ptxb1  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pTXB1 Vector DNA
    Description:
    pTXB1 Vector DNA 10 ug
    Catalog Number:
    N6707S
    Price:
    127
    Size:
    10 ug
    Category:
    E coli Expression Vectors
    Buy from Supplier


    Structured Review

    New England Biolabs ptxb1
    pTXB1 Vector DNA
    pTXB1 Vector DNA 10 ug
    https://www.bioz.com/result/ptxb1/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ptxb1 - by Bioz Stars, 2019-09
    99/100 stars

    Related Products / Commonly Used Together

    restriction sites ndei

    Images

    Related Articles

    Clone Assay:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: After amplifying the desired DNA fragment of the two zinc-finger domains (632–827) by polymerase chain reaction (PCR) using the forward 5‘ GGTGGTGCTAGCGAACGCCCATATGCTTGCCCTG3’ and reverse 5‘ GGTGGTTGCTCTTCCGCAGTCCTTCTGTCTTAAATGGATTTTG3’ primers from Sigma–Aldrich (Taufkirchen, Germany), and purification by agarose-gel electrophoresis, the fragment was ligated into the cloning vector pGEM-T from Promega (Mannheim, Germany). .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated. .. To confirm an in-frame cloning of Zf12 ( 1 ), DNA sequencing was performed.

    Article Title: Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry
    Article Snippet: Clones for the M.BsaHI, M.XbaI, M.PvuII and M.PstI enzymes were a kind gift from New England Biolabs Inc. .. Briefly, the methyltransferase genes were inserted into the pTXB1 vector (NEB) (NheI and EcoRI sites).

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: Restriction-free cloning ( ) was used to insert Ubl, UBE2L3 and UBE2L6 into pRSF Duet-1 (Merck) and thioredoxin from pThioHis A vector (Invitrogen) at the C-terminus of 6xHis-smt3-Parkin vector. .. All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct.

    Article Title: Direct detection of transient ?-helical states in islet amyloid polypeptide
    Article Snippet: Paragraph title: Cloning ... The sequence was ligated into the pTXB1 vector (NEB), which had been linearized with SapI and NdeI.

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: Paragraph title: Cloning, overexpression and purification of tagless HU PG0121 protein ... The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: Paragraph title: Cloning and purification of VicK, GcrR & ComE ... The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    Article Title: BDNF pro-peptide regulates dendritic spines via caspase-3
    Article Snippet: All these form the basis for future studies on the physiological and pharmacological effects of BDNF pro-peptide in vitro and in vivo , as well as the underlying mechanisms. .. DNA sequence encoding the human BDNF pro-peptide (Val66 ) and human NGF pro-peptide up to furin cleavage site was cloned into pTXB1 vector (New England Biolab, Ipswich, MA, USA) between Nde I and Spe I sites with an extra histidine residue at the C-terminus to enhance efficient cleavage of the intein affinity tag from BDNF pro-peptide and NGF pro-peptide. .. Recombinant BDNF pro-peptide and NGF pro-peptide were expressed in BL21 E. coli and purified to homogeneity using the IMPACT kit according to the manufacturer's protocol (New England Biolab, catalog no. E6901S).

    Article Title: Enhancement of therapeutic potential of a naturally occurring human antibody targeting a phosphorylated Ser422 containing epitope on pathological tau
    Article Snippet: Slides were counterstained with haematoxylin, dehydrated and mounted with Quick D mounting medium (Klinipath, Duiven, The Netherlands). .. DNA inserts for tau fragments with suitable overlaps to the pTXB1 vector (New England Biolabs) were obtained commercially (IDT) and cloned into the expressed protein ligation vector using the IMPACT kit and associated protocols (New England Biolabs). .. After cloning, the plasmid was amplified in E. coli NEB5α cells (New England Biolabs).

    Article Title: Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes
    Article Snippet: ToxT was purified using the IMPACT-CN fusion protein system (New England Biolabs). .. Full-length ToxT was cloned from Vibrio cholerae O395 and ligated into pTXB1 (New England Biolabs) to produce a toxT-intein/CBD (chitin binding domain) fusion construct. .. ToxT was expressed by autoinduction ( ) in ZYM-5052 media using BL21-CodonPlus® (DE3)-RIL (Stratagene) E. coli .

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For GST pull-down experiments, Rev7 cDNA and Rev1 C-terminal fragments were cloned in pGEX4T-2 (Amersham) to produce GST fusion proteins. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs).

    Centrifugation:

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Amplification:

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: The PCR products were amplified using Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) prior to digestion with the restriction enzymes NdeI and SapI (New England Biolabs) and subsequent purification using the QIAquick Gel Extraction Kit (Qiagen). .. The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance. .. Tagless HU PG0121 protein was first purified by chitin affinity chromatography from a 500-mL liquid culture of E. coli ER2566 carrying pTXB1 with the HU PG0121 gene.

    Article Title: Efficient, chemoselective synthesis of immunomicelles using single-domain antibodies with a C-terminal thioester
    Article Snippet: The gene encoding for sdAb-aGST was amplified by PCR from vector pHENIX sdAb-α GST C11 with the primer pair pUC119pelB_f (5'-GGTGGTCATATGAAATACCTATTGCCTACGGCAGC-3') and pUC119vsv_r (5'-GGTGGTTGCTCTTCCGCATGCGGCCCCCTTTCCAAG-3'). .. The PCR products and the pTXB1 and pTYB1 vectors were double-digested with the restriction endonucleases Nde I and Sap I followed by ligation of the amplified DNA fragments in the open plasmids yielding the expression plasmids pTXB1-sdAb-aGST and pTYB1-sdAb-aGST. .. DNA sequencing (BaseClear, Leiden, The Netherlands) using T7 promoter and intein-specific reversed primers (New England Biolabs) confirmed the correct in-frame fusion of the proteins with the intein sequence.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: For the Intein tag to be removed with greater efficiency, the last amino acid of VicK was changed from serine to alanine using primer oSG550. .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: Mouse Polι cDNA was amplified by PCR. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs).

