dsdna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    M13mp18 RF I DNA
    Description:
    M13mp18 RF I DNA 10 ug
    Catalog Number:
    N4018S
    Price:
    87
    Category:
    Genomic DNA
    Size:
    10 ug
    Buy from Supplier


    Structured Review

    New England Biolabs dsdna
    M13mp18 RF I DNA
    M13mp18 RF I DNA 10 ug
    https://www.bioz.com/result/dsdna/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dsdna - by Bioz Stars, 2021-04
    95/100 stars

    Images

    1) Product Images from "RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants"

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms18122546

    Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.
    Figure Legend Snippet: Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.

    Techniques Used: Binding Assay, Activity Assay, In Vitro, Purification, Recombinant, Incubation, Luciferase, Electrophoretic Mobility Shift Assay, Negative Control, Marker

    2) Product Images from "Dna2 Exhibits a Unique Strand End-dependent Helicase Function"

    Article Title: Dna2 Exhibits a Unique Strand End-dependent Helicase Function

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.165191

    Dna2 cannot track on a primed circular long single strand without a free 5′-end. Helicase activity was assayed as described under “Experimental Procedures.” Reactions containing 15 fmol of either ( A ) M13mp18 containing a completely
    Figure Legend Snippet: Dna2 cannot track on a primed circular long single strand without a free 5′-end. Helicase activity was assayed as described under “Experimental Procedures.” Reactions containing 15 fmol of either ( A ) M13mp18 containing a completely

    Techniques Used: Activity Assay

    3) Product Images from "Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection"

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection

    Journal: Nature Communications

    doi: 10.1038/s41467-020-18615-1

    Effect of reporter sequences on trans-cleavage activity, the proposed mechanism of crRNA end processing, enzyme kinetics, and binding affinity of LbCas12a with modified crGFP. a Effect of different types of fluorophore-quencher systems on trans-cleavage activity with various modifications of crRNA. b Interactions of fluorescently labeled crRNAs with LbCas12a and dsDNA activator, characterized by PAGE analysis. In the absence of the activator, the modified crRNA (pre-crRNA) is trimmed by LbCas12a on its 5′-end (the first Uracil is cleaved, so-called truncated-crRNA or tru-crRNA). In the presence of the activator, the crRNA extensions are further trimmed, possibly leaving a 3′overhang. c Schematic diagram of putative processing of crRNA cleavage sites in the presence and absence of activator GFP. d Enzyme kinetic data of LbCas12a with crGFP vs. crGFP + 3′DNA7. e Michaelis-Menten kinetic study of the wild-type crGFP vs. crGFP + 3′DNA7. For this assay, 100 nM of LbCas12a, 100 nM of crRNA, and 7.4 nM of GFP fragment were used. Error bars represent mean ± SD, where n = 3 technical replicates. f Time-dependent cis-cleavage of LbCas12a on GFP in the presence of nonspecific ssDNA M13mp18. The reaction mixture was taken out every 5 min and quenched with 6× SDS-containing loading dye. g Dissociation constants of crGFP vs. crGFP + 3′DNA7. The Kd was determined by the biolayer interferometry binding kinetic assay with R2 > 0.9. Error bars represent ± SD, where n = 5 independent dilutions. Source data are available in the Source Data file.
    Figure Legend Snippet: Effect of reporter sequences on trans-cleavage activity, the proposed mechanism of crRNA end processing, enzyme kinetics, and binding affinity of LbCas12a with modified crGFP. a Effect of different types of fluorophore-quencher systems on trans-cleavage activity with various modifications of crRNA. b Interactions of fluorescently labeled crRNAs with LbCas12a and dsDNA activator, characterized by PAGE analysis. In the absence of the activator, the modified crRNA (pre-crRNA) is trimmed by LbCas12a on its 5′-end (the first Uracil is cleaved, so-called truncated-crRNA or tru-crRNA). In the presence of the activator, the crRNA extensions are further trimmed, possibly leaving a 3′overhang. c Schematic diagram of putative processing of crRNA cleavage sites in the presence and absence of activator GFP. d Enzyme kinetic data of LbCas12a with crGFP vs. crGFP + 3′DNA7. e Michaelis-Menten kinetic study of the wild-type crGFP vs. crGFP + 3′DNA7. For this assay, 100 nM of LbCas12a, 100 nM of crRNA, and 7.4 nM of GFP fragment were used. Error bars represent mean ± SD, where n = 3 technical replicates. f Time-dependent cis-cleavage of LbCas12a on GFP in the presence of nonspecific ssDNA M13mp18. The reaction mixture was taken out every 5 min and quenched with 6× SDS-containing loading dye. g Dissociation constants of crGFP vs. crGFP + 3′DNA7. The Kd was determined by the biolayer interferometry binding kinetic assay with R2 > 0.9. Error bars represent ± SD, where n = 5 independent dilutions. Source data are available in the Source Data file.

