ssdna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    M13mp18 Single stranded DNA
    Description:
    M13mp18 Single stranded DNA 10 ug
    Catalog Number:
    N4040S
    Price:
    42
    Category:
    Genomic DNA
    Size:
    10 ug
    Buy from Supplier


    Structured Review

    New England Biolabs ssdna
    M13mp18 Single stranded DNA
    M13mp18 Single stranded DNA 10 ug
    https://www.bioz.com/result/ssdna/product/New England Biolabs
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ssdna - by Bioz Stars, 2021-04
    98/100 stars

    Images

    1) Product Images from "Wss1 metalloprotease partners with Cdc48/Doa1 in processing genotoxic SUMO conjugates"

    Article Title: Wss1 metalloprotease partners with Cdc48/Doa1 in processing genotoxic SUMO conjugates

    Journal: eLife

    doi: 10.7554/eLife.06763

    Proposed mechanism for the regulation of Wss1 protease activity by cysteine switch mechanism. ( I ) Mechanism of Wss1 activation by thiol-reactive electrophiles. (a) Modification of the regulatory cysteine by thiram (Th) or APMA displaces the cysteine from the active site Zn, activates the metalloprotease and induces in-cis Wss1 cleavage. (b) Activated Wss1 may also proteolyze other Wss1 molecules acting in-trans as endopeptidase or caboxypeptidase. (c) In-trans proteolysis results in gradual degradation of Wss1 pool, the most persistent fragment being a compact WLM domain. ( II ) Activation of Wss1 proteolysis by ssDNA. The DNA may act in two ways. (a) First, interaction of a positively charged WLM domain with DNA may induce conformational changes facilitating displacement of the negatively charged C-terminal peptide with an inhibitory cysteine from the active site. This may promote the initial event of Wss1 activation. The process is not efficient and can be reversed by thiols such as DTT and glutathione ( Figure 3D ). (b) Then, DNA may facilitate Wss1 intermolecular interaction and greatly promote in-trans proteolysis. (c) This results in rapid propagation of proteolytic activity and degradation of the Wss1 pool. ( III ) Cooperative mechanism. The DNA may induce Wss1 oligomerization (a), whereby initial in-cis cleavage (b) is followed by in-trans proteolysis of the whole oligomer (c). DOI: http://dx.doi.org/10.7554/eLife.06763.010
    Figure Legend Snippet: Proposed mechanism for the regulation of Wss1 protease activity by cysteine switch mechanism. ( I ) Mechanism of Wss1 activation by thiol-reactive electrophiles. (a) Modification of the regulatory cysteine by thiram (Th) or APMA displaces the cysteine from the active site Zn, activates the metalloprotease and induces in-cis Wss1 cleavage. (b) Activated Wss1 may also proteolyze other Wss1 molecules acting in-trans as endopeptidase or caboxypeptidase. (c) In-trans proteolysis results in gradual degradation of Wss1 pool, the most persistent fragment being a compact WLM domain. ( II ) Activation of Wss1 proteolysis by ssDNA. The DNA may act in two ways. (a) First, interaction of a positively charged WLM domain with DNA may induce conformational changes facilitating displacement of the negatively charged C-terminal peptide with an inhibitory cysteine from the active site. This may promote the initial event of Wss1 activation. The process is not efficient and can be reversed by thiols such as DTT and glutathione ( Figure 3D ). (b) Then, DNA may facilitate Wss1 intermolecular interaction and greatly promote in-trans proteolysis. (c) This results in rapid propagation of proteolytic activity and degradation of the Wss1 pool. ( III ) Cooperative mechanism. The DNA may induce Wss1 oligomerization (a), whereby initial in-cis cleavage (b) is followed by in-trans proteolysis of the whole oligomer (c). DOI: http://dx.doi.org/10.7554/eLife.06763.010

    Techniques Used: Activity Assay, Activation Assay, Modification, Activated Clotting Time Assay

