phix174 rf ii dna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    PhiX174 RF II DNA
    Description:
    PhiX174 RF II DNA 150 ug
    Catalog Number:
    n3022l
    Price:
    300
    Size:
    150 ug
    Category:
    Genomic DNA
    Buy from Supplier


    Structured Review

    New England Biolabs phix174 rf ii dna
    PhiX174 RF II DNA
    PhiX174 RF II DNA 150 ug
    https://www.bioz.com/result/phix174 rf ii dna/product/New England Biolabs
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    phix174 rf ii dna - by Bioz Stars, 2020-08
    92/100 stars

    Images

    1) Product Images from "The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA"

    Article Title: The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0169627

    Electron micrographs of the phiX174 plasmid with or without the wild-type/C-terminally truncated Sso7c4 proteins. Representative images of Sso7c4-DNA complexes visualized by EM. Nicked phiX174 plasmids were incubated with different stoichiometries (5 bp/dimer or 0.5 bp/dimer) of either the wild-type (wt) or C-terminally truncated (ctt) proteins. (A) High magnification images of the relaxed, circular phiX174 plasmid alone. (B) and (C) High magnification images of the wild-type Sso7c4-plasmid complex. (D) and (E) High magnification images of the C-terminally truncated Sso7c4-plasmid complex. The scale bar represents 100 nm.
    Figure Legend Snippet: Electron micrographs of the phiX174 plasmid with or without the wild-type/C-terminally truncated Sso7c4 proteins. Representative images of Sso7c4-DNA complexes visualized by EM. Nicked phiX174 plasmids were incubated with different stoichiometries (5 bp/dimer or 0.5 bp/dimer) of either the wild-type (wt) or C-terminally truncated (ctt) proteins. (A) High magnification images of the relaxed, circular phiX174 plasmid alone. (B) and (C) High magnification images of the wild-type Sso7c4-plasmid complex. (D) and (E) High magnification images of the C-terminally truncated Sso7c4-plasmid complex. The scale bar represents 100 nm.

    Techniques Used: Plasmid Preparation, Incubation

    2) Product Images from "The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA"

    Article Title: The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0169627

    Electron micrographs of the phiX174 plasmid with or without the wild-type/C-terminally truncated Sso7c4 proteins. Representative images of Sso7c4-DNA complexes visualized by EM. Nicked phiX174 plasmids were incubated with different stoichiometries (5 bp/dimer or 0.5 bp/dimer) of either the wild-type (wt) or C-terminally truncated (ctt) proteins. (A) High magnification images of the relaxed, circular phiX174 plasmid alone. (B) and (C) High magnification images of the wild-type Sso7c4-plasmid complex. (D) and (E) High magnification images of the C-terminally truncated Sso7c4-plasmid complex. The scale bar represents 100 nm.
    Figure Legend Snippet: Electron micrographs of the phiX174 plasmid with or without the wild-type/C-terminally truncated Sso7c4 proteins. Representative images of Sso7c4-DNA complexes visualized by EM. Nicked phiX174 plasmids were incubated with different stoichiometries (5 bp/dimer or 0.5 bp/dimer) of either the wild-type (wt) or C-terminally truncated (ctt) proteins. (A) High magnification images of the relaxed, circular phiX174 plasmid alone. (B) and (C) High magnification images of the wild-type Sso7c4-plasmid complex. (D) and (E) High magnification images of the C-terminally truncated Sso7c4-plasmid complex. The scale bar represents 100 nm.

    Techniques Used: Plasmid Preparation, Incubation

    Related Articles

    Electron Microscopy:

    Article Title: The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA
    Article Snippet: .. Electron microscopy The phiX174 RF II DNA (New England Biolabs) is the double-stranded, nicked, circular form of the phiX174 DNA. .. The molecular weight of phiX174 DNA is 3.50×106 daltons, and it is 5,386 bp in length.

    Amplification:

    Article Title: SASI-Seq: sample assurance Spike-Ins, and highly differentiating 384 barcoding for Illumina sequencing
    Article Snippet: .. SASI fragment preparation The three SASI amplicons were prepared by PCR using the following primers (obtained from IDT): Forward A 214 bp fragment primers {optional barcode sequence}GGCGCTCGTCTTTGGTATGTA Forward B 397 bp fragment primers {optional barcode sequence}TGAATTGTTCGCGTTTACCTT Forward C 568 bp fragment primers {optional barcode sequence}GTACGCTGGACTTTGTAGGAT Reverse primer {reverse complement of barcode sequence}GGCGTCCATCTCGAAG Each amplification reaction comprised 1 ng of PhiX174 RFII DNA (NEB #N3022L), 200pM of appropriate forward primer, 200pM reverse primer and 1× Kapa HiFi mastermix (KK2602). .. All PCR was performed on an MJ Tetrad2 thermal cycler with the following conditions: 98°C for 2 minutes; 20 cycles of 98°C for 20 seconds, 55°C for 30 seconds, 72°C for 30 seconds; 72°C for 3 minutes.

    Concentration Assay:

    Article Title: The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA
    Article Snippet: .. A 1 mg/ml solution of phiX174 RF II DNA was diluted 20-fold into the binding buffer to a final concentration of ~15 nM (50 μg/ml). .. Complexes of protein and phiX74 were formed by incubating equal volumes of ~15 nM phiX174 DNA with 15 μM or 150 μM protein dimer solutions to achieve stoichiometries of 5 bp and 0.5 bp DNA per protein dimer in binding buffer for 30 min at 25°C.

