polymerase chain reaction pcr assays  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
    Name:
    PCR Marker
    Description:
    PCR Marker 500 gel lanes
    Catalog Number:
    n3234l
    Price:
    272
    Size:
    500 gel lanes
    Category:
    PCR Molecular Weight Markers
    		Buy from Supplier

    Structured Review

    New England Biolabs polymerase chain reaction pcr assays
    PCR Marker
    PCR Marker 500 gel lanes
    https://www.bioz.com/result/polymerase chain reaction pcr assays/product/New England Biolabs
    Average 98 stars, based on 17101 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr assays - by Bioz Stars, 2020-09
    98/100 stars

    Related Products / Commonly Used Together

    mgcl2
    qiaquick pcr purification kit
    taq dna polymerase
    dntp
    dntps
    taq polymerase
    qiaquick gel extraction kit
    pgem-t easy vector
    pcr purification kit
    template dna
    exosap-it
    gel extraction kit
    pcr amplification
    exonuclease i
    bigdye terminator v3.1 cycle sequencing kit

    Images

    1) Product Images from "Non-lethal genotyping of Tribolium castaneum adults using genomic DNA extracted from wing tissue"

    Article Title: Non-lethal genotyping of Tribolium castaneum adults using genomic DNA extracted from wing tissue

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0182564

    Successful PCRs on genomic DNA extracted from one or both wings by using the custom method. (A) Quantification of successful PCRs on the alpha-tubulin 1 upstream regulatory sequence from five replicates with ten adults each using genomic DNA extracted from one or both wings as template. Significantly more successful PCRs could be performed when only one wing was digested. Error bars represent standard deviation. (B) Exemplary agarose gel electrophoresis images showing the PCR-based amplification of the alpha-tubulin 1 upstream regulatory sequence (ATub’) for ten individual adults using DNA extracted from either one or both wings. The estimated PCR product size is 616 bp. The bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template and in the positive control (+), DNA extracted from the whole body was used as template.
    Figure Legend Snippet: Successful PCRs on genomic DNA extracted from one or both wings by using the custom method. (A) Quantification of successful PCRs on the alpha-tubulin 1 upstream regulatory sequence from five replicates with ten adults each using genomic DNA extracted from one or both wings as template. Significantly more successful PCRs could be performed when only one wing was digested. Error bars represent standard deviation. (B) Exemplary agarose gel electrophoresis images showing the PCR-based amplification of the alpha-tubulin 1 upstream regulatory sequence (ATub’) for ten individual adults using DNA extracted from either one or both wings. The estimated PCR product size is 616 bp. The bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template and in the positive control (+), DNA extracted from the whole body was used as template.

    Techniques Used: Sequencing, Standard Deviation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Marker, Negative Control, Positive Control

    Sequencing of the SB and Prl white allele. (A) Exon / intron structure of the white gene (8,376 bp) with respective primer groups for extraction PCRs. (B) Agarose gel electrophoresis image showing the results for the extraction PCRs. Estimated PCR product size is 616 bp for the alpha-tubulin 1 upstream regulatory sequence control (ATub’), 4,208 bp for the exon 1–6 primer group and 4,295 bp for the exon 6–10 primer group. Bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template. (C) Alignment of the SB and Prl white sequences. Vertical black bars represent sequence deviations, horizontal black lines show insertions / deletions. The red asterisks mark the two mutations that lead to amino acid exchanges (Y437V and G573S).
    Figure Legend Snippet: Sequencing of the SB and Prl white allele. (A) Exon / intron structure of the white gene (8,376 bp) with respective primer groups for extraction PCRs. (B) Agarose gel electrophoresis image showing the results for the extraction PCRs. Estimated PCR product size is 616 bp for the alpha-tubulin 1 upstream regulatory sequence control (ATub’), 4,208 bp for the exon 1–6 primer group and 4,295 bp for the exon 6–10 primer group. Bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template. (C) Alignment of the SB and Prl white sequences. Vertical black bars represent sequence deviations, horizontal black lines show insertions / deletions. The red asterisks mark the two mutations that lead to amino acid exchanges (Y437V and G573S).

    Techniques Used: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker, Negative Control

    2) Product Images from "A patterned anisotropic nanofluidic sieving structure for continuous-flow separation of DNA and proteins"

    Article Title: A patterned anisotropic nanofluidic sieving structure for continuous-flow separation of DNA and proteins

    Journal:

    doi: 10.1038/nnano.2006.206

    O Ogston sieving of short DNA (the PCR marker) through the ANA
    Figure Legend Snippet: O Ogston sieving of short DNA (the PCR marker) through the ANA

    Techniques Used: Polymerase Chain Reaction, Marker

    Related Articles

    Amplification:

    Article Title: Molecular Mapping of PMR1, a Novel Locus Conferring Resistance to Powdery Mildew in Pepper (Capsicum annuum)
    Article Snippet: .. The PCR program was 95°C for 5 min, 35 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 10 min. For genotyping with CAPS marker (CZ2_11628), PCR was performed as mentioned above, but with an extension time of 72°C for 30 s. Amplified PCR products were digested with the restriction enzyme Taq α I according to the manufacturer's protocol (New England Biolabs, Beverly, MA). .. Digested PCR products were separated by gel electrophoresis and observed under a UV transilluminator (Bio-Rad, USA).

    Agarose Gel Electrophoresis:

    Article Title: A citizen science model for implementing statewide educational DNA barcoding
    Article Snippet: .. The PCR temperature cycle on the BioRad model T100 thermocyclers incorporated denaturation at 98°C for 30 s, annealing at 48°C for 30 s, and primer extension at 72°C for 45 s. The cycle was repeated 25–30 times and bracketed by an initial denaturation step at 98°C for 2 min and a concluding extension step at 72°C for 5 min. PCR products were evaluated by 1% agarose gel electrophoresis stained by SYBRSafe (Invitrogen, USA) and compared against size standards in Quick Load PCR Marker #N0475S (New England Biolabs, USA). .. After the student workshops were completed, PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Germany) following the manufacturer’s protocol.

    Fluorescence:

    Article Title: A patterned anisotropic nanofluidic sieving structure for continuous-flow separation of DNA and proteins
    Article Snippet: .. The PCR marker as well as λ DNA–Hind III digest (New England BioLabs, Beverly, MA) were labeled with the intercalating fluorescence dye YOYO-1 (Molecular Probes, Eugene, OR) in TBE 5× buffer. .. The dye to DNA base pair ratio was about 1:2 and the final DNA concentration was about 42.18 μg/ml (PCR) and 104 μg/ml (λ DNA–Hind III digest).

    Labeling:

    Article Title: A patterned anisotropic nanofluidic sieving structure for continuous-flow separation of DNA and proteins
    Article Snippet: .. The PCR marker as well as λ DNA–Hind III digest (New England BioLabs, Beverly, MA) were labeled with the intercalating fluorescence dye YOYO-1 (Molecular Probes, Eugene, OR) in TBE 5× buffer. .. The dye to DNA base pair ratio was about 1:2 and the final DNA concentration was about 42.18 μg/ml (PCR) and 104 μg/ml (λ DNA–Hind III digest).

    Polymerase Chain Reaction:

    Article Title: Association of Attention-Deficit/Hyperactivity Disorder with a Candidate Region for Reading Disabilities on Chromosome 6p
    Article Snippet: .. The G/T polymorphism rs2038137 was genotyped using a standard polymerase chain reaction (PCR; annealing temp 58°C) followed by an analysis with the restriction enzyme BstUI (New England Biolabs, Beverly, Massachusetts). .. PCR primer sequences were as follows: KIAA0319 -8137 F: GGTTGGGAAAAGACACTCAA and KIAA0319 -8137 R: GACGACGAGGAGGAACAAGT.

    Article Title: A citizen science model for implementing statewide educational DNA barcoding
    Article Snippet: .. The PCR temperature cycle on the BioRad model T100 thermocyclers incorporated denaturation at 98°C for 30 s, annealing at 48°C for 30 s, and primer extension at 72°C for 45 s. The cycle was repeated 25–30 times and bracketed by an initial denaturation step at 98°C for 2 min and a concluding extension step at 72°C for 5 min. PCR products were evaluated by 1% agarose gel electrophoresis stained by SYBRSafe (Invitrogen, USA) and compared against size standards in Quick Load PCR Marker #N0475S (New England Biolabs, USA). .. After the student workshops were completed, PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Germany) following the manufacturer’s protocol.

    Article Title: A patterned anisotropic nanofluidic sieving structure for continuous-flow separation of DNA and proteins
    Article Snippet: .. The PCR marker as well as λ DNA–Hind III digest (New England BioLabs, Beverly, MA) were labeled with the intercalating fluorescence dye YOYO-1 (Molecular Probes, Eugene, OR) in TBE 5× buffer. .. The dye to DNA base pair ratio was about 1:2 and the final DNA concentration was about 42.18 μg/ml (PCR) and 104 μg/ml (λ DNA–Hind III digest).

    Article Title: Molecular Mapping of PMR1, a Novel Locus Conferring Resistance to Powdery Mildew in Pepper (Capsicum annuum)
    Article Snippet: .. The PCR program was 95°C for 5 min, 35 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 10 min. For genotyping with CAPS marker (CZ2_11628), PCR was performed as mentioned above, but with an extension time of 72°C for 30 s. Amplified PCR products were digested with the restriction enzyme Taq α I according to the manufacturer's protocol (New England Biolabs, Beverly, MA). .. Digested PCR products were separated by gel electrophoresis and observed under a UV transilluminator (Bio-Rad, USA).

    Marker:

    Article Title: A citizen science model for implementing statewide educational DNA barcoding
    Article Snippet: .. The PCR temperature cycle on the BioRad model T100 thermocyclers incorporated denaturation at 98°C for 30 s, annealing at 48°C for 30 s, and primer extension at 72°C for 45 s. The cycle was repeated 25–30 times and bracketed by an initial denaturation step at 98°C for 2 min and a concluding extension step at 72°C for 5 min. PCR products were evaluated by 1% agarose gel electrophoresis stained by SYBRSafe (Invitrogen, USA) and compared against size standards in Quick Load PCR Marker #N0475S (New England Biolabs, USA). .. After the student workshops were completed, PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Germany) following the manufacturer’s protocol.

    Article Title: A patterned anisotropic nanofluidic sieving structure for continuous-flow separation of DNA and proteins
    Article Snippet: .. The PCR marker as well as λ DNA–Hind III digest (New England BioLabs, Beverly, MA) were labeled with the intercalating fluorescence dye YOYO-1 (Molecular Probes, Eugene, OR) in TBE 5× buffer. .. The dye to DNA base pair ratio was about 1:2 and the final DNA concentration was about 42.18 μg/ml (PCR) and 104 μg/ml (λ DNA–Hind III digest).

    Article Title: Molecular Mapping of PMR1, a Novel Locus Conferring Resistance to Powdery Mildew in Pepper (Capsicum annuum)
    Article Snippet: .. The PCR program was 95°C for 5 min, 35 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 10 min. For genotyping with CAPS marker (CZ2_11628), PCR was performed as mentioned above, but with an extension time of 72°C for 30 s. Amplified PCR products were digested with the restriction enzyme Taq α I according to the manufacturer's protocol (New England Biolabs, Beverly, MA). .. Digested PCR products were separated by gel electrophoresis and observed under a UV transilluminator (Bio-Rad, USA).

    Staining:

    Article Title: A citizen science model for implementing statewide educational DNA barcoding
    Article Snippet: .. The PCR temperature cycle on the BioRad model T100 thermocyclers incorporated denaturation at 98°C for 30 s, annealing at 48°C for 30 s, and primer extension at 72°C for 45 s. The cycle was repeated 25–30 times and bracketed by an initial denaturation step at 98°C for 2 min and a concluding extension step at 72°C for 5 min. PCR products were evaluated by 1% agarose gel electrophoresis stained by SYBRSafe (Invitrogen, USA) and compared against size standards in Quick Load PCR Marker #N0475S (New England Biolabs, USA). .. After the student workshops were completed, PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Germany) following the manufacturer’s protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • polymerase chain reaction pcr assays  (New England Biolabs)
    98
    New England Biolabs polymerase chain reaction pcr assays
    Successful <t>PCRs</t> on genomic DNA extracted from one or both wings by using the custom method. (A) Quantification of successful PCRs on the alpha-tubulin 1 upstream regulatory sequence from five replicates with ten adults each using genomic DNA extracted from one or both wings as template. Significantly more successful PCRs could be performed when only one wing was digested. Error bars represent standard deviation. (B) Exemplary agarose gel electrophoresis images showing the <t>PCR-based</t> amplification of the alpha-tubulin 1 upstream regulatory sequence (ATub’) for ten individual adults using DNA extracted from either one or both wings. The estimated PCR product size is 616 bp. The bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template and in the positive control (+), DNA extracted from the whole body was used as template.
    Polymerase Chain Reaction Pcr Assays, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 16351 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr assays/product/New England Biolabs
    Average 98 stars, based on 16351 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr assays - by Bioz Stars, 2020-09
    98/100 stars
    		  Buy from Supplier

    Image Search Results


    Successful PCRs on genomic DNA extracted from one or both wings by using the custom method. (A) Quantification of successful PCRs on the alpha-tubulin 1 upstream regulatory sequence from five replicates with ten adults each using genomic DNA extracted from one or both wings as template. Significantly more successful PCRs could be performed when only one wing was digested. Error bars represent standard deviation. (B) Exemplary agarose gel electrophoresis images showing the PCR-based amplification of the alpha-tubulin 1 upstream regulatory sequence (ATub’) for ten individual adults using DNA extracted from either one or both wings. The estimated PCR product size is 616 bp. The bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template and in the positive control (+), DNA extracted from the whole body was used as template.

    Journal: PLoS ONE

    Article Title: Non-lethal genotyping of Tribolium castaneum adults using genomic DNA extracted from wing tissue

    doi: 10.1371/journal.pone.0182564

    Figure Lengend Snippet: Successful PCRs on genomic DNA extracted from one or both wings by using the custom method. (A) Quantification of successful PCRs on the alpha-tubulin 1 upstream regulatory sequence from five replicates with ten adults each using genomic DNA extracted from one or both wings as template. Significantly more successful PCRs could be performed when only one wing was digested. Error bars represent standard deviation. (B) Exemplary agarose gel electrophoresis images showing the PCR-based amplification of the alpha-tubulin 1 upstream regulatory sequence (ATub’) for ten individual adults using DNA extracted from either one or both wings. The estimated PCR product size is 616 bp. The bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template and in the positive control (+), DNA extracted from the whole body was used as template.

    Article Snippet: Polymerase chain reaction (PCR) assays All PCRs were performed with the Phusion polymerase (M0530L, New England BioLabs) in 20 μl reactions.

    Techniques: Sequencing, Standard Deviation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Marker, Negative Control, Positive Control

    Sequencing of the SB and Prl white allele. (A) Exon / intron structure of the white gene (8,376 bp) with respective primer groups for extraction PCRs. (B) Agarose gel electrophoresis image showing the results for the extraction PCRs. Estimated PCR product size is 616 bp for the alpha-tubulin 1 upstream regulatory sequence control (ATub’), 4,208 bp for the exon 1–6 primer group and 4,295 bp for the exon 6–10 primer group. Bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template. (C) Alignment of the SB and Prl white sequences. Vertical black bars represent sequence deviations, horizontal black lines show insertions / deletions. The red asterisks mark the two mutations that lead to amino acid exchanges (Y437V and G573S).

    Journal: PLoS ONE

    Article Title: Non-lethal genotyping of Tribolium castaneum adults using genomic DNA extracted from wing tissue

    doi: 10.1371/journal.pone.0182564

    Figure Lengend Snippet: Sequencing of the SB and Prl white allele. (A) Exon / intron structure of the white gene (8,376 bp) with respective primer groups for extraction PCRs. (B) Agarose gel electrophoresis image showing the results for the extraction PCRs. Estimated PCR product size is 616 bp for the alpha-tubulin 1 upstream regulatory sequence control (ATub’), 4,208 bp for the exon 1–6 primer group and 4,295 bp for the exon 6–10 primer group. Bright DNA marker bands (top to bottom) represent 3,000 / 1,000 / 500 bp. In the negative control (–), double-distilled H 2 O was used as template. (C) Alignment of the SB and Prl white sequences. Vertical black bars represent sequence deviations, horizontal black lines show insertions / deletions. The red asterisks mark the two mutations that lead to amino acid exchanges (Y437V and G573S).

    Article Snippet: Polymerase chain reaction (PCR) assays All PCRs were performed with the Phusion polymerase (M0530L, New England BioLabs) in 20 μl reactions.

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker, Negative Control

    O Ogston sieving of short DNA (the PCR marker) through the ANA

    Journal:

    Article Title: A patterned anisotropic nanofluidic sieving structure for continuous-flow separation of DNA and proteins

    doi: 10.1038/nnano.2006.206

    Figure Lengend Snippet: O Ogston sieving of short DNA (the PCR marker) through the ANA

    Article Snippet: The PCR marker as well as λ DNA–Hind III digest (New England BioLabs, Beverly, MA) were labeled with the intercalating fluorescence dye YOYO-1 (Molecular Probes, Eugene, OR) in TBE 5× buffer.

    Techniques: Polymerase Chain Reaction, Marker