    SUMO-dependent extraction of proteins from the chromatin. ( A ) ssDNA-activated SUMO E3 ligase sumoylates DNA-bound protein and induces its dissociation. ( B ) Delay in dissociation results in SUMO chain formation through multiple rounds of protein sumoylation. Subsequent ubiqutylation b y STUbL promotes Cdc48/Npl4/Ufd1 loading, protein extraction and degradation via proteasome. ( C ) When the extraction is compromised (e.g., covalent protein–DNA adduct), the protein is processed by Cdc48/Wss1/Doa1 complex. Wss1 is targeted to sumoylated protein via its SIMs and promotes extension of SUMO chain that in return could further stimulate Wss1 accumulation and oligomerization at the site of DNA damage (Wss1 foci). Binding to ssDNA and oligomerization triggers metalloprotease activity of Wss1 and initiates substrate processing. The process is assisted by Cdc48 and Doa1 and finally ends in the vacuole. DOI: http://dx.doi.org/10.7554/eLife.06763.033
    Figure Legend Snippet: SUMO-dependent extraction of proteins from the chromatin. ( A ) ssDNA-activated SUMO E3 ligase sumoylates DNA-bound protein and induces its dissociation. ( B ) Delay in dissociation results in SUMO chain formation through multiple rounds of protein sumoylation. Subsequent ubiqutylation b y STUbL promotes Cdc48/Npl4/Ufd1 loading, protein extraction and degradation via proteasome. ( C ) When the extraction is compromised (e.g., covalent protein–DNA adduct), the protein is processed by Cdc48/Wss1/Doa1 complex. Wss1 is targeted to sumoylated protein via its SIMs and promotes extension of SUMO chain that in return could further stimulate Wss1 accumulation and oligomerization at the site of DNA damage (Wss1 foci). Binding to ssDNA and oligomerization triggers metalloprotease activity of Wss1 and initiates substrate processing. The process is assisted by Cdc48 and Doa1 and finally ends in the vacuole. DOI: http://dx.doi.org/10.7554/eLife.06763.033

    Techniques Used: Protein Extraction, Binding Assay, Activity Assay

    2) Product Images from "Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site"

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site

    Journal: Journal of Virology

    doi: 10.1128/JVI.02264-13

    Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was
    Figure Legend Snippet: Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was

    Techniques Used: Labeling, Purification

    Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was
    Figure Legend Snippet: Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was

    Techniques Used: Labeling, Purification

    3) Product Images from "RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants"

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms18122546

    Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.
    Figure Legend Snippet: Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.

    Techniques Used: Binding Assay, Activity Assay, In Vitro, Purification, Recombinant, Incubation, Luciferase, Electrophoretic Mobility Shift Assay, Negative Control, Marker

    4) Product Images from "Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site"

    Article Title: Viroplasm Protein P9-1 of Rice Black-Streaked Dwarf Virus Preferentially Binds to Single-Stranded RNA in Its Octamer Form, and the Central Interior Structure Formed by This Octamer Constitutes the Major RNA Binding Site

    Journal: Journal of Virology

    doi: 10.1128/JVI.02264-13

    Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was
    Figure Legend Snippet: Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was

    Techniques Used: Labeling, Purification

    Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was
    Figure Legend Snippet: Competition and specificity assays of P9-1. (A) Increasing amounts of unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol DIG-labeled S9-1900nt ssRNA; 4.6 μmol of purified P9-1 was added to each sample, and the sample was

    Techniques Used: Labeling, Purification

    Related Articles

    Plasmid Preparation:

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ
    Article Snippet: The DNA substrate for electrochemistry consisted of a 49:58-mer primer-template composed of three oligomers: a 20-mer with a 3′ thiol modification, a 38-mer, and a 49-mer complement; sequences are as follows (see also ): 20-mer Thiol: 5′ - GCT GTC GTA CAG CTC AAT GC - 3′ - (CH2 )2 O(CH2 )3 SH 38-mer: 5′ - TAA CAG GTT GAT GCA TCG CGC TTC GGT GCT GCG TGT CT - 3′ 49-mer: 5′ - GCA TTG AGC TGT ACG ACA GCA GAC ACG CAG CAC CGA AGC GCG ATG CAT C - 3′ The bold G of the 49-mer was changed to an A or an abasic (AP) site for CA mismatch and abasic site discrimination experiments. .. DNA replication assays used single-stranded M13mp18 plasmid purchased from New England Biolabs (NEB). .. Primers were purchased from IDT and purified by HPLC as described above.

    other:

    Article Title: The M184V Mutation Reduces the Selective Excision of Zidovudine 5?-Monophosphate (AZTMP) by the Reverse Transcriptase of Human Immunodeficiency Virus Type 1
    Article Snippet: The −47 primer was annealed to single-stranded M13mp18 DNA.

    Article Title: Mathematical model to reduce loop mediated isothermal amplification (LAMP) false‐positive diagnosis
    Article Snippet: This process began with identifying the size and location of each primer and the number of nucleotides between them within the M13mp18 template DNA for the first primer set (Fig. and Table ).

    Purification:

    Article Title: YADD Mutants of Human Immunodeficiency Virus Type 1 and Moloney Murine Leukemia Virus Reverse Transcriptase Are Resistant to Lamivudine Triphosphate (3TCTP) In Vitro
    Article Snippet: Briefly, −47 sequencing primer (New England Biolabs) was 5′ end labeled with [γ-32 P]ATP and T4 polynucleotide kinase. .. After purification, the labeled primer was annealed to single-stranded M13mp18 DNA (New England Biolabs) by heating and slow cooling. .. For each sample, 1.0 μg of wild-type MLV RT or MLV RT variant was added to the labeled template-primer in 25 mM Tris-Cl (pH 8.0)–30 mM KCl–8.0 mM MgCl2 –2.0 mM DTT–100 μg of BSA per ml–10.0 mM CHAPS.

    Labeling:

    Article Title: YADD Mutants of Human Immunodeficiency Virus Type 1 and Moloney Murine Leukemia Virus Reverse Transcriptase Are Resistant to Lamivudine Triphosphate (3TCTP) In Vitro
    Article Snippet: Briefly, −47 sequencing primer (New England Biolabs) was 5′ end labeled with [γ-32 P]ATP and T4 polynucleotide kinase. .. After purification, the labeled primer was annealed to single-stranded M13mp18 DNA (New England Biolabs) by heating and slow cooling. .. For each sample, 1.0 μg of wild-type MLV RT or MLV RT variant was added to the labeled template-primer in 25 mM Tris-Cl (pH 8.0)–30 mM KCl–8.0 mM MgCl2 –2.0 mM DTT–100 μg of BSA per ml–10.0 mM CHAPS.

    Generated:

    Article Title: Active displacement of RecA filaments by UvrD translocase activity
    Article Snippet: DNA substrates M13mp18 circular ssDNA was purified as previously described ( ). .. M13mp18 linear ssDNA was generated by annealing a primer (ACTCTAGAGGATCCCCGGGTAC) to the virion DNA and incubating with BamHI restriction enzyme (New England Biolabs, R0136). .. The DNA was purified by phenol-chloroform extraction and ethanol precipitation.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs single stranded m13mp18 dna
    Inhibition of polymerase activity by AZTTP and 3TCTP. The four HIV-1 RTs used in the subsequent experiments (wild-type [WT], M184V, AZT-21, and M184V/AZT-21) were tested for inhibition by AZTTP and 3TCTP. To simplify the comparisons, the activities of each of the enzymes were normalized to 100%. Various concentrations of AZTTP and 3TCTP were added to polymerization reactions containing a −47 sequencing primer annealed to an <t>M13mp18</t> <t>DNA</t> template (see Materials and Methods). After 30 min, the reactions were stopped by the addition of trichloroacetic acid and the newly synthesized DNA was collected on Whatman GF/C filters. Panel A shows the effects of adding AZTTP to the polymerization reactions; panel B shows the effects of adding 3TCTP.
    Single Stranded M13mp18 Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded m13mp18 dna/product/New England Biolabs
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    single stranded m13mp18 dna - by Bioz Stars, 2021-04
    98/100 stars
      Buy from Supplier

