU Biotechnik GmbH, catalog number: 2006) Ethylenediamine tetraacetic acid (EDTA) (GERBU Biotechnik GmbH, catalog number: 1034) Tris (GERBU Biotechnik GmbH, catalog number: 1018) Maltose (Merck KGaA, catalog number: 105911) Ultrapure water (18.2 MΩ) Lysogeny broth (LB) (see ) Phosphate buffered saline (PBS) (see ) Column buffer (see ) Elution buffer (see ) .. Orbital shaker at 37 °C Spectrophotometer Cooled centrifuge Bandelin Sonoplus sonicator with an MS 73 tapered probe (BANDELIN electronic GmbH & Co., model: GM70HD) PolyPrep Chromatography Columns (Bio-Rad Laboratories, AbD Serotec® , catalog number: 7311550)

    Article Title: Soybean GmDREBL Increases Lipid Content in Seeds of Transgenic Arabidopsis
    Article Snippet: .. Gel-shift assay The recombinant protein of maltose binding protein–GmDREBL was expressed in Escherichia coli BL21 using pMAL-c5x vector and purified from cells using Amylose Resin (NEB). ..

    Article Title: Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase. Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase
    Article Snippet: .. The amplified fragment was subcloned into the pMAL‐c5X vector (New England Biolabs) following the manufacturer's instruction. ..

    Article Title: Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4
    Article Snippet: .. In brief, ORFs of ScATG4 , HsATG4B , AtATG4a (AT2G44140), and SlATG4 (Solyc01g006230) were amplified and cloned into pMal-C2 expression vector (NEW ENGLAND BIOLABS, current version of this vector is pMal-c5X, N8108), resulting in maltose binding protein (MBP)-ATG4. .. For synthetic substrates, ScATG8 , HsLC3A , AtATG8a (AT4G21980), and SlATG8a (Solyc07g064680) ORFs were amplified and cloned into BamHI (NEW ENGLAND BIOLABS, R0136S) and SalI (NEW ENGLAND BIOLABS, R0138S)-restricted pET28-Citrine-ShR plasmid.

    Article Title: Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W]Hemoglobin Control of Cell Survival/Death Decision Regulates in Vitro Plant Embryogenesis 1 [W] [OPEN]
    Article Snippet: .. An fusion construct was assembled in pMAL-c5X vector (NEB) using an Infusion strategy (Clontech) by linearizing the vector with Xmn I and Eco ). .. A single colony of NEB expression Escherichia coli harboring the pMAL-c5X vector alone or the positive vector containing Zm 4 fusion was used to inoculate an overnight starter culture in 4 mL of Luria-Bertani broth incubated at 37°C with vigorous shaking.

    Article Title: Post-transcriptional regulation of transcript abundance by a conserved member of the tristetraprolin family in Candida albicans
    Article Snippet: .. Full-length C. albicans ZFS1 (orf19.5334) was cloned using the NotI and BamHI sites of a modified pMAL-c5x vector (New England Biolabs), as described in , and was expressed as a fusion protein with maltose-binding protein linked to the N-terminus of Zfs1 (Zfs1:MBP) by a three alanine linker. .. The recombinant fusion protein was expressed in BL21 (DE3) cells after induction with 0.3 mM IPTG for 16 h at 20°C.

    Article Title: A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1 [OPEN]
    Article Snippet: .. The HY5 fragment was released from pEASY-HY5 (cut with Eco RI and Xho I) and cloned into the Eco RI- Xho I sites of the modified pMAL-c5X vector (New England Biolabs), resulting in MBP-HY5. .. The plasmids of AD-HY5, AD-HY5N, AD-HY5C, AD-PIF1, AD-PIF3, His-HY5, YFPC -HY5, GAL4:LUC, and 35S:GUS were produced as described previously ( ; ; ). pEASY-BBX23 was cut with Xba I and Bam HI to release the BBX23 fragment, which was then ligated into the Xba I- Bam HI site of pCAMBIA-nFlag, giving rise to 35S:Flag-BBX23.