    Techniques Used: Activity Assay, Binding Assay, Modification, Labeling, Polyacrylamide Gel Electrophoresis, Kinetic Assay

    4) Product Images from "Characterization of the Endonuclease and ATP-dependent Flap Endo/Exonuclease of Dna2 *"

    Article Title: Characterization of the Endonuclease and ATP-dependent Flap Endo/Exonuclease of Dna2 *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.243071

    Dna2 has endonuclease activity. A , nuclease assays were performed as described under “Experimental Procedures.” Briefly, 50 fmol of yeast Dna2 was incubated with 500 ng of M13mp18 phage ssDNA and MgCl 2 , MnCl 2 , and ATP as indicated for
    Figure Legend Snippet: Dna2 has endonuclease activity. A , nuclease assays were performed as described under “Experimental Procedures.” Briefly, 50 fmol of yeast Dna2 was incubated with 500 ng of M13mp18 phage ssDNA and MgCl 2 , MnCl 2 , and ATP as indicated for

    Techniques Used: Activity Assay, Incubation

    Replication protein A inhibits Dna2 endonuclease. A , endonuclease reactions were performed as described under “Experimental Procedures.” Briefly, RPA, 0, 0.75 μg, or 1.5 μg, was incubated with 100 ng of M13mp18 ssDNA in
    Figure Legend Snippet: Replication protein A inhibits Dna2 endonuclease. A , endonuclease reactions were performed as described under “Experimental Procedures.” Briefly, RPA, 0, 0.75 μg, or 1.5 μg, was incubated with 100 ng of M13mp18 ssDNA in

    Techniques Used: Recombinase Polymerase Amplification, Incubation

    5) Product Images from "Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection"