    Article Title: Expression and purification of functional human glycogen synthase-1 (hGYS1) in insect cells
    Article Snippet: The scheme of this preparation and implications for this co-expression, as well as levels of post-translational phosphorylation, are discussed. .. Human glycogen synthase (hGYS1) clone was obtained from Open Biosystems, amplified and sub-cloned into an IMPACT E.coli expression vector pTXB1 (NEB Inc, MA) using NdeI and SpeI with an intein tag and a chitin-binding domain (CBD) at the C-terminus of hGYS1. .. The hGYS1-intein-CBD was later sub-cloned in a pFL MultiBac transfer vector[ ] using the XhoI and SphI sites; the gene encoding rabbit Glycogenin (rGYG1) was amplified by PCR and sub-cloned into the BamHI and HindIII sites of pFL-CBD-intein-hGYS1, yielding the final transfer vector, pFL-CBD-intein-hGYS1-rGYG1 ( ).

    Polymerase Chain Reaction:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: After amplifying the desired DNA fragment of the two zinc-finger domains (632–827) by polymerase chain reaction (PCR) using the forward 5‘ GGTGGTGCTAGCGAACGCCCATATGCTTGCCCTG3’ and reverse 5‘ GGTGGTTGCTCTTCCGCAGTCCTTCTGTCTTAAATGGATTTTG3’ primers from Sigma–Aldrich (Taufkirchen, Germany), and purification by agarose-gel electrophoresis, the fragment was ligated into the cloning vector pGEM-T from Promega (Mannheim, Germany). .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated.

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: The PCR products were amplified using Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) prior to digestion with the restriction enzymes NdeI and SapI (New England Biolabs) and subsequent purification using the QIAquick Gel Extraction Kit (Qiagen). .. The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance.

    Article Title: Efficient, chemoselective synthesis of immunomicelles using single-domain antibodies with a C-terminal thioester
    Article Snippet: The gene encoding for sdAb-aGST was amplified by PCR from vector pHENIX sdAb-α GST C11 with the primer pair pUC119pelB_f (5'-GGTGGTCATATGAAATACCTATTGCCTACGGCAGC-3') and pUC119vsv_r (5'-GGTGGTTGCTCTTCCGCATGCGGCCCCCTTTCCAAG-3'). .. The PCR products and the pTXB1 and pTYB1 vectors were double-digested with the restriction endonucleases Nde I and Sap I followed by ligation of the amplified DNA fragments in the open plasmids yielding the expression plasmids pTXB1-sdAb-aGST and pTYB1-sdAb-aGST. .. DNA sequencing (BaseClear, Leiden, The Netherlands) using T7 promoter and intein-specific reversed primers (New England Biolabs) confirmed the correct in-frame fusion of the proteins with the intein sequence.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: To generate a tagless version of VicK we used the Impact Kit (New England Biolabs) and generated a C-terminal VicK-Intein fusion protein by PCR amplifying the vicK coding sequence from S. mutans UA159 chromosomal DNA with oligonucleotides oSG548 and oSG550 ( ). .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: Mouse Polι cDNA was amplified by PCR. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs).

    Construct:

    Article Title: Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O-demethylase crystals by the microseeding method
    Article Snippet: LigM was produced with an intein–chitin-binding domain (intein-CBD) tag. .. An expression plasmid for LigM (GenBank ; Abe et al. , 2005 ; Masai et al. , 2012 ) was constructed using the pTXB1 vector (New England Biolabs). .. Escherichia coli BL21(DE3) cells were transformed with the expression plasmid.

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: Restriction-free cloning ( ) was used to insert Ubl, UBE2L3 and UBE2L6 into pRSF Duet-1 (Merck) and thioredoxin from pThioHis A vector (Invitrogen) at the C-terminus of 6xHis-smt3-Parkin vector. .. All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct. .. A G94A mutation was made to improve autocatalytic cleavage of the C-terminal intein.

    Article Title: BDNF pro-peptide regulates dendritic spines via caspase-3
    Article Snippet: Paragraph title: DNA construct and purification of BDNF pro-peptide ... DNA sequence encoding the human BDNF pro-peptide (Val66 ) and human NGF pro-peptide up to furin cleavage site was cloned into pTXB1 vector (New England Biolab, Ipswich, MA, USA) between Nde I and Spe I sites with an extra histidine residue at the C-terminus to enhance efficient cleavage of the intein affinity tag from BDNF pro-peptide and NGF pro-peptide.

    Article Title: Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes
    Article Snippet: ToxT was purified using the IMPACT-CN fusion protein system (New England Biolabs). .. Full-length ToxT was cloned from Vibrio cholerae O395 and ligated into pTXB1 (New England Biolabs) to produce a toxT-intein/CBD (chitin binding domain) fusion construct. .. ToxT was expressed by autoinduction ( ) in ZYM-5052 media using BL21-CodonPlus® (DE3)-RIL (Stratagene) E. coli .

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs). .. The pTXB1-mDinB plasmid yields a tagless mPolκ protein.

    Article Title: FACILE CHEMICAL FUNCTIONALIZATION OF PROTEINS THROUGH INTEIN-LINKED YEAST DISPLAY
    Article Snippet: The pCT4Re yeast surface display vector was created by insertion of the constructs shown in into the pCT-302 yeast surface display vector between the GAL1-10 promoter and the alpha factor terminator sequences using the restriction sites Eco RI and Xho I. .. The Mxe GyrA intein sequence was subcloned from the pTXB1 vector (New England Biolabs).

    Electrophoresis:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: After amplifying the desired DNA fragment of the two zinc-finger domains (632–827) by polymerase chain reaction (PCR) using the forward 5‘ GGTGGTGCTAGCGAACGCCCATATGCTTGCCCTG3’ and reverse 5‘ GGTGGTTGCTCTTCCGCAGTCCTTCTGTCTTAAATGGATTTTG3’ primers from Sigma–Aldrich (Taufkirchen, Germany), and purification by agarose-gel electrophoresis, the fragment was ligated into the cloning vector pGEM-T from Promega (Mannheim, Germany). .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated.

    Incubation:

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    Article Title: Enhancement of therapeutic potential of a naturally occurring human antibody targeting a phosphorylated Ser422 containing epitope on pathological tau
    Article Snippet: DNA inserts for tau fragments with suitable overlaps to the pTXB1 vector (New England Biolabs) were obtained commercially (IDT) and cloned into the expressed protein ligation vector using the IMPACT kit and associated protocols (New England Biolabs). .. DNA inserts for tau fragments with suitable overlaps to the pTXB1 vector (New England Biolabs) were obtained commercially (IDT) and cloned into the expressed protein ligation vector using the IMPACT kit and associated protocols (New England Biolabs).