    Image Search Results


    Inhibition of polymerase activity by AZTTP and 3TCTP. The four HIV-1 RTs used in the subsequent experiments (wild-type [WT], M184V, AZT-21, and M184V/AZT-21) were tested for inhibition by AZTTP and 3TCTP. To simplify the comparisons, the activities of each of the enzymes were normalized to 100%. Various concentrations of AZTTP and 3TCTP were added to polymerization reactions containing a −47 sequencing primer annealed to an M13mp18 DNA template (see Materials and Methods). After 30 min, the reactions were stopped by the addition of trichloroacetic acid and the newly synthesized DNA was collected on Whatman GF/C filters. Panel A shows the effects of adding AZTTP to the polymerization reactions; panel B shows the effects of adding 3TCTP.

    Journal: Journal of Virology

    Article Title: The M184V Mutation Reduces the Selective Excision of Zidovudine 5?-Monophosphate (AZTMP) by the Reverse Transcriptase of Human Immunodeficiency Virus Type 1

    doi: 10.1128/JVI.76.7.3248-3256.2002

    Figure Lengend Snippet: Inhibition of polymerase activity by AZTTP and 3TCTP. The four HIV-1 RTs used in the subsequent experiments (wild-type [WT], M184V, AZT-21, and M184V/AZT-21) were tested for inhibition by AZTTP and 3TCTP. To simplify the comparisons, the activities of each of the enzymes were normalized to 100%. Various concentrations of AZTTP and 3TCTP were added to polymerization reactions containing a −47 sequencing primer annealed to an M13mp18 DNA template (see Materials and Methods). After 30 min, the reactions were stopped by the addition of trichloroacetic acid and the newly synthesized DNA was collected on Whatman GF/C filters. Panel A shows the effects of adding AZTTP to the polymerization reactions; panel B shows the effects of adding 3TCTP.

    Article Snippet: The −47 primer was annealed to single-stranded M13mp18 DNA.

    Techniques: Inhibition, Activity Assay, Sequencing, Synthesized

    Relative efficiency of AZTMP incorporation or excision at various positions. The abilities of the various HIV-1 RTs to be blocked by AZTMP incorporation at various positions on an M13mp18 template were compared at various concentrations of ATP (see Materials and Methods). The primer was labeled with 32 P, and the reaction products were fractionated by electrophoresis on a 6% polyacrylamide gel. On the left is a scale showing the sizes of the DNA products. Arrows on the right indicate positions at which the excision efficiency differs for the RT mutants.

    Journal: Journal of Virology

    Article Title: The M184V Mutation Reduces the Selective Excision of Zidovudine 5?-Monophosphate (AZTMP) by the Reverse Transcriptase of Human Immunodeficiency Virus Type 1

    doi: 10.1128/JVI.76.7.3248-3256.2002

    Figure Lengend Snippet: Relative efficiency of AZTMP incorporation or excision at various positions. The abilities of the various HIV-1 RTs to be blocked by AZTMP incorporation at various positions on an M13mp18 template were compared at various concentrations of ATP (see Materials and Methods). The primer was labeled with 32 P, and the reaction products were fractionated by electrophoresis on a 6% polyacrylamide gel. On the left is a scale showing the sizes of the DNA products. Arrows on the right indicate positions at which the excision efficiency differs for the RT mutants.

    Article Snippet: The −47 primer was annealed to single-stranded M13mp18 DNA.