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection

    Journal: bioRxiv

    doi: 10.1101/2020.04.13.036079

    Mechanism and kinetics of LbCas12a trans-cleavage with modified crGFP. (a) Interactions of fluorescently labeled crRNAs with LbCas12a and dsDNA activator, characterized by PAGE analysis. In the absence of the activator, the modified crRNA (pre-crRNA) is trimmed by LbCas12a on its 5’-end (the first Uracil is cleaved, so-called truncated-crRNA or tru-crRNA). In the presence of the activator, the crRNA extensions are further trimmed, possibly leaving a 3’overhang. (b) Schematic diagram of putative processing of crRNA cleavage sites in the presence and absence of activator GFP. (c) schematic diagram of different cleavage sites in the presence and absence of activator GFP. (c) Enzyme kinetic data of LbCas12a with crGFP vs. crGFP+3’DNA7. (d) Michaelis-Menten kinetic study of the wild-type crGFP vs. crGFP+3’DNA7. For this assay, 100nM of LbCas12a, 100 nM of crRNA, and 7.4 nM of GFP fragment were used. (e) Time-dependent cis-cleavage of LbCas12a on GFP in the presence of nonspecific ssDNA M13mp18. The reaction mixture was taken out every five minutes and quenched with 6X SDS-containing loading dye. (f) Effect of different types of fluorophore-quencher systems on trans-cleavage activity with various modifications of crRNA. (g) Comparison of trans-cleavage activity between precursor crRNA (pre-crRNA) and mature crRNA (tru-crRNA, where the first Uracil on the 5’-end of the crRNA is cleaved by LbCas12a in the absence of the activator). (h) Comparison of trans-cleavage activity between AT-rich extensions and GC-rich extensions of the crRNA. (i) Dissociation constants of crGFP vs. crGFP+3’DNA7. The Kd was determined by the biolayer interferometry binding kinetic assay with R 2 > 0.9. (j) Trans-cleavage activity of different variants of Cas12a. The prefix Lb, As, and Fn stand for Lachnospiraceae bacterium, Acidaminococcus, and Francisella novicida, respectively. (k) Single-point mutations (m1-m20) on the target strand of a dsDNA GFP activator. The heat map displays relative fluorescence intensity normalized to wild-type (WT) activator after 3 hours. Error bars represent ± SEM, where n = 6 replicates. The experiments were repeated at least twice with n = 3 per experiment.
    Figure Legend Snippet: Mechanism and kinetics of LbCas12a trans-cleavage with modified crGFP. (a) Interactions of fluorescently labeled crRNAs with LbCas12a and dsDNA activator, characterized by PAGE analysis. In the absence of the activator, the modified crRNA (pre-crRNA) is trimmed by LbCas12a on its 5’-end (the first Uracil is cleaved, so-called truncated-crRNA or tru-crRNA). In the presence of the activator, the crRNA extensions are further trimmed, possibly leaving a 3’overhang. (b) Schematic diagram of putative processing of crRNA cleavage sites in the presence and absence of activator GFP. (c) schematic diagram of different cleavage sites in the presence and absence of activator GFP. (c) Enzyme kinetic data of LbCas12a with crGFP vs. crGFP+3’DNA7. (d) Michaelis-Menten kinetic study of the wild-type crGFP vs. crGFP+3’DNA7. For this assay, 100nM of LbCas12a, 100 nM of crRNA, and 7.4 nM of GFP fragment were used. (e) Time-dependent cis-cleavage of LbCas12a on GFP in the presence of nonspecific ssDNA M13mp18. The reaction mixture was taken out every five minutes and quenched with 6X SDS-containing loading dye. (f) Effect of different types of fluorophore-quencher systems on trans-cleavage activity with various modifications of crRNA. (g) Comparison of trans-cleavage activity between precursor crRNA (pre-crRNA) and mature crRNA (tru-crRNA, where the first Uracil on the 5’-end of the crRNA is cleaved by LbCas12a in the absence of the activator). (h) Comparison of trans-cleavage activity between AT-rich extensions and GC-rich extensions of the crRNA. (i) Dissociation constants of crGFP vs. crGFP+3’DNA7. The Kd was determined by the biolayer interferometry binding kinetic assay with R 2 > 0.9. (j) Trans-cleavage activity of different variants of Cas12a. The prefix Lb, As, and Fn stand for Lachnospiraceae bacterium, Acidaminococcus, and Francisella novicida, respectively. (k) Single-point mutations (m1-m20) on the target strand of a dsDNA GFP activator. The heat map displays relative fluorescence intensity normalized to wild-type (WT) activator after 3 hours. Error bars represent ± SEM, where n = 6 replicates. The experiments were repeated at least twice with n = 3 per experiment.

    Techniques Used: Modification, Labeling, Polyacrylamide Gel Electrophoresis, Activity Assay, Binding Assay, Kinetic Assay, Fluorescence

    6) Product Images from "96-Well Polycarbonate-Based Microfluidic Titer Plate for High-Throughput Purification of DNA and RNA"

    Article Title: 96-Well Polycarbonate-Based Microfluidic Titer Plate for High-Throughput Purification of DNA and RNA

    Journal:

    doi: 10.1021/ac8002352

    (A) Fluorescence image of an ethidium-stained 3% agarose gel showing the presence of amplicons with sizes of 159, 204, 600, 500 bp for the B. subtilis, S. aureus, E. coli , λ-DNA, respectively, and 381 and 272 bp for M13mp18. The PCR products were
    Figure Legend Snippet: (A) Fluorescence image of an ethidium-stained 3% agarose gel showing the presence of amplicons with sizes of 159, 204, 600, 500 bp for the B. subtilis, S. aureus, E. coli , λ-DNA, respectively, and 381 and 272 bp for M13mp18. The PCR products were

    Techniques Used: Fluorescence, Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    7) Product Images from "Dna2 Exhibits a Unique Strand End-dependent Helicase Function"

    Article Title: Dna2 Exhibits a Unique Strand End-dependent Helicase Function

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.165191

    Dna2 cannot track on a primed circular long single strand without a free 5′-end. Helicase activity was assayed as described under “Experimental Procedures.” Reactions containing 15 fmol of either ( A ) M13mp18 containing a completely
    Figure Legend Snippet: Dna2 cannot track on a primed circular long single strand without a free 5′-end. Helicase activity was assayed as described under “Experimental Procedures.” Reactions containing 15 fmol of either ( A ) M13mp18 containing a completely

    Techniques Used: Activity Assay

    Related Articles

    Generated:

    Article Title: DNA-nanostructure-assembly by sequential spotting
    Article Snippet: Ink was supplied to the tip by a hypodermic needle of Popper & Sons, Inc. (N.Y. 11040 USA). .. DNA preparation The DNA-construct was generated by digesting 10 μg M13mp18 RF I DNA plasmid (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) simultaneously with the restriction enzymes PstI, Acc65I and BamHI (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) in NEBuffer-3 at 37°C for 2 h. Then the enzymes were inactivated by heating the batch to 80°C for 20 minutes and finally cooling down slowly (1 K/min.). .. Parallel to this, hybridization of the adapter segments in Tris-Cl buffer (100 mM Tris-Cl; 600 mM NaCl; pH 7.4) took place by heating the oligonucleotides up to 90°C for 5 minutes (see figure ) and cooling down slowly (1 K/min.).