    Expressing:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: After amplifying the desired DNA fragment of the two zinc-finger domains (632–827) by polymerase chain reaction (PCR) using the forward 5‘ GGTGGTGCTAGCGAACGCCCATATGCTTGCCCTG3’ and reverse 5‘ GGTGGTTGCTCTTCCGCAGTCCTTCTGTCTTAAATGGATTTTG3’ primers from Sigma–Aldrich (Taufkirchen, Germany), and purification by agarose-gel electrophoresis, the fragment was ligated into the cloning vector pGEM-T from Promega (Mannheim, Germany). .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated. .. To confirm an in-frame cloning of Zf12 ( 1 ), DNA sequencing was performed.

    Article Title: Glioma Dual-Targeting Nanohybrid Protein Toxin Constructed by Intein-Mediated Site-Specific Ligation for Multistage Booster Delivery
    Article Snippet: E.coli strain BL21 (DE3) was preserved by our laboratory. .. The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (UK). .. Lysogeny Broth (LB) medium was purchased from Oxoid (UK).

    Article Title: Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O-demethylase crystals by the microseeding method
    Article Snippet: LigM was produced with an intein–chitin-binding domain (intein-CBD) tag. .. An expression plasmid for LigM (GenBank ; Abe et al. , 2005 ; Masai et al. , 2012 ) was constructed using the pTXB1 vector (New England Biolabs). .. Escherichia coli BL21(DE3) cells were transformed with the expression plasmid.

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: Paragraph title: Expression and purification of proteins ... All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct.

    Article Title: Direct detection of transient ?-helical states in islet amyloid polypeptide
    Article Snippet: The coding sequences of the peptide inserts were designed with optimal bacterial codon usage for expression. .. The sequence was ligated into the pTXB1 vector (NEB), which had been linearized with SapI and NdeI.

    Article Title:
    Article Snippet: The cDNA encoding the protein was inserted upstream of the intein gene in the pTXB1 vector from New England Biolabs (Ipswich, MA). .. The cDNA encoding the protein was inserted upstream of the intein gene in the pTXB1 vector from New England Biolabs (Ipswich, MA).

    Article Title: Efficient, chemoselective synthesis of immunomicelles using single-domain antibodies with a C-terminal thioester
    Article Snippet: The gene encoding for sdAb-aGST was amplified by PCR from vector pHENIX sdAb-α GST C11 with the primer pair pUC119pelB_f (5'-GGTGGTCATATGAAATACCTATTGCCTACGGCAGC-3') and pUC119vsv_r (5'-GGTGGTTGCTCTTCCGCATGCGGCCCCCTTTCCAAG-3'). .. The PCR products and the pTXB1 and pTYB1 vectors were double-digested with the restriction endonucleases Nde I and Sap I followed by ligation of the amplified DNA fragments in the open plasmids yielding the expression plasmids pTXB1-sdAb-aGST and pTYB1-sdAb-aGST. .. DNA sequencing (BaseClear, Leiden, The Netherlands) using T7 promoter and intein-specific reversed primers (New England Biolabs) confirmed the correct in-frame fusion of the proteins with the intein sequence.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: For the Intein tag to be removed with greater efficiency, the last amino acid of VicK was changed from serine to alanine using primer oSG550. .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Article Title: Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes
    Article Snippet: Paragraph title: ToxT Expression. ... Full-length ToxT was cloned from Vibrio cholerae O395 and ligated into pTXB1 (New England Biolabs) to produce a toxT-intein/CBD (chitin binding domain) fusion construct.

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For GST pull-down experiments, Rev7 cDNA and Rev1 C-terminal fragments were cloned in pGEX4T-2 (Amersham) to produce GST fusion proteins. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs). .. The pET-16b-mDinB plasmid yields an N-terminally His10 -tagged mPolκ protein.

    Article Title: Expression and purification of functional human glycogen synthase-1 (hGYS1) in insect cells
    Article Snippet: The scheme of this preparation and implications for this co-expression, as well as levels of post-translational phosphorylation, are discussed. .. Human glycogen synthase (hGYS1) clone was obtained from Open Biosystems, amplified and sub-cloned into an IMPACT E.coli expression vector pTXB1 (NEB Inc, MA) using NdeI and SpeI with an intein tag and a chitin-binding domain (CBD) at the C-terminus of hGYS1. .. The hGYS1-intein-CBD was later sub-cloned in a pFL MultiBac transfer vector[ ] using the XhoI and SphI sites; the gene encoding rabbit Glycogenin (rGYG1) was amplified by PCR and sub-cloned into the BamHI and HindIII sites of pFL-CBD-intein-hGYS1, yielding the final transfer vector, pFL-CBD-intein-hGYS1-rGYG1 ( ).

    Article Title: Intein-mediated site-specific synthesis of tumor-targeting protein delivery system: Turning PEG dilemma into prodrug-like feature
    Article Snippet: E. coli strain BL21 (DE3) was preserved by our laboratory. .. The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (England). .. Lysogeny Broth (LB) medium was purchased from Oxoid (England).

    BIA-KA:

    Article Title: Intein-mediated site-specific synthesis of tumor-targeting protein delivery system: Turning PEG dilemma into prodrug-like feature
    Article Snippet: The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (England). .. Protein marker and isopropyl β-D-1-thiogalactopyranoside (IPTG) were acquired from Thermo (USA).

    Transformation Assay:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated. .. To confirm an in-frame cloning of Zf12 ( 1 ), DNA sequencing was performed.

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct. .. The SH3 domain from endophilin (residues 291–352) and E304A mutant ( ) were expressed as His-smt3 fusions, purified by Nickel-affinity chromatography followed by overnight cleavage with Ulp1 at 4°C and subsequent anion exchange chromatography.

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: The PCR products were amplified using Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) prior to digestion with the restriction enzymes NdeI and SapI (New England Biolabs) and subsequent purification using the QIAquick Gel Extraction Kit (Qiagen). .. The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance. .. Tagless HU PG0121 protein was first purified by chitin affinity chromatography from a 500-mL liquid culture of E. coli ER2566 carrying pTXB1 with the HU PG0121 gene.