    Polymerase Chain Reaction:

    Article Title: SASI-Seq: sample assurance Spike-Ins, and highly differentiating 384 barcoding for Illumina sequencing
    Article Snippet: .. SASI fragment preparation The three SASI amplicons were prepared by PCR using the following primers (obtained from IDT): Forward A 214 bp fragment primers {optional barcode sequence}GGCGCTCGTCTTTGGTATGTA Forward B 397 bp fragment primers {optional barcode sequence}TGAATTGTTCGCGTTTACCTT Forward C 568 bp fragment primers {optional barcode sequence}GTACGCTGGACTTTGTAGGAT Reverse primer {reverse complement of barcode sequence}GGCGTCCATCTCGAAG Each amplification reaction comprised 1 ng of PhiX174 RFII DNA (NEB #N3022L), 200pM of appropriate forward primer, 200pM reverse primer and 1× Kapa HiFi mastermix (KK2602). .. All PCR was performed on an MJ Tetrad2 thermal cycler with the following conditions: 98°C for 2 minutes; 20 cycles of 98°C for 20 seconds, 55°C for 30 seconds, 72°C for 30 seconds; 72°C for 3 minutes.

    Sequencing:

    Article Title: SASI-Seq: sample assurance Spike-Ins, and highly differentiating 384 barcoding for Illumina sequencing
    Article Snippet: .. SASI fragment preparation The three SASI amplicons were prepared by PCR using the following primers (obtained from IDT): Forward A 214 bp fragment primers {optional barcode sequence}GGCGCTCGTCTTTGGTATGTA Forward B 397 bp fragment primers {optional barcode sequence}TGAATTGTTCGCGTTTACCTT Forward C 568 bp fragment primers {optional barcode sequence}GTACGCTGGACTTTGTAGGAT Reverse primer {reverse complement of barcode sequence}GGCGTCCATCTCGAAG Each amplification reaction comprised 1 ng of PhiX174 RFII DNA (NEB #N3022L), 200pM of appropriate forward primer, 200pM reverse primer and 1× Kapa HiFi mastermix (KK2602). .. All PCR was performed on an MJ Tetrad2 thermal cycler with the following conditions: 98°C for 2 minutes; 20 cycles of 98°C for 20 seconds, 55°C for 30 seconds, 72°C for 30 seconds; 72°C for 3 minutes.

    Binding Assay:

    Article Title: The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA
    Article Snippet: .. A 1 mg/ml solution of phiX174 RF II DNA was diluted 20-fold into the binding buffer to a final concentration of ~15 nM (50 μg/ml). .. Complexes of protein and phiX74 were formed by incubating equal volumes of ~15 nM phiX174 DNA with 15 μM or 150 μM protein dimer solutions to achieve stoichiometries of 5 bp and 0.5 bp DNA per protein dimer in binding buffer for 30 min at 25°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs phix174 rf ii dna
    Electron micrographs of the <t>phiX174</t> plasmid with or without the wild-type/C-terminally truncated Sso7c4 proteins. Representative images of <t>Sso7c4-DNA</t> complexes visualized by EM. Nicked phiX174 plasmids were incubated with different stoichiometries (5 bp/dimer or 0.5 bp/dimer) of either the wild-type (wt) or C-terminally truncated (ctt) proteins. (A) High magnification images of the relaxed, circular phiX174 plasmid alone. (B) and (C) High magnification images of the wild-type Sso7c4-plasmid complex. (D) and (E) High magnification images of the C-terminally truncated Sso7c4-plasmid complex. The scale bar represents 100 nm.
    Phix174 Rf Ii Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 rf ii dna/product/New England Biolabs
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    phix174 rf ii dna - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results


    Electron micrographs of the phiX174 plasmid with or without the wild-type/C-terminally truncated Sso7c4 proteins. Representative images of Sso7c4-DNA complexes visualized by EM. Nicked phiX174 plasmids were incubated with different stoichiometries (5 bp/dimer or 0.5 bp/dimer) of either the wild-type (wt) or C-terminally truncated (ctt) proteins. (A) High magnification images of the relaxed, circular phiX174 plasmid alone. (B) and (C) High magnification images of the wild-type Sso7c4-plasmid complex. (D) and (E) High magnification images of the C-terminally truncated Sso7c4-plasmid complex. The scale bar represents 100 nm.

    Journal: PLoS ONE

    Article Title: The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA

    doi: 10.1371/journal.pone.0169627

    Figure Lengend Snippet: Electron micrographs of the phiX174 plasmid with or without the wild-type/C-terminally truncated Sso7c4 proteins. Representative images of Sso7c4-DNA complexes visualized by EM. Nicked phiX174 plasmids were incubated with different stoichiometries (5 bp/dimer or 0.5 bp/dimer) of either the wild-type (wt) or C-terminally truncated (ctt) proteins. (A) High magnification images of the relaxed, circular phiX174 plasmid alone. (B) and (C) High magnification images of the wild-type Sso7c4-plasmid complex. (D) and (E) High magnification images of the C-terminally truncated Sso7c4-plasmid complex. The scale bar represents 100 nm.

    Article Snippet: A 1 mg/ml solution of phiX174 RF II DNA was diluted 20-fold into the binding buffer to a final concentration of ~15 nM (50 μg/ml).

    Techniques: Plasmid Preparation, Incubation