    Article Title: A Rapid Induction Mechanism for Lin28a in Trophic Responses
    Article Snippet: .. MBP-Lin28a in the pMAL-c5X vector was expressed in BL21 bacteria and purified as described, but rotated with amylose resin (NEB E80215). .. Lin28a was cleaved from the amylose-bound MBP tag with factor Xa protease (NEB P8010).

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: .. Maltose binding protein (MBP) (a.a.1-367) was produced using pMal-c5x vector (New England BioLabs Inc., Ipswich, MA). .. Plasmid encoding MBP+hBT protein was a gift from Evotec A.G. (Hamburg, Germany).

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: .. The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression. .. To reduce the affinity of MBP for endogenous ligands and allow subsequent testing of maltose binding, we introduced a point mutation, W340A , in all constructs.

    Affinity Chromatography:

    Article Title: Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase. Rice plants have three homologs of glutathione synthetase genes, one of which, OsGS2, codes for hydroxymethyl‐glutathione synthetase
    Article Snippet: The amplified fragment was subcloned into the pMAL‐c5X vector (New England Biolabs) following the manufacturer's instruction. .. The recombinant maltose‐binding protein (MBP)‐fusion protein was expressed in the Escherichia coli strain NEB Express (ER2523; New England Biolabs) and purified by affinity chromatography using amylose resin (Kellermann & Ferenci, ).

    Produced:

    Article Title: A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1A PIF1/PIF3-HY5-BBX23 Transcription Factor Cascade Affects Photomorphogenesis 1 [OPEN]
    Article Snippet: The HY5 fragment was released from pEASY-HY5 (cut with Eco RI and Xho I) and cloned into the Eco RI- Xho I sites of the modified pMAL-c5X vector (New England Biolabs), resulting in MBP-HY5. .. The plasmids of AD-HY5, AD-HY5N, AD-HY5C, AD-PIF1, AD-PIF3, His-HY5, YFPC -HY5, GAL4:LUC, and 35S:GUS were produced as described previously ( ; ; ). pEASY-BBX23 was cut with Xba I and Bam HI to release the BBX23 fragment, which was then ligated into the Xba I- Bam HI site of pCAMBIA-nFlag, giving rise to 35S:Flag-BBX23.

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: .. Maltose binding protein (MBP) (a.a.1-367) was produced using pMal-c5x vector (New England BioLabs Inc., Ipswich, MA). .. Plasmid encoding MBP+hBT protein was a gift from Evotec A.G. (Hamburg, Germany).

    Concentration Assay:

    Article Title: The Type Three Secretion System 2-Encoded Regulator EtrB Modulates Enterohemorrhagic Escherichia coli Virulence Gene Expression
    Article Snippet: The EtrB protein was fused with the maltose-binding protein (MBP) using a pMAL-C5x vector (NEB) with the restriction enzymes NcoI and SbfI (NEB) to create pDL02. .. E. coli strain BL21(DE3) containing pDL02 was grown at 37°C in LB broth with glucose (0.2% final concentration) and ampicillin (100 μg/ml) to an OD600 of 0.5.

    Article Title: A Rapid Induction Mechanism for Lin28a in Trophic Responses
    Article Snippet: RnaseA was added to lysates to a final concentration of 20 μg/ml. .. MBP-Lin28a in the pMAL-c5X vector was expressed in BL21 bacteria and purified as described, but rotated with amylose resin (NEB E80215).

    FLAG-tag:

    Article Title: Visualizing conformational dynamics of proteins in solution and at the cell membrane
    Article Snippet: The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs, Ipswich, MA), and was codon optimized for mammalian cell expression. .. In addition, a FLAG epitope was added to the N-terminus of MBP.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs pmal c2 expression vector
    Pmal C2 Expression Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmal c2 expression vector/product/New England Biolabs
    Average 90 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    pmal c2 expression vector - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results