    Article Title: Enhancement of therapeutic potential of a naturally occurring human antibody targeting a phosphorylated Ser422 containing epitope on pathological tau
    Article Snippet: DNA inserts for tau fragments with suitable overlaps to the pTXB1 vector (New England Biolabs) were obtained commercially (IDT) and cloned into the expressed protein ligation vector using the IMPACT kit and associated protocols (New England Biolabs). .. After cloning, the plasmid was amplified in E. coli NEB5α cells (New England Biolabs).

    Article Title: FACILE CHEMICAL FUNCTIONALIZATION OF PROTEINS THROUGH INTEIN-LINKED YEAST DISPLAY
    Article Snippet: The Mxe GyrA intein sequence was subcloned from the pTXB1 vector (New England Biolabs). .. An N-linked glycosylation site that appears in the scFv2 amino acid sequence (N-x-T) was altered to prevent N-linked glycosylation by changing the asparagine residue to a serine (S-x-T) with the Quikchange II Site-Directed Mutagenesis Kit (Agilent).

    Over Expression:

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: Paragraph title: Cloning, overexpression and purification of tagless HU PG0121 protein ... The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance.

    Chromatography:

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct. .. A G94A mutation was made to improve autocatalytic cleavage of the C-terminal intein.

    Ligation:

    Article Title: Efficient, chemoselective synthesis of immunomicelles using single-domain antibodies with a C-terminal thioester
    Article Snippet: The gene encoding for sdAb-aGST was amplified by PCR from vector pHENIX sdAb-α GST C11 with the primer pair pUC119pelB_f (5'-GGTGGTCATATGAAATACCTATTGCCTACGGCAGC-3') and pUC119vsv_r (5'-GGTGGTTGCTCTTCCGCATGCGGCCCCCTTTCCAAG-3'). .. The PCR products and the pTXB1 and pTYB1 vectors were double-digested with the restriction endonucleases Nde I and Sap I followed by ligation of the amplified DNA fragments in the open plasmids yielding the expression plasmids pTXB1-sdAb-aGST and pTYB1-sdAb-aGST. .. DNA sequencing (BaseClear, Leiden, The Netherlands) using T7 promoter and intein-specific reversed primers (New England Biolabs) confirmed the correct in-frame fusion of the proteins with the intein sequence.

    Article Title: Enhancement of therapeutic potential of a naturally occurring human antibody targeting a phosphorylated Ser422 containing epitope on pathological tau
    Article Snippet: Slides were counterstained with haematoxylin, dehydrated and mounted with Quick D mounting medium (Klinipath, Duiven, The Netherlands). .. DNA inserts for tau fragments with suitable overlaps to the pTXB1 vector (New England Biolabs) were obtained commercially (IDT) and cloned into the expressed protein ligation vector using the IMPACT kit and associated protocols (New England Biolabs). .. After cloning, the plasmid was amplified in E. coli NEB5α cells (New England Biolabs).

    Hemagglutination Assay:

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For in vivo binding assays, full-length mRev1 and mDinB cDNAs were cloned in pCMV-Myc or pCMV-HA (Clontech) to produce Myc or HA fusion proteins. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs).

    Generated:

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: Ubl point mutants (K27N, R33Q, R42P, A46P, K48A/R and R51P) and Parkin truncations (ΔUbl and 95C) were generated using the Phusion® Mutagenesis Kit (Finnzymes). .. All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: To generate a tagless version of VicK we used the Impact Kit (New England Biolabs) and generated a C-terminal VicK-Intein fusion protein by PCR amplifying the vicK coding sequence from S. mutans UA159 chromosomal DNA with oligonucleotides oSG548 and oSG550 ( ). .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs). .. The pTXB1-mDinB plasmid yields a tagless mPolκ protein.

    Article Title: Expression and purification of functional human glycogen synthase-1 (hGYS1) in insect cells
    Article Snippet: Human glycogen synthase (hGYS1) clone was obtained from Open Biosystems, amplified and sub-cloned into an IMPACT E.coli expression vector pTXB1 (NEB Inc, MA) using NdeI and SpeI with an intein tag and a chitin-binding domain (CBD) at the C-terminus of hGYS1. .. Expression of hGYS1 is driven by transcription of the p10 promoter, while glycogenin is driven by the polh promoter thus allowing for simultaneous expression of both proteins ( ).

    Zinc-Fingers:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: The spectra were recorded at 20 °C in a wavelength range of 260–190 nm for the zinc fingers and from 300–200 nm for the DNA binding studies with 1.0 nm bandwidth in continuous mode, 1.0 s response and a scan speed of 100 nm min−1 . .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated.

    Sequencing:

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: Restriction-free cloning ( ) was used to insert Ubl, UBE2L3 and UBE2L6 into pRSF Duet-1 (Merck) and thioredoxin from pThioHis A vector (Invitrogen) at the C-terminus of 6xHis-smt3-Parkin vector. .. All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct. .. A G94A mutation was made to improve autocatalytic cleavage of the C-terminal intein.

    Article Title: Direct detection of transient ?-helical states in islet amyloid polypeptide
    Article Snippet: Six oligonucleotides, comprising the complimentary forward and reverse sequences, were annealed to create the double-stranded coding sequence for IAPP with SapI and NdeI compatible overhands. .. The sequence was ligated into the pTXB1 vector (NEB), which had been linearized with SapI and NdeI. .. The pTXB1:IAPP plasmid was cloned in LE392 E. coli cells ( ) and purified with a QIAGEN spin miniprep kit and sequenced for verification.

    Article Title:
    Article Snippet: The cDNA encoding the protein was inserted upstream of the intein gene in the pTXB1 vector from New England Biolabs (Ipswich, MA). .. The EIAV-CA-pTXB1 construct was transformed into Escherichia coli host strain BL21-DE3.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: To generate a tagless version of VicK we used the Impact Kit (New England Biolabs) and generated a C-terminal VicK-Intein fusion protein by PCR amplifying the vicK coding sequence from S. mutans UA159 chromosomal DNA with oligonucleotides oSG548 and oSG550 ( ). .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol.