    Plasmid Preparation:

    Article Title: DNA-nanostructure-assembly by sequential spotting
    Article Snippet: Ink was supplied to the tip by a hypodermic needle of Popper & Sons, Inc. (N.Y. 11040 USA). .. DNA preparation The DNA-construct was generated by digesting 10 μg M13mp18 RF I DNA plasmid (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) simultaneously with the restriction enzymes PstI, Acc65I and BamHI (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) in NEBuffer-3 at 37°C for 2 h. Then the enzymes were inactivated by heating the batch to 80°C for 20 minutes and finally cooling down slowly (1 K/min.). .. Parallel to this, hybridization of the adapter segments in Tris-Cl buffer (100 mM Tris-Cl; 600 mM NaCl; pH 7.4) took place by heating the oligonucleotides up to 90°C for 5 minutes (see figure ) and cooling down slowly (1 K/min.).

    Labeling:

    Article Title: ATP?S Disrupts Human Immunodeficiency Virus Type 1 Virion Core Integrity
    Article Snippet: For each extension assay, 2 pmol of the M13 −47 primer (New England Biolabs) was 5′-end labeled with [γ-32 P]ATP with T4 polynucleotide kinase. .. After incubating at 37°C for 1 h, unincorporated nucleotide was removed by passing the primer through a MicroSpin S-200 HR column and the labeled primer was annealed to 0.25 μg of M13mp18 DNA (New England Biolabs) by heating to 96°C and slowly cooling to room temperature; 0.5 μg of reverse transcriptase was added to the labeled template-primer complex in 25 mM Tris-HCl (pH 8.0)-75 mM KCl-8 mM MgCl2 -2 mM dithiothreitol-100 μg of bovine serum albumin per ml-10 mM CHAPS. ..

    Recombinant:

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants
    Article Snippet: Nucleic Acid-Binding Analysis Gel-shift assays with dsDNA, ssDNA, and luc mRNA substrates were performed as described previously [ ]. .. Recombinant AtUSP or BSA was incubated with ssDNA (M13mp18, NEB), dsDNA (M13mp18 RF I DNA, NEB), and luc mRNA (TriLink Biotechnologies Co., San Diego, CA, USA) in 15 μL binding buffer (10 mM Tris-HCl, pH 7.5) on ice for 30 min. .. The samples were then separated using 0.8% agarose gels, and stained with ethidium bromide to visualize migration shifts.

    Incubation:

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants
    Article Snippet: Nucleic Acid-Binding Analysis Gel-shift assays with dsDNA, ssDNA, and luc mRNA substrates were performed as described previously [ ]. .. Recombinant AtUSP or BSA was incubated with ssDNA (M13mp18, NEB), dsDNA (M13mp18 RF I DNA, NEB), and luc mRNA (TriLink Biotechnologies Co., San Diego, CA, USA) in 15 μL binding buffer (10 mM Tris-HCl, pH 7.5) on ice for 30 min. .. The samples were then separated using 0.8% agarose gels, and stained with ethidium bromide to visualize migration shifts.

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Binding Assay:

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants
    Article Snippet: Nucleic Acid-Binding Analysis Gel-shift assays with dsDNA, ssDNA, and luc mRNA substrates were performed as described previously [ ]. .. Recombinant AtUSP or BSA was incubated with ssDNA (M13mp18, NEB), dsDNA (M13mp18 RF I DNA, NEB), and luc mRNA (TriLink Biotechnologies Co., San Diego, CA, USA) in 15 μL binding buffer (10 mM Tris-HCl, pH 7.5) on ice for 30 min. .. The samples were then separated using 0.8% agarose gels, and stained with ethidium bromide to visualize migration shifts.

    Amplification:

    Article Title: Molecular Threading: Mechanical Extraction, Stretching and Placement of DNA Molecules from a Liquid-Air Interface
    Article Snippet: .. Preparation of long ssDNA using rolling circle amplification 10 µL of 10× reaction buffer (10× phi29 DNA Polymerase Buffer (B7020, Enzymatics, 500 mMTris-HCl, 100 mM (NH4)2SO4, 40 mM DTT, 100 mM MgCl2, pH 7.5), 1 µL of 1 nM M13mp18 template (NEB), 2.5 µL of 100 nM primer ( TCCAACGTCAAAGGGCGAAAAACC , IDT) and 1.6 µL of dNTP mix (Enzymatics N2050L) was brought to a volume of 48 µL in water. .. The mixture was put on ice, and 2 µL of phi29 DNA polymerase (10 U/µL, Enzymatics P7020-LC-L) was added.

    Cleavage Assay:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Activity Assay:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Concentration Assay:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Agarose Gel Electrophoresis:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs dsdna
    Nucleic acid-binding activity of <t>AtUSP</t> in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 <t>dsDNA,</t> or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.
    Dsdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsdna/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dsdna - by Bioz Stars, 2021-04
    95/100 stars
      Buy from Supplier

    Image Search Results


    Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.

    Journal: International Journal of Molecular Sciences

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants

    doi: 10.3390/ijms18122546

    Figure Lengend Snippet: Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.

    Article Snippet: Recombinant AtUSP or BSA was incubated with ssDNA (M13mp18, NEB), dsDNA (M13mp18 RF I DNA, NEB), and luc mRNA (TriLink Biotechnologies Co., San Diego, CA, USA) in 15 μL binding buffer (10 mM Tris-HCl, pH 7.5) on ice for 30 min.

    Techniques: Binding Assay, Activity Assay, In Vitro, Purification, Recombinant, Incubation, Luciferase, Electrophoretic Mobility Shift Assay, Negative Control, Marker

    DNA-construct assembly pathway . The vector M13mp18 (7250 bp) is used to produce a DNA building unit of approximately 5 μm length with an elongated single stranded sticky end at both sides. 1 - 4: Formation of single stranded adapter oligonucleotides. 6, 7: Ligation of adapter elements to form two DNA-constructs that are capable to bind site specific. 8: Hybridization will occur spontaneously and will result in the long DNA-construct.

    Journal: Journal of Nanobiotechnology

    Article Title: DNA-nanostructure-assembly by sequential spotting

    doi: 10.1186/1477-3155-9-54

    Figure Lengend Snippet: DNA-construct assembly pathway . The vector M13mp18 (7250 bp) is used to produce a DNA building unit of approximately 5 μm length with an elongated single stranded sticky end at both sides. 1 - 4: Formation of single stranded adapter oligonucleotides. 6, 7: Ligation of adapter elements to form two DNA-constructs that are capable to bind site specific. 8: Hybridization will occur spontaneously and will result in the long DNA-construct.

    Article Snippet: DNA preparation The DNA-construct was generated by digesting 10 μg M13mp18 RF I DNA plasmid (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) simultaneously with the restriction enzymes PstI, Acc65I and BamHI (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) in NEBuffer-3 at 37°C for 2 h. Then the enzymes were inactivated by heating the batch to 80°C for 20 minutes and finally cooling down slowly (1 K/min.).

    Techniques: Construct, Plasmid Preparation, Ligation, Hybridization

    ATPγS does not inhibit the processivity of HIV-1 reverse transcriptase. With the low deoxynucleoside triphosphate extension assay, HIV-1 reverse transcriptase's ability to extend a radiolabeled primer on single-stranded M13mp18 DNA was assessed

    Journal:

    Article Title: ATP?S Disrupts Human Immunodeficiency Virus Type 1 Virion Core Integrity

    doi: 10.1128/JVI.79.9.5557-5567.2005

    Figure Lengend Snippet: ATPγS does not inhibit the processivity of HIV-1 reverse transcriptase. With the low deoxynucleoside triphosphate extension assay, HIV-1 reverse transcriptase's ability to extend a radiolabeled primer on single-stranded M13mp18 DNA was assessed

    Article Snippet: After incubating at 37°C for 1 h, unincorporated nucleotide was removed by passing the primer through a MicroSpin S-200 HR column and the labeled primer was annealed to 0.25 μg of M13mp18 DNA (New England Biolabs) by heating to 96°C and slowly cooling to room temperature; 0.5 μg of reverse transcriptase was added to the labeled template-primer complex in 25 mM Tris-HCl (pH 8.0)-75 mM KCl-8 mM MgCl2 -2 mM dithiothreitol-100 μg of bovine serum albumin per ml-10 mM CHAPS.