    Techniques: Labeling, Electrophoresis

    Low dNTP extension assay. The ability of the various enzymes to extend the −47 primer on an M13mp18 template was measured at a final concentration of either 0.1 or 0.5 μM each of the four dNTPs. The reactions were run as a time course with samples taken at 15, 30, and 60 min (see Materials and Methods). The reaction products were fractionated on a 6% polyacrylamide gel, and the DNA products were visualized by autoradiography. The scale at the left shows the sizes of the products. WT, wild type.

    Journal: Journal of Virology

    Article Title: The M184V Mutation Reduces the Selective Excision of Zidovudine 5?-Monophosphate (AZTMP) by the Reverse Transcriptase of Human Immunodeficiency Virus Type 1

    doi: 10.1128/JVI.76.7.3248-3256.2002

    Figure Lengend Snippet: Low dNTP extension assay. The ability of the various enzymes to extend the −47 primer on an M13mp18 template was measured at a final concentration of either 0.1 or 0.5 μM each of the four dNTPs. The reactions were run as a time course with samples taken at 15, 30, and 60 min (see Materials and Methods). The reaction products were fractionated on a 6% polyacrylamide gel, and the DNA products were visualized by autoradiography. The scale at the left shows the sizes of the products. WT, wild type.

    Article Snippet: The −47 primer was annealed to single-stranded M13mp18 DNA.

    Techniques: Concentration Assay, Autoradiography

    Extension assay for HIV-1 RT, MLV RT, and the MLV RT mutants V223M, V223I, and V223A. The −47 sequencing primer was phosphorylated with [γ- 32 P]ATP, purified, and hybridized to M13mp18 DNA. Polymerization reactions were allowed to proceed for 10 min at 37°C and stopped by phenol-chloroform extraction (see Materials and Methods). The DNA was recovered by isopropanol precipitation and fractionated on a 6% polyacrylamide gel. Bands were visualized by autoradiography (see Materials and Methods). All reactions were done as duplicates (lanes 1 and 2), the nature of the RT used in the reactions is given above each lane. The sizes of DNA molecular weight markers are given on the left side. WT, wild type.

    Journal: Journal of Virology

    Article Title: YADD Mutants of Human Immunodeficiency Virus Type 1 and Moloney Murine Leukemia Virus Reverse Transcriptase Are Resistant to Lamivudine Triphosphate (3TCTP) In Vitro

    doi: 10.1128/JVI.75.14.6321-6328.2001

    Figure Lengend Snippet: Extension assay for HIV-1 RT, MLV RT, and the MLV RT mutants V223M, V223I, and V223A. The −47 sequencing primer was phosphorylated with [γ- 32 P]ATP, purified, and hybridized to M13mp18 DNA. Polymerization reactions were allowed to proceed for 10 min at 37°C and stopped by phenol-chloroform extraction (see Materials and Methods). The DNA was recovered by isopropanol precipitation and fractionated on a 6% polyacrylamide gel. Bands were visualized by autoradiography (see Materials and Methods). All reactions were done as duplicates (lanes 1 and 2), the nature of the RT used in the reactions is given above each lane. The sizes of DNA molecular weight markers are given on the left side. WT, wild type.

    Article Snippet: After purification, the labeled primer was annealed to single-stranded M13mp18 DNA (New England Biolabs) by heating and slow cooling.

    Techniques: Sequencing, Purification, Autoradiography, Molecular Weight

    Effects of 3TCTP on polymerization of HIV-1 RT, MLV RT, and the MLV RT mutants V223M, V223I, and V223A. Polymerization assays were performed with M13mp18 DNA as a template in the presence of [α- 32 P]dCTP (see Materials and Methods). dATP, dGTP, and dTTP were present at a concentration of 10 μM, and the dCTP concentration was 5 μM. Increasing amounts of 3TCTP were added to the reactions. The reactions were allowed to proceed for 30 min and were stopped by the addition of ice-cold TCA; the DNA was collected on GF/C glass fiber filters. Radioactivity was measured using a liquid scintillation counter. The enzymes synthesized different amounts of DNA; to simplify the comparisons, the data for each enzyme were normalized. WT, wild type.