    Article Title: BDNF pro-peptide regulates dendritic spines via caspase-3
    Article Snippet: All these form the basis for future studies on the physiological and pharmacological effects of BDNF pro-peptide in vitro and in vivo , as well as the underlying mechanisms. .. DNA sequence encoding the human BDNF pro-peptide (Val66 ) and human NGF pro-peptide up to furin cleavage site was cloned into pTXB1 vector (New England Biolab, Ipswich, MA, USA) between Nde I and Spe I sites with an extra histidine residue at the C-terminus to enhance efficient cleavage of the intein affinity tag from BDNF pro-peptide and NGF pro-peptide. .. Recombinant BDNF pro-peptide and NGF pro-peptide were expressed in BL21 E. coli and purified to homogeneity using the IMPACT kit according to the manufacturer's protocol (New England Biolab, catalog no. E6901S).

    Article Title: FACILE CHEMICAL FUNCTIONALIZATION OF PROTEINS THROUGH INTEIN-LINKED YEAST DISPLAY
    Article Snippet: The pCT4Re yeast surface display vector was created by insertion of the constructs shown in into the pCT-302 yeast surface display vector between the GAL1-10 promoter and the alpha factor terminator sequences using the restriction sites Eco RI and Xho I. .. The Mxe GyrA intein sequence was subcloned from the pTXB1 vector (New England Biolabs). .. The anti-fluorescein single-chain antibody (scFv) (4-4-20) was subcloned from the pCT-302 vector, creating pCT4Re-4420, and the yeast enhanced green fluorescent protein (GFP) was subcloned from the pCT-GFP plasmid, creating pCT4Re-GFP.

    Article Title: Novel Semi-synthetic Method for Generating Full Length ?-Amyloid Peptides
    Article Snippet: The ligation reaction was transformed into ER2566 cells and resulting colonies were screened on Luria broth (LB) plates containing ampicillin (amp) and using restriction digest. .. Sequencing verified that Aβ1-29 was correctly aligned into the pTXB1 vector. .. For production of Aβ peptides bearing a point mutation associated with Familial Alzheimer’s Disease, we performed site directed mutagenesis to obtain a construct with the Iowa mutation, D23N.

    Sonication:

    Article Title: Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O-demethylase crystals by the microseeding method
    Article Snippet: An expression plasmid for LigM (GenBank ; Abe et al. , 2005 ; Masai et al. , 2012 ) was constructed using the pTXB1 vector (New England Biolabs). .. An expression plasmid for LigM (GenBank ; Abe et al. , 2005 ; Masai et al. , 2012 ) was constructed using the pTXB1 vector (New England Biolabs).

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance. .. The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance.

    Recombinant:

    Article Title: Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O-demethylase crystals by the microseeding method
    Article Snippet: An expression plasmid for LigM (GenBank ; Abe et al. , 2005 ; Masai et al. , 2012 ) was constructed using the pTXB1 vector (New England Biolabs). .. Escherichia coli BL21(DE3) cells were transformed with the expression plasmid.

    Article Title: BDNF pro-peptide regulates dendritic spines via caspase-3
    Article Snippet: DNA sequence encoding the human BDNF pro-peptide (Val66 ) and human NGF pro-peptide up to furin cleavage site was cloned into pTXB1 vector (New England Biolab, Ipswich, MA, USA) between Nde I and Spe I sites with an extra histidine residue at the C-terminus to enhance efficient cleavage of the intein affinity tag from BDNF pro-peptide and NGF pro-peptide. .. Recombinant BDNF pro-peptide and NGF pro-peptide were expressed in BL21 E. coli and purified to homogeneity using the IMPACT kit according to the manufacturer's protocol (New England Biolab, catalog no. E6901S).

    Article Title: Enhancement of therapeutic potential of a naturally occurring human antibody targeting a phosphorylated Ser422 containing epitope on pathological tau
    Article Snippet: Paragraph title: Production recombinant tau fragments (tau1–415-Mxe-CBD) for ligation ... DNA inserts for tau fragments with suitable overlaps to the pTXB1 vector (New England Biolabs) were obtained commercially (IDT) and cloned into the expressed protein ligation vector using the IMPACT kit and associated protocols (New England Biolabs).

    In Vivo:

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For in vivo binding assays, full-length mRev1 and mDinB cDNAs were cloned in pCMV-Myc or pCMV-HA (Clontech) to produce Myc or HA fusion proteins. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs).

    Mutagenesis:

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: Ubl point mutants (K27N, R33Q, R42P, A46P, K48A/R and R51P) and Parkin truncations (ΔUbl and 95C) were generated using the Phusion® Mutagenesis Kit (Finnzymes). .. All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct.

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs). .. The pTXB1-mDinB plasmid yields a tagless mPolκ protein.

    Article Title: FACILE CHEMICAL FUNCTIONALIZATION OF PROTEINS THROUGH INTEIN-LINKED YEAST DISPLAY
    Article Snippet: The Mxe GyrA intein sequence was subcloned from the pTXB1 vector (New England Biolabs). .. The anti-epidermal growth factor receptor (EGFR) scFv, scFv2, was subcloned from the pCDNA3.1-scFv2 plasmid generously donated by Dr. Winfried Wels to create pCT4Re-scFv2.

    Purification:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: After amplifying the desired DNA fragment of the two zinc-finger domains (632–827) by polymerase chain reaction (PCR) using the forward 5‘ GGTGGTGCTAGCGAACGCCCATATGCTTGCCCTG3’ and reverse 5‘ GGTGGTTGCTCTTCCGCAGTCCTTCTGTCTTAAATGGATTTTG3’ primers from Sigma–Aldrich (Taufkirchen, Germany), and purification by agarose-gel electrophoresis, the fragment was ligated into the cloning vector pGEM-T from Promega (Mannheim, Germany). .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated.

    Article Title: Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry
    Article Snippet: Briefly, the methyltransferase genes were inserted into the pTXB1 vector (NEB) (NheI and EcoRI sites). .. Briefly, the methyltransferase genes were inserted into the pTXB1 vector (NEB) (NheI and EcoRI sites).

    Article Title: Glioma Dual-Targeting Nanohybrid Protein Toxin Constructed by Intein-Mediated Site-Specific Ligation for Multistage Booster Delivery
    Article Snippet: E.coli strain BL21 (DE3) was preserved by our laboratory. .. The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (UK). .. Lysogeny Broth (LB) medium was purchased from Oxoid (UK).

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: Paragraph title: Expression and purification of proteins ... All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct.

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: Paragraph title: Cloning, overexpression and purification of tagless HU PG0121 protein ... The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: For the Intein tag to be removed with greater efficiency, the last amino acid of VicK was changed from serine to alanine using primer oSG550. .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Article Title: BDNF pro-peptide regulates dendritic spines via caspase-3
    Article Snippet: Paragraph title: DNA construct and purification of BDNF pro-peptide ... DNA sequence encoding the human BDNF pro-peptide (Val66 ) and human NGF pro-peptide up to furin cleavage site was cloned into pTXB1 vector (New England Biolab, Ipswich, MA, USA) between Nde I and Spe I sites with an extra histidine residue at the C-terminus to enhance efficient cleavage of the intein affinity tag from BDNF pro-peptide and NGF pro-peptide.

    Article Title: Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes
    Article Snippet: ToxT was purified using the IMPACT-CN fusion protein system (New England Biolabs). .. Full-length ToxT was cloned from Vibrio cholerae O395 and ligated into pTXB1 (New England Biolabs) to produce a toxT-intein/CBD (chitin binding domain) fusion construct.

    Article Title: Expression and purification of functional human glycogen synthase-1 (hGYS1) in insect cells
    Article Snippet: Paragraph title: Expression and Purification of hGYS1 ... Human glycogen synthase (hGYS1) clone was obtained from Open Biosystems, amplified and sub-cloned into an IMPACT E.coli expression vector pTXB1 (NEB Inc, MA) using NdeI and SpeI with an intein tag and a chitin-binding domain (CBD) at the C-terminus of hGYS1.

    Article Title: Using S-adenosyl-L-homocysteine capture compounds to characterize S-adenosyl-L-methionine and S-adenosyl-L-homocysteine binding proteins
    Article Snippet: The human SAHH open reading frame (Invitrogen, cat. no. IOH14308) was subcloned into pTXB1 vector (NEB) using Nde I and Sap I restriction sites. .. The human SAHH open reading frame (Invitrogen, cat. no. IOH14308) was subcloned into pTXB1 vector (NEB) using Nde I and Sap I restriction sites.

    Article Title: Intein-mediated site-specific synthesis of tumor-targeting protein delivery system: Turning PEG dilemma into prodrug-like feature
    Article Snippet: E. coli strain BL21 (DE3) was preserved by our laboratory. .. The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (England). .. Lysogeny Broth (LB) medium was purchased from Oxoid (England).

    Protein Purification:

    Article Title: Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O-demethylase crystals by the microseeding method
    Article Snippet: Paragraph title: 2.1. Protein purification   ... An expression plasmid for LigM (GenBank ; Abe et al. , 2005 ; Masai et al. , 2012 ) was constructed using the pTXB1 vector (New England Biolabs).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: Mouse Rev7 and Polη cDNAs were amplified by RT–PCR using mouse testis total RNA as template ( ; ). .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs).

    Positron Emission Tomography:

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: park2 gene was inserted into pET SUMO protein expression systems (Invitrogen). .. All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct.

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For GST pull-down experiments, Rev7 cDNA and Rev1 C-terminal fragments were cloned in pGEX4T-2 (Amersham) to produce GST fusion proteins. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs). .. The pET-16b-mDinB plasmid yields an N-terminally His10 -tagged mPolκ protein.

    Lysis:

    Article Title:
    Article Snippet: The cDNA encoding the protein was inserted upstream of the intein gene in the pTXB1 vector from New England Biolabs (Ipswich, MA). .. The cDNA encoding the protein was inserted upstream of the intein gene in the pTXB1 vector from New England Biolabs (Ipswich, MA).

    Article Title: Using S-adenosyl-L-homocysteine capture compounds to characterize S-adenosyl-L-methionine and S-adenosyl-L-homocysteine binding proteins
    Article Snippet: The human SAHH open reading frame (Invitrogen, cat. no. IOH14308) was subcloned into pTXB1 vector (NEB) using Nde I and Sap I restriction sites. .. The human SAHH open reading frame (Invitrogen, cat. no. IOH14308) was subcloned into pTXB1 vector (NEB) using Nde I and Sap I restriction sites.

    Plasmid Preparation:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: After amplifying the desired DNA fragment of the two zinc-finger domains (632–827) by polymerase chain reaction (PCR) using the forward 5‘ GGTGGTGCTAGCGAACGCCCATATGCTTGCCCTG3’ and reverse 5‘ GGTGGTTGCTCTTCCGCAGTCCTTCTGTCTTAAATGGATTTTG3’ primers from Sigma–Aldrich (Taufkirchen, Germany), and purification by agarose-gel electrophoresis, the fragment was ligated into the cloning vector pGEM-T from Promega (Mannheim, Germany). .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated. .. To confirm an in-frame cloning of Zf12 ( 1 ), DNA sequencing was performed.

    Article Title: Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry
    Article Snippet: Clones for the M.BsaHI, M.XbaI, M.PvuII and M.PstI enzymes were a kind gift from New England Biolabs Inc. .. Briefly, the methyltransferase genes were inserted into the pTXB1 vector (NEB) (NheI and EcoRI sites). .. T7 Express competent cells (NEB) were transformed with these plasmids and, following induction with isopropyl ‘beta'-D-1-thiogalactopyranoside (IPTG), the cells were grown overnight at 30°C.

    Article Title: Glioma Dual-Targeting Nanohybrid Protein Toxin Constructed by Intein-Mediated Site-Specific Ligation for Multistage Booster Delivery
    Article Snippet: E.coli strain BL21 (DE3) was preserved by our laboratory. .. The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (UK). .. Lysogeny Broth (LB) medium was purchased from Oxoid (UK).

    Article Title: Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O-demethylase crystals by the microseeding method
    Article Snippet: LigM was produced with an intein–chitin-binding domain (intein-CBD) tag. .. An expression plasmid for LigM (GenBank ; Abe et al. , 2005 ; Masai et al. , 2012 ) was constructed using the pTXB1 vector (New England Biolabs). .. Escherichia coli BL21(DE3) cells were transformed with the expression plasmid.

    Article Title: Autoregulation of Parkin activity through its ubiquitin-like domain
    Article Snippet: Restriction-free cloning ( ) was used to insert Ubl, UBE2L3 and UBE2L6 into pRSF Duet-1 (Merck) and thioredoxin from pThioHis A vector (Invitrogen) at the C-terminus of 6xHis-smt3-Parkin vector. .. All other E2s were purchased from Boston Biochem. pTXB1 (New England Biolabs) served as template for Mxe GyrA Intein-CBD sequence, inserted C-terminal of residue 94 to give a 6xHis-smt3 Ubl (1–94)–Intein-CBD fusion construct.

    Article Title: Direct detection of transient ?-helical states in islet amyloid polypeptide
    Article Snippet: Six oligonucleotides, comprising the complimentary forward and reverse sequences, were annealed to create the double-stranded coding sequence for IAPP with SapI and NdeI compatible overhands. .. The sequence was ligated into the pTXB1 vector (NEB), which had been linearized with SapI and NdeI. .. The pTXB1:IAPP plasmid was cloned in LE392 E. coli cells ( ) and purified with a QIAGEN spin miniprep kit and sequenced for verification.

    Article Title:
    Article Snippet: The wt EIAV-CA protein consists of 230 residues and starts with proline ( A ). .. The cDNA encoding the protein was inserted upstream of the intein gene in the pTXB1 vector from New England Biolabs (Ipswich, MA). .. The EIAV-CA-pTXB1 construct was transformed into Escherichia coli host strain BL21-DE3.

    Article Title: In vitro Manganese-Dependent Cross-Talk between Streptococcus mutans VicK and GcrR: Implications for Overlapping Stress Response Pathways
    Article Snippet: For the Intein tag to be removed with greater efficiency, the last amino acid of VicK was changed from serine to alanine using primer oSG550. .. The purified amplicon was digested with Nde I and Sap I and ligated into the expression plasmid pTXB1 (New England Biolabs) according to the supplier's protocol. .. The ligation mixture was transformed into E. coli ER2566 cells, selected for ampicillin resistance, and the construct was confirmed by DNA sequencing.

    Article Title: BDNF pro-peptide regulates dendritic spines via caspase-3
    Article Snippet: All these form the basis for future studies on the physiological and pharmacological effects of BDNF pro-peptide in vitro and in vivo , as well as the underlying mechanisms. .. DNA sequence encoding the human BDNF pro-peptide (Val66 ) and human NGF pro-peptide up to furin cleavage site was cloned into pTXB1 vector (New England Biolab, Ipswich, MA, USA) between Nde I and Spe I sites with an extra histidine residue at the C-terminus to enhance efficient cleavage of the intein affinity tag from BDNF pro-peptide and NGF pro-peptide. .. Recombinant BDNF pro-peptide and NGF pro-peptide were expressed in BL21 E. coli and purified to homogeneity using the IMPACT kit according to the manufacturer's protocol (New England Biolab, catalog no. E6901S).

    Article Title: Enhancement of therapeutic potential of a naturally occurring human antibody targeting a phosphorylated Ser422 containing epitope on pathological tau
    Article Snippet: Slides were counterstained with haematoxylin, dehydrated and mounted with Quick D mounting medium (Klinipath, Duiven, The Netherlands). .. DNA inserts for tau fragments with suitable overlaps to the pTXB1 vector (New England Biolabs) were obtained commercially (IDT) and cloned into the expressed protein ligation vector using the IMPACT kit and associated protocols (New England Biolabs). .. After cloning, the plasmid was amplified in E. coli NEB5α cells (New England Biolabs).

    Article Title: Site-specific protein double labeling by expressed protein ligation: applications to repeat proteins
    Article Snippet: These doubly labeled CTPR3 variants were prepared in high purity and homogeneity, as required for single molecule FRET studies. .. pTXB1 and pETM13 plasmids were respectively obtained from New England Biolabs and European Molecular Biology Laboratory. pProEXHTa vector containing the gene construct coding CTPR3 (360 bp) cloned between BamHI and HindIII sites (pProExHTa- ctpr3 ) has been previously described. .. All restriction and modification enzymes were purchased from New England Biolabs, except for PfuTurbo DNA Polymerase (Stratagene) and restriction enzyme SacI (Roche).

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For GST pull-down experiments, Rev7 cDNA and Rev1 C-terminal fragments were cloned in pGEX4T-2 (Amersham) to produce GST fusion proteins. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs). .. The pET-16b-mDinB plasmid yields an N-terminally His10 -tagged mPolκ protein.

    Article Title: Expression and purification of functional human glycogen synthase-1 (hGYS1) in insect cells
    Article Snippet: The scheme of this preparation and implications for this co-expression, as well as levels of post-translational phosphorylation, are discussed. .. Human glycogen synthase (hGYS1) clone was obtained from Open Biosystems, amplified and sub-cloned into an IMPACT E.coli expression vector pTXB1 (NEB Inc, MA) using NdeI and SpeI with an intein tag and a chitin-binding domain (CBD) at the C-terminus of hGYS1. .. The hGYS1-intein-CBD was later sub-cloned in a pFL MultiBac transfer vector[ ] using the XhoI and SphI sites; the gene encoding rabbit Glycogenin (rGYG1) was amplified by PCR and sub-cloned into the BamHI and HindIII sites of pFL-CBD-intein-hGYS1, yielding the final transfer vector, pFL-CBD-intein-hGYS1-rGYG1 ( ).

    Article Title: FACILE CHEMICAL FUNCTIONALIZATION OF PROTEINS THROUGH INTEIN-LINKED YEAST DISPLAY
    Article Snippet: The pCT4Re yeast surface display vector was created by insertion of the constructs shown in into the pCT-302 yeast surface display vector between the GAL1-10 promoter and the alpha factor terminator sequences using the restriction sites Eco RI and Xho I. .. The Mxe GyrA intein sequence was subcloned from the pTXB1 vector (New England Biolabs). .. The anti-fluorescein single-chain antibody (scFv) (4-4-20) was subcloned from the pCT-302 vector, creating pCT4Re-4420, and the yeast enhanced green fluorescent protein (GFP) was subcloned from the pCT-GFP plasmid, creating pCT4Re-GFP.

    Article Title: Novel Semi-synthetic Method for Generating Full Length ?-Amyloid Peptides
    Article Snippet: The ligation reaction was transformed into ER2566 cells and resulting colonies were screened on Luria broth (LB) plates containing ampicillin (amp) and using restriction digest. .. Sequencing verified that Aβ1-29 was correctly aligned into the pTXB1 vector. .. For production of Aβ peptides bearing a point mutation associated with Familial Alzheimer’s Disease, we performed site directed mutagenesis to obtain a construct with the Iowa mutation, D23N.

    Article Title: Using S-adenosyl-L-homocysteine capture compounds to characterize S-adenosyl-L-methionine and S-adenosyl-L-homocysteine binding proteins
    Article Snippet: The protein was quantified via BCA (bisinchoninic acid) assay (Pierce) and stored at −80 °C until use. .. The human SAHH open reading frame (Invitrogen, cat. no. IOH14308) was subcloned into pTXB1 vector (NEB) using Nde I and Sap I restriction sites. .. SAHH was expressed in Escherichia coli BL21(DE3) cells and grown at 37 °C, followed by induction with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at 16 °C for 16 to 20 h before harvest.

    Binding Assay:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: The spectra were recorded at 20 °C in a wavelength range of 260–190 nm for the zinc fingers and from 300–200 nm for the DNA binding studies with 1.0 nm bandwidth in continuous mode, 1.0 s response and a scan speed of 100 nm min−1 . .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated.

    Article Title: Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes
    Article Snippet: ToxT was purified using the IMPACT-CN fusion protein system (New England Biolabs). .. Full-length ToxT was cloned from Vibrio cholerae O395 and ligated into pTXB1 (New England Biolabs) to produce a toxT-intein/CBD (chitin binding domain) fusion construct. .. ToxT was expressed by autoinduction ( ) in ZYM-5052 media using BL21-CodonPlus® (DE3)-RIL (Stratagene) E. coli .

    Article Title: Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis
    Article Snippet: For in vivo binding assays, full-length mRev1 and mDinB cDNAs were cloned in pCMV-Myc or pCMV-HA (Clontech) to produce Myc or HA fusion proteins. .. For preparation of mPolκ expression vector, the mouse DinB cDNA was subcloned into the Nde I site of the pET-16b vector (Novagen) or Nde I and Sap I sites of the IMPACT-CN system vector pTXB1 (New England Biolabs).

    Article Title: Using S-adenosyl-L-homocysteine capture compounds to characterize S-adenosyl-L-methionine and S-adenosyl-L-homocysteine binding proteins
    Article Snippet: The human SAHH open reading frame (Invitrogen, cat. no. IOH14308) was subcloned into pTXB1 vector (NEB) using Nde I and Sap I restriction sites. .. Following bacterial cell lysis by French press in 25 mM Hepes (pH 7.5), 500 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM tris(2-carboxyethyl)phosphine, and 10% glycerol, SAHH protein was purified according to the standard protocol from the IMPACT (Intein Mediated Purification with an Affinity Chitin-binding Tag) kit (NEB).

    Agarose Gel Electrophoresis:

    Article Title: Semi-Synthesis and Analysis of Chemically Modified Zif268 Zinc-Finger Domains
    Article Snippet: After amplifying the desired DNA fragment of the two zinc-finger domains (632–827) by polymerase chain reaction (PCR) using the forward 5‘ GGTGGTGCTAGCGAACGCCCATATGCTTGCCCTG3’ and reverse 5‘ GGTGGTTGCTCTTCCGCAGTCCTTCTGTCTTAAATGGATTTTG3’ primers from Sigma–Aldrich (Taufkirchen, Germany), and purification by agarose-gel electrophoresis, the fragment was ligated into the cloning vector pGEM-T from Promega (Mannheim, Germany). .. After digestion of the cloning vector pGEM-T and expression vector pTXB1 from New England Biolabs (Ipswich, USA), using the restriction enzymes SapI and NheI, the DNA insert and vector were subsequently ligated.

    Produced:

    Article Title: Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O-demethylase crystals by the microseeding method
    Article Snippet: LigM was produced with an intein–chitin-binding domain (intein-CBD) tag. .. An expression plasmid for LigM (GenBank ; Abe et al. , 2005 ; Masai et al. , 2012 ) was constructed using the pTXB1 vector (New England Biolabs).

    Article Title: Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes
    Article Snippet: Full-length ToxT was cloned from Vibrio cholerae O395 and ligated into pTXB1 (New England Biolabs) to produce a toxT-intein/CBD (chitin binding domain) fusion construct. .. Full-length ToxT was cloned from Vibrio cholerae O395 and ligated into pTXB1 (New England Biolabs) to produce a toxT-intein/CBD (chitin binding domain) fusion construct.

    Concentration Assay:

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance. .. The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance.

    DNA Purification:

    Article Title: Site-specific protein double labeling by expressed protein ligation: applications to repeat proteins
    Article Snippet: pTXB1 and pETM13 plasmids were respectively obtained from New England Biolabs and European Molecular Biology Laboratory. pProEXHTa vector containing the gene construct coding CTPR3 (360 bp) cloned between BamHI and HindIII sites (pProExHTa- ctpr3 ) has been previously described. .. All restriction and modification enzymes were purchased from New England Biolabs, except for PfuTurbo DNA Polymerase (Stratagene) and restriction enzyme SacI (Roche).

    Marker:

    Article Title: Glioma Dual-Targeting Nanohybrid Protein Toxin Constructed by Intein-Mediated Site-Specific Ligation for Multistage Booster Delivery
    Article Snippet: The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (UK). .. The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (UK).

    Article Title: Intein-mediated site-specific synthesis of tumor-targeting protein delivery system: Turning PEG dilemma into prodrug-like feature
    Article Snippet: The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (England). .. The IMPACT (Intein-mediated purification with affinity chitin-binding tag) system, including the expressing vector pTXB1 and chitin resin, was obtained from New England Biolabs (England).

    Gel Extraction:

    Article Title: A Biochemical Analysis of the Interaction of Porphyromonas gingivalis HU PG0121 Protein with DNA
    Article Snippet: The PCR products were amplified using Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) prior to digestion with the restriction enzymes NdeI and SapI (New England Biolabs) and subsequent purification using the QIAquick Gel Extraction Kit (Qiagen). .. The HU PG0121 amplicon was then ligated into pTXB1 (New England Biolabs) at the NdeI and SapI sites, transformed into E. coli ER2566 cells and selected for ampicillin resistance.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs ptxb1
    Ptxb1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptxb1/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ptxb1 - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    Image Search Results