    Techniques:

    a) Illustration of the DNA-enzyme complex captured in a nanopore (left). The base-by-base processive behavior of the ATP-fueled ratcheting enzyme leads to the depicted ionic currents (right) which are discretized to facilitate subsequent analysis (red line). b) Summary analysis of a sequencing run of M13mp18 DNA on an Oxford MinION device demonstrating the available depth of coverage at moderate accuracy. Each data point represents an entire M13 DNA molecule. c) A plot of the mean currents and standard deviations of the 1024 distinct 5-mer sequences, with the full Gaussian distributions of a few example 5-mers shown in blue. d) Depiction of the alignment issues caused by possible detection errors in multiple reads (grey) against the expected ideal current levels (black), including missed levels (red) and extra levels (green).

    Journal: Nature biotechnology

    Article Title: De novo sequencing and variant calling with nanopores using PoreSeq

    doi: 10.1038/nbt.3360

    Figure Lengend Snippet: a) Illustration of the DNA-enzyme complex captured in a nanopore (left). The base-by-base processive behavior of the ATP-fueled ratcheting enzyme leads to the depicted ionic currents (right) which are discretized to facilitate subsequent analysis (red line). b) Summary analysis of a sequencing run of M13mp18 DNA on an Oxford MinION device demonstrating the available depth of coverage at moderate accuracy. Each data point represents an entire M13 DNA molecule. c) A plot of the mean currents and standard deviations of the 1024 distinct 5-mer sequences, with the full Gaussian distributions of a few example 5-mers shown in blue. d) Depiction of the alignment issues caused by possible detection errors in multiple reads (grey) against the expected ideal current levels (black), including missed levels (red) and extra levels (green).

    Article Snippet: M13 Restriction Digest Four micrograms of M13mp18 RFI (New England Biolabs, cat. no. N4018S) DNA were digested with EcoRI restriction enzyme in a 100 microliter reaction volume for 2 hrs at 37C, and then heated for 30 min at 65C to inactivate the enzyme.

    Techniques: Sequencing

    a) Accuracy results of running our code on nanopore data from M13, λ, and E. coli DNA to obtain complete de novo sequences. For M13, error bars indicate the upper and lower bounds for accuracy across 20 random subsets at the given coverage. The green line is the result of error correction and assembly with PBcR using only the 2D basecalled sequences; the red line shows the improvement when we error-correct with the raw data. b) Fraction of single-base variants of M13mp18 correctly called as a function of coverage. Variant sequences were generated by computationally making every possible insertion, deletion, or mutation in the original sequence of M13. A correct call is defined as the original M13 sequences' likelihood being larger than the variant in question. Error bars denote the deviation across 20 random subsets of molecules. c) Variant calling performance of our code on substitution mutations introduced in M13 at a higher frequency of 1%, at a range of coverages. Precision and recall denote the probabilities of false positives and negatives, respectively. The maximum F -score accuracy shown is 99.1% at 16× coverage.

    Journal: Nature biotechnology

    Article Title: De novo sequencing and variant calling with nanopores using PoreSeq

    doi: 10.1038/nbt.3360

    Figure Lengend Snippet: a) Accuracy results of running our code on nanopore data from M13, λ, and E. coli DNA to obtain complete de novo sequences. For M13, error bars indicate the upper and lower bounds for accuracy across 20 random subsets at the given coverage. The green line is the result of error correction and assembly with PBcR using only the 2D basecalled sequences; the red line shows the improvement when we error-correct with the raw data. b) Fraction of single-base variants of M13mp18 correctly called as a function of coverage. Variant sequences were generated by computationally making every possible insertion, deletion, or mutation in the original sequence of M13. A correct call is defined as the original M13 sequences' likelihood being larger than the variant in question. Error bars denote the deviation across 20 random subsets of molecules. c) Variant calling performance of our code on substitution mutations introduced in M13 at a higher frequency of 1%, at a range of coverages. Precision and recall denote the probabilities of false positives and negatives, respectively. The maximum F -score accuracy shown is 99.1% at 16× coverage.

    Article Snippet: M13 Restriction Digest Four micrograms of M13mp18 RFI (New England Biolabs, cat. no. N4018S) DNA were digested with EcoRI restriction enzyme in a 100 microliter reaction volume for 2 hrs at 37C, and then heated for 30 min at 65C to inactivate the enzyme.

    Techniques: Variant Assay, Generated, Mutagenesis, Sequencing