    Journal: Journal of Virology

    Article Title: YADD Mutants of Human Immunodeficiency Virus Type 1 and Moloney Murine Leukemia Virus Reverse Transcriptase Are Resistant to Lamivudine Triphosphate (3TCTP) In Vitro

    doi: 10.1128/JVI.75.14.6321-6328.2001

    Figure Lengend Snippet: Effects of 3TCTP on polymerization of HIV-1 RT, MLV RT, and the MLV RT mutants V223M, V223I, and V223A. Polymerization assays were performed with M13mp18 DNA as a template in the presence of [α- 32 P]dCTP (see Materials and Methods). dATP, dGTP, and dTTP were present at a concentration of 10 μM, and the dCTP concentration was 5 μM. Increasing amounts of 3TCTP were added to the reactions. The reactions were allowed to proceed for 30 min and were stopped by the addition of ice-cold TCA; the DNA was collected on GF/C glass fiber filters. Radioactivity was measured using a liquid scintillation counter. The enzymes synthesized different amounts of DNA; to simplify the comparisons, the data for each enzyme were normalized. WT, wild type.

    Article Snippet: After purification, the labeled primer was annealed to single-stranded M13mp18 DNA (New England Biolabs) by heating and slow cooling.

    Techniques: Concentration Assay, Radioactivity, Synthesized

    Activity assays with native and electrochemically oxidized Pol δ DV. ( a ) 190 nM Pol δ DV was oxidized or reduced by bulk electrolysis at potentials of 0.412 V and −0.188 V and subsequently diluted to 2 nM final concentration into reaction mixes containing radiolabeled M13mp18 DNA. ( b, c ) As seen on representative 1% alkaline agarose gels, oxidation lowers activity levels at early time points, while reduction restores activity to native levels. The degree of this effect can be quantified by dividing the amount of DNA synthesis in reactions with oxidized or reduced Pol δ by that from reactions with untreated enzyme. The oxidation yield for the gel shown in b is ~80%. Error bars are standard deviation of the mean (n ≥ 3).

    Journal: Journal of the American Chemical Society

    Article Title: A Redox Role for the [4Fe4S] Cluster of Yeast DNA Polymerase δ

    doi: 10.1021/jacs.7b10284

    Figure Lengend Snippet: Activity assays with native and electrochemically oxidized Pol δ DV. ( a ) 190 nM Pol δ DV was oxidized or reduced by bulk electrolysis at potentials of 0.412 V and −0.188 V and subsequently diluted to 2 nM final concentration into reaction mixes containing radiolabeled M13mp18 DNA. ( b, c ) As seen on representative 1% alkaline agarose gels, oxidation lowers activity levels at early time points, while reduction restores activity to native levels. The degree of this effect can be quantified by dividing the amount of DNA synthesis in reactions with oxidized or reduced Pol δ by that from reactions with untreated enzyme. The oxidation yield for the gel shown in b is ~80%. Error bars are standard deviation of the mean (n ≥ 3).

    Article Snippet: DNA replication assays used single-stranded M13mp18 plasmid purchased from New England Biolabs (NEB).

    Techniques: Activity Assay, Electrolysis, Concentration Assay, DNA Synthesis, Standard Deviation

    Schematic of LAMP primer sites within the M13mp18 template DNA.

    Journal: Electrophoresis

    Article Title: Mathematical model to reduce loop mediated isothermal amplification (LAMP) false‐positive diagnosis

    doi: 10.1002/elps.201900167

    Figure Lengend Snippet: Schematic of LAMP primer sites within the M13mp18 template DNA.

    Article Snippet: This process began with identifying the size and location of each primer and the number of nucleotides between them within the M13mp18 template DNA for the first primer set (Fig. and Table ).

    Techniques: