pbr322  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    pBR322 Vector
    Description:
    pBR322 Vector 250 ug
    Catalog Number:
    n3033l
    Price:
    294
    Size:
    250 ug
    Category:
    Vectors Plasmids
    Buy from Supplier


    Structured Review

    New England Biolabs pbr322
    pBR322 Vector
    pBR322 Vector 250 ug
    https://www.bioz.com/result/pbr322/product/New England Biolabs
    Average 90 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    pbr322 - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Rational design of an orthogonal tryptophanyl nonsense suppressor tRNA
    Article Snippet: Top10 (for routine cloning) and BL21(DE3)Star chemically competent cells were from Invitrogen (Carlsbad, CA, USA). .. All restriction enzymes, T4 DNA ligase and vector pBR322 were from New England Biolabs (Ipswich, MA, USA).

    Article Title: RNA Binding Domain of Jamestown Canyon Virus S Segment RNAs ▿
    Article Snippet: .. The amplified segment was cloned into the AatII and BspEI sites (underlined above) within the pBR322 vector (New England Biolabs). ..

    Article Title: A molecular clone of Chronic Bee Paralysis Virus (CBPV) causes mortality in honey bee pupae (Apis mellifera)
    Article Snippet: .. The PCR products were purified, cloned into a pBR322 vector backbone by a DNA assembly reaction (NEBuilder, NEB), and transformed in E. coli (strain HB101). .. The complete sequences were verified by Sanger sequencing (Eurofins Genomics).

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: .. In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites. .. The ∼1.2-kb RNA with the pseudoknot sequence, flanked by ∼500 and ∼600 nt, on the 5′ and 3′ halves, respectively, was in vitro transcribed.

    Amplification:

    Article Title: RNA Binding Domain of Jamestown Canyon Virus S Segment RNAs ▿
    Article Snippet: .. The amplified segment was cloned into the AatII and BspEI sites (underlined above) within the pBR322 vector (New England Biolabs). ..

    Stable Transfection:

    Article Title: The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
    Article Snippet: Paragraph title: Stable transfection of NIKS cells and establishment of clonal cell lines. ... Five micrograms of recombinant, wild-type, or L2 mutant HPV31a plasmid was digested with EcoRI to release from the pBR322 bacterial vector, the EcoRI was then heat inactivated, the digest was diluted to 2.5 μg per ml in 1× ligase buffer, 10,000 U of T4 ligase (New England Biolabs, Beverly, Mass.) was added, and the solution was incubated at 16°C overnight.

    Synthesized:

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: .. In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites. .. The ∼1.2-kb RNA with the pseudoknot sequence, flanked by ∼500 and ∼600 nt, on the 5′ and 3′ halves, respectively, was in vitro transcribed.

    Construct:

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: Paragraph title: Preparation of RNA and single-molecule constructs ... In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites.

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ). .. The construct was linearized by Not I digestion, separated in agarose gel and recovered by electroelution.

    SYBR Green Assay:

    Article Title: Human Topoisomerase III? Is a Single-stranded DNA Decatenase That Is Stimulated by BLM and RMI1 *
    Article Snippet: pBR322 (21 fmol) (N3033S, New England Biolabs) was incubated with the indicated proteins in 15 μl of reaction buffer containing 50 m m Tris-HCl (pH 7.5), 40 m m NaCl, 5 m m MgCl2 , 1 m m DTT, and 0.1 mg/ml BSA at 37 °C for 30 min. .. Samples were subjected to 1% agarose gel electrophoresis in TAE buffer with buffer re-circularization at 70 V for 16 h. The gels were stained with SYBR Green I (S-7563; Invitrogen) for 30 min and visualized under UV light.

    Incubation:

    Article Title: Human Topoisomerase III? Is a Single-stranded DNA Decatenase That Is Stimulated by BLM and RMI1 *
    Article Snippet: .. pBR322 (21 fmol) (N3033S, New England Biolabs) was incubated with the indicated proteins in 15 μl of reaction buffer containing 50 m m Tris-HCl (pH 7.5), 40 m m NaCl, 5 m m MgCl2 , 1 m m DTT, and 0.1 mg/ml BSA at 37 °C for 30 min. ..

    Article Title: The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
    Article Snippet: .. Five micrograms of recombinant, wild-type, or L2 mutant HPV31a plasmid was digested with EcoRI to release from the pBR322 bacterial vector, the EcoRI was then heat inactivated, the digest was diluted to 2.5 μg per ml in 1× ligase buffer, 10,000 U of T4 ligase (New England Biolabs, Beverly, Mass.) was added, and the solution was incubated at 16°C overnight. .. The ligation was diluted to 10 ml with buffer PB (QIAGEN, Valencia, Calif.) and then aspirated through a mini-prep column (QIAGEN).

    Modification:

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: .. In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites. .. The ∼1.2-kb RNA with the pseudoknot sequence, flanked by ∼500 and ∼600 nt, on the 5′ and 3′ halves, respectively, was in vitro transcribed.

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: .. A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ). .. The construct was linearized by Not I digestion, separated in agarose gel and recovered by electroelution.

    Transformation Assay:

    Article Title: A molecular clone of Chronic Bee Paralysis Virus (CBPV) causes mortality in honey bee pupae (Apis mellifera)
    Article Snippet: .. The PCR products were purified, cloned into a pBR322 vector backbone by a DNA assembly reaction (NEBuilder, NEB), and transformed in E. coli (strain HB101). .. The complete sequences were verified by Sanger sequencing (Eurofins Genomics).

    Transfection:

    Article Title: A System for the Analysis of BKV Non-coding Control Regions: Application to Clinical Isolates from an HIV/AIDS Patient
    Article Snippet: Paragraph title: Transfections ... The viral genome was excised from the pBR322 vector by BamHI (New England Biolabs, Ipswich, MA) digestion and then recirularized at a concentration of 10 ng/μL using T4 DNA ligase (New England Biolabs, Ipswich, MA).

    Ligation:

    Article Title: Mechanisms of HCV NS3 Helicase Monitored by Optical Tweezers
    Article Snippet: Adjust pH to 7.5 at 25°C with HCl and store at 4°C. pBR322 plasmid vector (New England Biolabs). .. DNA Quick ligation kit (New England Biolabs).

    Article Title: The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
    Article Snippet: Five micrograms of recombinant, wild-type, or L2 mutant HPV31a plasmid was digested with EcoRI to release from the pBR322 bacterial vector, the EcoRI was then heat inactivated, the digest was diluted to 2.5 μg per ml in 1× ligase buffer, 10,000 U of T4 ligase (New England Biolabs, Beverly, Mass.) was added, and the solution was incubated at 16°C overnight. .. The ligation was diluted to 10 ml with buffer PB (QIAGEN, Valencia, Calif.) and then aspirated through a mini-prep column (QIAGEN).

    Generated:

    Article Title: A molecular clone of Chronic Bee Paralysis Virus (CBPV) causes mortality in honey bee pupae (Apis mellifera)
    Article Snippet: Full-length PCR amplicons were generated using primers corresponding to the correct 5′- and 3′-ends (CPV8 and CPV9 for RNA1 as well as CPV24 and CPV25 for RNA2). .. The PCR products were purified, cloned into a pBR322 vector backbone by a DNA assembly reaction (NEBuilder, NEB), and transformed in E. coli (strain HB101).

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites. .. The corresponding ∼500-bp (handle A) and ∼600-bp (handle B) DNA sequences were generated by PCR.

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: Retn -Cre mice were generated using bacterial artificial chromosome (BAC) modification methods. .. A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ).

    Imaging:

    Article Title: Sulfide (Na2S) and Polysulfide (Na2S2) Interacting with Doxycycline Produce/Scavenge Superoxide and Hydroxyl Radicals and Induce/Inhibit DNA Cleavage
    Article Snippet: 4.4. pDNA Cleavage Assay The pBR322 plasmid (N3033L, New England BioLabs Inc., Frankfurt, Germany) was used in pDNA cleavage assay that was performed according to our previous report [ ]. .. The samples were electrophoresed in TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM EDTA, pH 8.0) at 5.5 V/cm for 2 h. Gels were stained with Gel Red™Nucleic Acid Gel Stain and photographed using the Odyssey Fc Imaging System (LI-COR Biotechnology, Bad Homburg, Germany).

    Sequencing:

    Article Title: RNA Binding Domain of Jamestown Canyon Virus S Segment RNAs ▿
    Article Snippet: The entire S segment of JCV N protein, both vRNA and cRNA, was amplified by reverse transcription-PCR with 5′ and 3′ primers engineered with a flanking AatII site and T7 promoter sequence and a BspEI restriction site. .. The amplified segment was cloned into the AatII and BspEI sites (underlined above) within the pBR322 vector (New England Biolabs).

    Article Title: Copper bis-Dipyridoquinoxaline Is a Potent DNA Intercalator that Induces Superoxide-Mediated Cleavage via the Minor Groove
    Article Snippet: PCR Primer Design Forward and reverse primers for the pBR322 vector (4361 bp) were designed in order to generate a 798 bp sequence (54% GC) by PCR. .. The transcript, which contains four individual CCGG sequences (CpG islands), was produced using PCR (35 cycles) with 1 ng pBR322 plasmid (NEB, N3033L) using 2× MyTaq Red Mix (Bioline) at suitable annealing temperatures for the primer pair.

    Article Title: A molecular clone of Chronic Bee Paralysis Virus (CBPV) causes mortality in honey bee pupae (Apis mellifera)
    Article Snippet: The PCR products were purified, cloned into a pBR322 vector backbone by a DNA assembly reaction (NEBuilder, NEB), and transformed in E. coli (strain HB101). .. The complete sequences were verified by Sanger sequencing (Eurofins Genomics).

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites. .. The ∼1.2-kb RNA with the pseudoknot sequence, flanked by ∼500 and ∼600 nt, on the 5′ and 3′ halves, respectively, was in vitro transcribed.

    Recombinant:

    Article Title: Dataset on the effects of spermidine on linking number differences between histone H1-free and histone H1-bound circular polynucleosomes
    Article Snippet: .. 2.4 Materials Recombinant human histone H2A/H2B dimer, histone H3.1/H4 tetramer, histone H10 , pBR322 vector, Nt.BspQI nicking endonuclease, T4 DNA ligase and Proteinase K were purchased from New England Biolabs Inc. (Singapore). .. QIAquick PCR Purification Kit was obtained from QIAGEN Singapore Pte.

    Article Title: Dataset on the effects of spermidine on linking number differences between histone H1-free and histone H1-bound circular polynucleosomes
    Article Snippet: .. Recombinant human histone H2A/H2B dimer, histone H3.1/H4 tetramer, histone H10 , pBR322 vector, Nt.BspQI nicking endonuclease, T4 DNA ligase and Proteinase K were purchased from New England Biolabs Inc. (Singapore). .. QIAquick PCR Purification Kit was obtained from QIAGEN Singapore Pte.

    Article Title: The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
    Article Snippet: .. Five micrograms of recombinant, wild-type, or L2 mutant HPV31a plasmid was digested with EcoRI to release from the pBR322 bacterial vector, the EcoRI was then heat inactivated, the digest was diluted to 2.5 μg per ml in 1× ligase buffer, 10,000 U of T4 ligase (New England Biolabs, Beverly, Mass.) was added, and the solution was incubated at 16°C overnight. .. The ligation was diluted to 10 ml with buffer PB (QIAGEN, Valencia, Calif.) and then aspirated through a mini-prep column (QIAGEN).

    Cleavage Assay:

    Article Title: Sulfide (Na2S) and Polysulfide (Na2S2) Interacting with Doxycycline Produce/Scavenge Superoxide and Hydroxyl Radicals and Induce/Inhibit DNA Cleavage
    Article Snippet: .. 4.4. pDNA Cleavage Assay The pBR322 plasmid (N3033L, New England BioLabs Inc., Frankfurt, Germany) was used in pDNA cleavage assay that was performed according to our previous report [ ]. ..

    Nucleic Acid Electrophoresis:

    Article Title: Investigation into the antimicrobial action and mechanism of a novel endogenous peptide β-casein 197 from human milk
    Article Snippet: DNA binding assay Gel-retardation experiments were performed using 5 µL of a 25 µg mL−1 pBR322 vector from E. coli (BioLabs, New England). .. Plasmid DNA (pDNA) was exposed to 5 µL of different concentrations of β-casein 197 at 37 °C for 1 h prior to gel electrophoresis of the reaction mixtures through a 0.7% agarose gel in Tris–acetate EDTA buffer.

    Mutagenesis:

    Article Title: The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
    Article Snippet: .. Five micrograms of recombinant, wild-type, or L2 mutant HPV31a plasmid was digested with EcoRI to release from the pBR322 bacterial vector, the EcoRI was then heat inactivated, the digest was diluted to 2.5 μg per ml in 1× ligase buffer, 10,000 U of T4 ligase (New England Biolabs, Beverly, Mass.) was added, and the solution was incubated at 16°C overnight. .. The ligation was diluted to 10 ml with buffer PB (QIAGEN, Valencia, Calif.) and then aspirated through a mini-prep column (QIAGEN).

    Electrophoretic Mobility Shift Assay:

    Article Title: Investigation into the antimicrobial action and mechanism of a novel endogenous peptide β-casein 197 from human milk
    Article Snippet: .. DNA binding assay Gel-retardation experiments were performed using 5 µL of a 25 µg mL−1 pBR322 vector from E. coli (BioLabs, New England). .. Plasmid DNA (pDNA) was exposed to 5 µL of different concentrations of β-casein 197 at 37 °C for 1 h prior to gel electrophoresis of the reaction mixtures through a 0.7% agarose gel in Tris–acetate EDTA buffer.

    Purification:

    Article Title: Dataset on the effects of spermidine on linking number differences between histone H1-free and histone H1-bound circular polynucleosomes
    Article Snippet: 2.4 Materials Recombinant human histone H2A/H2B dimer, histone H3.1/H4 tetramer, histone H10 , pBR322 vector, Nt.BspQI nicking endonuclease, T4 DNA ligase and Proteinase K were purchased from New England Biolabs Inc. (Singapore). .. QIAquick PCR Purification Kit was obtained from QIAGEN Singapore Pte.

    Article Title: Dataset on the effects of spermidine on linking number differences between histone H1-free and histone H1-bound circular polynucleosomes
    Article Snippet: Recombinant human histone H2A/H2B dimer, histone H3.1/H4 tetramer, histone H10 , pBR322 vector, Nt.BspQI nicking endonuclease, T4 DNA ligase and Proteinase K were purchased from New England Biolabs Inc. (Singapore). .. QIAquick PCR Purification Kit was obtained from QIAGEN Singapore Pte.

    Article Title: A molecular clone of Chronic Bee Paralysis Virus (CBPV) causes mortality in honey bee pupae (Apis mellifera)
    Article Snippet: .. The PCR products were purified, cloned into a pBR322 vector backbone by a DNA assembly reaction (NEBuilder, NEB), and transformed in E. coli (strain HB101). .. The complete sequences were verified by Sanger sequencing (Eurofins Genomics).

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ). .. The DNA fragment was purified using Elutip-d column (Whatman, Middlesex, UK), followed by dialysis, and microinjected into pronuclei of fertilized C57BL/6 embryos using standard method at the University Pennsylvania Transgenic Mouse Core Facility.

    Polymerase Chain Reaction:

    Article Title: High-Resolution “Fleezers”: Dual-Trap Optical Tweezers Combined with Single-Molecule Fluorescence Detection
    Article Snippet: Standard thermal cycler for DNA PCR reactions (e.g., Bio-Rad T100, 1861096). .. Nanodrop 2000 UV-Vis spectrophotometer (Thermo Scientific). pBR322 vector (New England Biolabs, N3033S).

    Article Title: Rational design of an orthogonal tryptophanyl nonsense suppressor tRNA
    Article Snippet: All restriction enzymes, T4 DNA ligase and vector pBR322 were from New England Biolabs (Ipswich, MA, USA). .. Wizard SV Gel and PCR cleanup kit were from Promega (Madison, WI, USA).

    Article Title: Copper bis-Dipyridoquinoxaline Is a Potent DNA Intercalator that Induces Superoxide-Mediated Cleavage via the Minor Groove
    Article Snippet: .. The transcript, which contains four individual CCGG sequences (CpG islands), was produced using PCR (35 cycles) with 1 ng pBR322 plasmid (NEB, N3033L) using 2× MyTaq Red Mix (Bioline) at suitable annealing temperatures for the primer pair. .. The sequence length was verified using a 1 Kb DNA ladder.

    Article Title: Dataset on the effects of spermidine on linking number differences between histone H1-free and histone H1-bound circular polynucleosomes
    Article Snippet: 2.4 Materials Recombinant human histone H2A/H2B dimer, histone H3.1/H4 tetramer, histone H10 , pBR322 vector, Nt.BspQI nicking endonuclease, T4 DNA ligase and Proteinase K were purchased from New England Biolabs Inc. (Singapore). .. QIAquick PCR Purification Kit was obtained from QIAGEN Singapore Pte.

    Article Title: Dataset on the effects of spermidine on linking number differences between histone H1-free and histone H1-bound circular polynucleosomes
    Article Snippet: Recombinant human histone H2A/H2B dimer, histone H3.1/H4 tetramer, histone H10 , pBR322 vector, Nt.BspQI nicking endonuclease, T4 DNA ligase and Proteinase K were purchased from New England Biolabs Inc. (Singapore). .. QIAquick PCR Purification Kit was obtained from QIAGEN Singapore Pte.

    Article Title: A molecular clone of Chronic Bee Paralysis Virus (CBPV) causes mortality in honey bee pupae (Apis mellifera)
    Article Snippet: .. The PCR products were purified, cloned into a pBR322 vector backbone by a DNA assembly reaction (NEBuilder, NEB), and transformed in E. coli (strain HB101). .. The complete sequences were verified by Sanger sequencing (Eurofins Genomics).

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites. .. The corresponding ∼500-bp (handle A) and ∼600-bp (handle B) DNA sequences were generated by PCR.

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ). .. Potential founders were identified by genomic PCR for Cre recombinase.

    Mouse Assay:

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: Paragraph title: Mice ... A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ).

    Plasmid Preparation:

    Article Title: High-Resolution “Fleezers”: Dual-Trap Optical Tweezers Combined with Single-Molecule Fluorescence Detection
    Article Snippet: .. Nanodrop 2000 UV-Vis spectrophotometer (Thermo Scientific). pBR322 vector (New England Biolabs, N3033S). .. Lambda phage DNA template (NEB, N3011S).

    Article Title: Rational design of an orthogonal tryptophanyl nonsense suppressor tRNA
    Article Snippet: .. All restriction enzymes, T4 DNA ligase and vector pBR322 were from New England Biolabs (Ipswich, MA, USA). .. Vector pACYCDuet-1 was obtained from Novagen (San Diego, CA, USA).

    Article Title: RNA Binding Domain of Jamestown Canyon Virus S Segment RNAs ▿
    Article Snippet: .. The amplified segment was cloned into the AatII and BspEI sites (underlined above) within the pBR322 vector (New England Biolabs). ..

    Article Title: A System for the Analysis of BKV Non-coding Control Regions: Application to Clinical Isolates from an HIV/AIDS Patient
    Article Snippet: .. The viral genome was excised from the pBR322 vector by BamHI (New England Biolabs, Ipswich, MA) digestion and then recirularized at a concentration of 10 ng/μL using T4 DNA ligase (New England Biolabs, Ipswich, MA). .. RPTE cells were seeded into 12 well plates and transfected with 0.6 μg DNA at 60–70% confluency using TransIT LT-1 transfection reagent (Mirus Bio, Madison, WI) according to the manufacturer’s instructions with a DNA to transfection reagent ratio of 1:6.

    Article Title: Copper bis-Dipyridoquinoxaline Is a Potent DNA Intercalator that Induces Superoxide-Mediated Cleavage via the Minor Groove
    Article Snippet: .. The transcript, which contains four individual CCGG sequences (CpG islands), was produced using PCR (35 cycles) with 1 ng pBR322 plasmid (NEB, N3033L) using 2× MyTaq Red Mix (Bioline) at suitable annealing temperatures for the primer pair. .. The sequence length was verified using a 1 Kb DNA ladder.

    Article Title: Mechanisms of HCV NS3 Helicase Monitored by Optical Tweezers
    Article Snippet: .. Adjust pH to 7.5 at 25°C with HCl and store at 4°C. pBR322 plasmid vector (New England Biolabs). ..

    Article Title: Investigation into the antimicrobial action and mechanism of a novel endogenous peptide β-casein 197 from human milk
    Article Snippet: .. DNA binding assay Gel-retardation experiments were performed using 5 µL of a 25 µg mL−1 pBR322 vector from E. coli (BioLabs, New England). .. Plasmid DNA (pDNA) was exposed to 5 µL of different concentrations of β-casein 197 at 37 °C for 1 h prior to gel electrophoresis of the reaction mixtures through a 0.7% agarose gel in Tris–acetate EDTA buffer.

    Article Title: Dataset on the effects of spermidine on linking number differences between histone H1-free and histone H1-bound circular polynucleosomes
    Article Snippet: .. 2.4 Materials Recombinant human histone H2A/H2B dimer, histone H3.1/H4 tetramer, histone H10 , pBR322 vector, Nt.BspQI nicking endonuclease, T4 DNA ligase and Proteinase K were purchased from New England Biolabs Inc. (Singapore). .. QIAquick PCR Purification Kit was obtained from QIAGEN Singapore Pte.

    Article Title: Dataset on the effects of spermidine on linking number differences between histone H1-free and histone H1-bound circular polynucleosomes
    Article Snippet: .. Recombinant human histone H2A/H2B dimer, histone H3.1/H4 tetramer, histone H10 , pBR322 vector, Nt.BspQI nicking endonuclease, T4 DNA ligase and Proteinase K were purchased from New England Biolabs Inc. (Singapore). .. QIAquick PCR Purification Kit was obtained from QIAGEN Singapore Pte.

    Article Title: A molecular clone of Chronic Bee Paralysis Virus (CBPV) causes mortality in honey bee pupae (Apis mellifera)
    Article Snippet: .. The PCR products were purified, cloned into a pBR322 vector backbone by a DNA assembly reaction (NEBuilder, NEB), and transformed in E. coli (strain HB101). .. The complete sequences were verified by Sanger sequencing (Eurofins Genomics).

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: .. In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites. .. The ∼1.2-kb RNA with the pseudoknot sequence, flanked by ∼500 and ∼600 nt, on the 5′ and 3′ halves, respectively, was in vitro transcribed.

    Article Title: Sulfide (Na2S) and Polysulfide (Na2S2) Interacting with Doxycycline Produce/Scavenge Superoxide and Hydroxyl Radicals and Induce/Inhibit DNA Cleavage
    Article Snippet: .. 4.4. pDNA Cleavage Assay The pBR322 plasmid (N3033L, New England BioLabs Inc., Frankfurt, Germany) was used in pDNA cleavage assay that was performed according to our previous report [ ]. ..

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: .. A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ). .. The construct was linearized by Not I digestion, separated in agarose gel and recovered by electroelution.

    Software:

    Article Title: A molecular clone of Chronic Bee Paralysis Virus (CBPV) causes mortality in honey bee pupae (Apis mellifera)
    Article Snippet: The PCR products were purified, cloned into a pBR322 vector backbone by a DNA assembly reaction (NEBuilder, NEB), and transformed in E. coli (strain HB101). .. Phylogenetic analysis of CBPV AUT17-CBP1 and AUT17-CBP2 and the construction of the phylogenetic tree was done with the CLC Sequence Viewer Software, Version 8.0 and available CBPV sequences from Genbank.

    DNA Binding Assay:

    Article Title: Investigation into the antimicrobial action and mechanism of a novel endogenous peptide β-casein 197 from human milk
    Article Snippet: .. DNA binding assay Gel-retardation experiments were performed using 5 µL of a 25 µg mL−1 pBR322 vector from E. coli (BioLabs, New England). .. Plasmid DNA (pDNA) was exposed to 5 µL of different concentrations of β-casein 197 at 37 °C for 1 h prior to gel electrophoresis of the reaction mixtures through a 0.7% agarose gel in Tris–acetate EDTA buffer.

    Agarose Gel Electrophoresis:

    Article Title: Human Topoisomerase III? Is a Single-stranded DNA Decatenase That Is Stimulated by BLM and RMI1 *
    Article Snippet: pBR322 (21 fmol) (N3033S, New England Biolabs) was incubated with the indicated proteins in 15 μl of reaction buffer containing 50 m m Tris-HCl (pH 7.5), 40 m m NaCl, 5 m m MgCl2 , 1 m m DTT, and 0.1 mg/ml BSA at 37 °C for 30 min. .. Samples were subjected to 1% agarose gel electrophoresis in TAE buffer with buffer re-circularization at 70 V for 16 h. The gels were stained with SYBR Green I (S-7563; Invitrogen) for 30 min and visualized under UV light.

    Article Title: Investigation into the antimicrobial action and mechanism of a novel endogenous peptide β-casein 197 from human milk
    Article Snippet: DNA binding assay Gel-retardation experiments were performed using 5 µL of a 25 µg mL−1 pBR322 vector from E. coli (BioLabs, New England). .. Plasmid DNA (pDNA) was exposed to 5 µL of different concentrations of β-casein 197 at 37 °C for 1 h prior to gel electrophoresis of the reaction mixtures through a 0.7% agarose gel in Tris–acetate EDTA buffer.

    Article Title: The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
    Article Snippet: Five micrograms of recombinant, wild-type, or L2 mutant HPV31a plasmid was digested with EcoRI to release from the pBR322 bacterial vector, the EcoRI was then heat inactivated, the digest was diluted to 2.5 μg per ml in 1× ligase buffer, 10,000 U of T4 ligase (New England Biolabs, Beverly, Mass.) was added, and the solution was incubated at 16°C overnight. .. Five microliters of the eluate was run on an agarose gel and stained with ethidium bromide to verify concentration and to ensure that ligations were primarily intramolecular.

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ). .. The construct was linearized by Not I digestion, separated in agarose gel and recovered by electroelution.

    In Vitro:

    Article Title: Single-molecule mechanical unfolding and folding of a pseudoknot in human telomerase RNA
    Article Snippet: In brief, the chemically synthesized DNA oligonucleotide (Operon) corresponding to modified human telomerase RNA pseudoknot was cloned into the pBR322 vector (NEB) between the EcoRI and HindIII sites. .. The ∼1.2-kb RNA with the pseudoknot sequence, flanked by ∼500 and ∼600 nt, on the 5′ and 3′ halves, respectively, was in vitro transcribed.

    Electrophoresis:

    Article Title: High-Resolution “Fleezers”: Dual-Trap Optical Tweezers Combined with Single-Molecule Fluorescence Detection
    Article Snippet: Electrophoresis cell with power supply, 8- and 15-well combs, gel caster, and 7 × 10 cm tray (Bio-Rad Mini-Sub Cell GT Cell and PowerPac Basic Power Supply, 1640300). .. Nanodrop 2000 UV-Vis spectrophotometer (Thermo Scientific). pBR322 vector (New England Biolabs, N3033S).

    Transgenic Assay:

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ). .. The DNA fragment was purified using Elutip-d column (Whatman, Middlesex, UK), followed by dialysis, and microinjected into pronuclei of fertilized C57BL/6 embryos using standard method at the University Pennsylvania Transgenic Mouse Core Facility.

    Spectrophotometry:

    Article Title: High-Resolution “Fleezers”: Dual-Trap Optical Tweezers Combined with Single-Molecule Fluorescence Detection
    Article Snippet: .. Nanodrop 2000 UV-Vis spectrophotometer (Thermo Scientific). pBR322 vector (New England Biolabs, N3033S). .. Lambda phage DNA template (NEB, N3011S).

    Produced:

    Article Title: Copper bis-Dipyridoquinoxaline Is a Potent DNA Intercalator that Induces Superoxide-Mediated Cleavage via the Minor Groove
    Article Snippet: .. The transcript, which contains four individual CCGG sequences (CpG islands), was produced using PCR (35 cycles) with 1 ng pBR322 plasmid (NEB, N3033L) using 2× MyTaq Red Mix (Bioline) at suitable annealing temperatures for the primer pair. .. The sequence length was verified using a 1 Kb DNA ladder.

    Concentration Assay:

    Article Title: A System for the Analysis of BKV Non-coding Control Regions: Application to Clinical Isolates from an HIV/AIDS Patient
    Article Snippet: .. The viral genome was excised from the pBR322 vector by BamHI (New England Biolabs, Ipswich, MA) digestion and then recirularized at a concentration of 10 ng/μL using T4 DNA ligase (New England Biolabs, Ipswich, MA). .. RPTE cells were seeded into 12 well plates and transfected with 0.6 μg DNA at 60–70% confluency using TransIT LT-1 transfection reagent (Mirus Bio, Madison, WI) according to the manufacturer’s instructions with a DNA to transfection reagent ratio of 1:6.

    Article Title: Mechanisms of HCV NS3 Helicase Monitored by Optical Tweezers
    Article Snippet: Resuspend the oligodeoxynucleotides listed in subheadings 1 to 10 in ddH2 O to a concentration of 100 µM. top-left : 5' (phos)-AATTCTCATGCAGGACAGTCGGAATTATTTATTTATTTATTTTATTTATTTTACCGCCCGCCCGCCCGCCCGCCCGCCGCCCGCATGCGGGCGGCGGGCG- 3'; top-right: 5' (phos)-GGCGGGCGGGCGGGCGGTAAAATAAATAAAATAAATAAATAAATAATAGGAGCTCAGCTATCAGA- 3'; bottom-left: 5' (phos)-GGGCGGCGGGCGGGCGGGCGGGCGGGCGGTAAAATAAATAAAATAAATAAATAAATAATTCCGACTGTCCTGCATGAG- 3'; bottom-right: 5' (phos)-AGCTTCTGATAGCTGAGCTCCTATTATTTATTTATTTATTTTATTTATTTTACCGCCCGCCCGCCCGCCCGCCCGCCGCCCGCATGC-3'; T7 promoter top strand: 5’(phos)-GTTATAATACGACTCACTATAGGGACTGGTGAGT-3’; T7 promoter bottom strand: 5’(phos)-ACTCACCAGTCCCTATAGTGAGTCGTATTATAACTGCA-3’; A-forward: 5’-GGAATTCCGACTGGTGAGTACTCAACCAAGTC-3’; A-reverse: 5’-TCCGACTGTCCTGCATGAG-3’; B-forward: 5’-CTATCAGAAGCTTTAATGCGG-3’; B-reverse-Biotin: 5’ (Biotin)-GCATTAGGAAGCAGCCCAGTAGTAGG-3’. .. Adjust pH to 7.5 at 25°C with HCl and store at 4°C. pBR322 plasmid vector (New England Biolabs).

    Article Title: The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
    Article Snippet: Five micrograms of recombinant, wild-type, or L2 mutant HPV31a plasmid was digested with EcoRI to release from the pBR322 bacterial vector, the EcoRI was then heat inactivated, the digest was diluted to 2.5 μg per ml in 1× ligase buffer, 10,000 U of T4 ligase (New England Biolabs, Beverly, Mass.) was added, and the solution was incubated at 16°C overnight. .. Five microliters of the eluate was run on an agarose gel and stained with ethidium bromide to verify concentration and to ensure that ligations were primarily intramolecular.

    BAC Assay:

    Article Title: A Novel Adipose-Specific Gene Deletion Model Demonstrates Potential Pitfalls of Existing Methods
    Article Snippet: .. A DNA fragment encompassing approximately 23 kb upstream and 10 kb downstream from the transcriptional start site of Retn was retrieved from the modified Retn -Cre BAC into a pBR322 vector (New England Biolabs, Beverly, MA) using a method described by Liu et al. ( ). .. The construct was linearized by Not I digestion, separated in agarose gel and recovered by electroelution.

    Staining:

    Article Title: Human Topoisomerase III? Is a Single-stranded DNA Decatenase That Is Stimulated by BLM and RMI1 *
    Article Snippet: pBR322 (21 fmol) (N3033S, New England Biolabs) was incubated with the indicated proteins in 15 μl of reaction buffer containing 50 m m Tris-HCl (pH 7.5), 40 m m NaCl, 5 m m MgCl2 , 1 m m DTT, and 0.1 mg/ml BSA at 37 °C for 30 min. .. Samples were subjected to 1% agarose gel electrophoresis in TAE buffer with buffer re-circularization at 70 V for 16 h. The gels were stained with SYBR Green I (S-7563; Invitrogen) for 30 min and visualized under UV light.

    Article Title: Investigation into the antimicrobial action and mechanism of a novel endogenous peptide β-casein 197 from human milk
    Article Snippet: DNA binding assay Gel-retardation experiments were performed using 5 µL of a 25 µg mL−1 pBR322 vector from E. coli (BioLabs, New England). .. The gel was stained with Goodview™ (Sbsbio, China) and viewed with AlphaImager Mini System (Proteinsimple, USA).

    Article Title: The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
    Article Snippet: Five micrograms of recombinant, wild-type, or L2 mutant HPV31a plasmid was digested with EcoRI to release from the pBR322 bacterial vector, the EcoRI was then heat inactivated, the digest was diluted to 2.5 μg per ml in 1× ligase buffer, 10,000 U of T4 ligase (New England Biolabs, Beverly, Mass.) was added, and the solution was incubated at 16°C overnight. .. Five microliters of the eluate was run on an agarose gel and stained with ethidium bromide to verify concentration and to ensure that ligations were primarily intramolecular.

    Article Title: Sulfide (Na2S) and Polysulfide (Na2S2) Interacting with Doxycycline Produce/Scavenge Superoxide and Hydroxyl Radicals and Induce/Inhibit DNA Cleavage
    Article Snippet: 4.4. pDNA Cleavage Assay The pBR322 plasmid (N3033L, New England BioLabs Inc., Frankfurt, Germany) was used in pDNA cleavage assay that was performed according to our previous report [ ]. .. The samples were electrophoresed in TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM EDTA, pH 8.0) at 5.5 V/cm for 2 h. Gels were stained with Gel Red™Nucleic Acid Gel Stain and photographed using the Odyssey Fc Imaging System (LI-COR Biotechnology, Bad Homburg, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs pbr322 vector
    The DNA-binding properties of β-Casein 197. a ProtParam analysis of predicted binding residues of β-casein 197, predicted binding residues was labeled with a red “+”. b Gel retardation assays. Binding was assayed by the migration of pDNA. Various concentrations of peptides were incubated with 5 µL of 25 µg mL −1 <t>pBR322</t> vector from E. coli at 37 °C for 1 h, and then the reaction mixtures were applied to 0.7% agarose gel electrophoresis. Lane M DNA marker DL 10,000; Lane 1 5 µL pDNA as control; Lanes 2–6 mixture of pDNA and various concentrations of peptides (12.5, 25, 50, 100 and 500 µg mL −1 )
    Pbr322 Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pbr322 vector/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pbr322 vector - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    The DNA-binding properties of β-Casein 197. a ProtParam analysis of predicted binding residues of β-casein 197, predicted binding residues was labeled with a red “+”. b Gel retardation assays. Binding was assayed by the migration of pDNA. Various concentrations of peptides were incubated with 5 µL of 25 µg mL −1 pBR322 vector from E. coli at 37 °C for 1 h, and then the reaction mixtures were applied to 0.7% agarose gel electrophoresis. Lane M DNA marker DL 10,000; Lane 1 5 µL pDNA as control; Lanes 2–6 mixture of pDNA and various concentrations of peptides (12.5, 25, 50, 100 and 500 µg mL −1 )

    Journal: AMB Express

    Article Title: Investigation into the antimicrobial action and mechanism of a novel endogenous peptide β-casein 197 from human milk

    doi: 10.1186/s13568-017-0409-y

    Figure Lengend Snippet: The DNA-binding properties of β-Casein 197. a ProtParam analysis of predicted binding residues of β-casein 197, predicted binding residues was labeled with a red “+”. b Gel retardation assays. Binding was assayed by the migration of pDNA. Various concentrations of peptides were incubated with 5 µL of 25 µg mL −1 pBR322 vector from E. coli at 37 °C for 1 h, and then the reaction mixtures were applied to 0.7% agarose gel electrophoresis. Lane M DNA marker DL 10,000; Lane 1 5 µL pDNA as control; Lanes 2–6 mixture of pDNA and various concentrations of peptides (12.5, 25, 50, 100 and 500 µg mL −1 )

    Article Snippet: DNA binding assay Gel-retardation experiments were performed using 5 µL of a 25 µg mL−1 pBR322 vector from E. coli (BioLabs, New England).

    Techniques: Binding Assay, Labeling, Electrophoretic Mobility Shift Assay, Migration, Incubation, Plasmid Preparation, Agarose Gel Electrophoresis, Marker