nucleosome  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85

    Structured Review

    New England Biolabs nucleosome
    Assembly of H2B K34ub and unmodified <t>nucleosomes.</t> ( A ) Left panel: SDS-PAGE of H2B K34ub- (lane 1) and unmodified (lane 2) histone octamers. Right panel: native PAGE of modified nucleosomes assembled on 147 bp 601 DNA using increasing amounts histones. ( B ) SDS-PAGE of faster- (lane 1) and slower- (lane 2) migrating H2B K34ub assembly products extracted from the native gel in A. The densitometric tracing of the gel lanes is shown on the right. Quantification, by ImageJ, is normalized to that of the histone H4, which is arbitrarily set as 1. ( C ) Native PAGE for samples prepared by serial dilution of 2M NaCl mixtures of 147 bp 601 DNA and modified or unmodified histones to 1 M NaCl. ( D ) Left panel: SDS-PAGE of recombinant linker histone H1 0 . Right panel: assembly of H2B K34ub modified and unmodified nucleosomes with increasing concentration of recombinant histone H1 0 .
    Nucleosome, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleosome/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nucleosome - by Bioz Stars, 2020-03
    85/100 stars

    Images

    1) Product Images from "Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics"

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky526

    Assembly of H2B K34ub and unmodified nucleosomes. ( A ) Left panel: SDS-PAGE of H2B K34ub- (lane 1) and unmodified (lane 2) histone octamers. Right panel: native PAGE of modified nucleosomes assembled on 147 bp 601 DNA using increasing amounts histones. ( B ) SDS-PAGE of faster- (lane 1) and slower- (lane 2) migrating H2B K34ub assembly products extracted from the native gel in A. The densitometric tracing of the gel lanes is shown on the right. Quantification, by ImageJ, is normalized to that of the histone H4, which is arbitrarily set as 1. ( C ) Native PAGE for samples prepared by serial dilution of 2M NaCl mixtures of 147 bp 601 DNA and modified or unmodified histones to 1 M NaCl. ( D ) Left panel: SDS-PAGE of recombinant linker histone H1 0 . Right panel: assembly of H2B K34ub modified and unmodified nucleosomes with increasing concentration of recombinant histone H1 0 .
    Figure Legend Snippet: Assembly of H2B K34ub and unmodified nucleosomes. ( A ) Left panel: SDS-PAGE of H2B K34ub- (lane 1) and unmodified (lane 2) histone octamers. Right panel: native PAGE of modified nucleosomes assembled on 147 bp 601 DNA using increasing amounts histones. ( B ) SDS-PAGE of faster- (lane 1) and slower- (lane 2) migrating H2B K34ub assembly products extracted from the native gel in A. The densitometric tracing of the gel lanes is shown on the right. Quantification, by ImageJ, is normalized to that of the histone H4, which is arbitrarily set as 1. ( C ) Native PAGE for samples prepared by serial dilution of 2M NaCl mixtures of 147 bp 601 DNA and modified or unmodified histones to 1 M NaCl. ( D ) Left panel: SDS-PAGE of recombinant linker histone H1 0 . Right panel: assembly of H2B K34ub modified and unmodified nucleosomes with increasing concentration of recombinant histone H1 0 .

    Techniques Used: SDS Page, Clear Native PAGE, Modification, Serial Dilution, Recombinant, Concentration Assay

    Stability of H2B K34ub- versus H2B K120ub-nucleosomes. ( A ) Left panel: SDS-PAGE of H2B K120ub and K34ub histone octamers. Right panel: unmodified and H2B K120ub/ K34ub nucleosomes assembled on 147 bp 601 DNA. ( B ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA for 2.5 h at indicated temperature/ionic conditions. ( C ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with NAP1 for 2.5 h at 26/37°C in a buffer containing at 140 mM NaCl.
    Figure Legend Snippet: Stability of H2B K34ub- versus H2B K120ub-nucleosomes. ( A ) Left panel: SDS-PAGE of H2B K120ub and K34ub histone octamers. Right panel: unmodified and H2B K120ub/ K34ub nucleosomes assembled on 147 bp 601 DNA. ( B ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA for 2.5 h at indicated temperature/ionic conditions. ( C ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with NAP1 for 2.5 h at 26/37°C in a buffer containing at 140 mM NaCl.

    Techniques Used: SDS Page, Incubation

    Eviction of histone dimer in H2B K34ub nucleosome by histone dimer acceptors. ( A ) Left panel: SDS-PAGE of NAP1. Middle, right panels: unmodified and H2B K34ub nucleosomes assembled on a 147 or 177 bp 601 DNA were post-assembly incubated with NAP1 for 2.5 h at 26 or 37°C in a buffer containing 100 mM NaCl. ( B ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA for 2.5 h at 26/37°C in a buffer containing at 100 mM NaCl. ( C ) H2B K34ub nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA at 26/37°C for 2.5 h or at 26°C for 20 h (the ‘20 h’ and ‘2.5 h’ samples were resolved in different gels).
    Figure Legend Snippet: Eviction of histone dimer in H2B K34ub nucleosome by histone dimer acceptors. ( A ) Left panel: SDS-PAGE of NAP1. Middle, right panels: unmodified and H2B K34ub nucleosomes assembled on a 147 or 177 bp 601 DNA were post-assembly incubated with NAP1 for 2.5 h at 26 or 37°C in a buffer containing 100 mM NaCl. ( B ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA for 2.5 h at 26/37°C in a buffer containing at 100 mM NaCl. ( C ) H2B K34ub nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA at 26/37°C for 2.5 h or at 26°C for 20 h (the ‘20 h’ and ‘2.5 h’ samples were resolved in different gels).

    Techniques Used: SDS Page, Incubation

    Dynamics of H2B K34ub nucleosomes. ( A ) Nucleosomes assembled on 147 bp 601 DNA were resolved in native PAGE under ionic and temperature conditions indicated on top. For the middle panel, although electrophoresis was performed at ∼26°C, the temperature at the glass surface was ∼35–37°C due to higher conductivity of the buffer. All gels were pre-electrophoresed in the relevant buffer. ( B ) Unmodified and H2B K34ub nucleosomes /hexasomes assembled on 177 bp 601 were digested with MNase at 26°C or 37°C and DNA was resolved in 6.5% PAGE and stained with SYBR Gold.
    Figure Legend Snippet: Dynamics of H2B K34ub nucleosomes. ( A ) Nucleosomes assembled on 147 bp 601 DNA were resolved in native PAGE under ionic and temperature conditions indicated on top. For the middle panel, although electrophoresis was performed at ∼26°C, the temperature at the glass surface was ∼35–37°C due to higher conductivity of the buffer. All gels were pre-electrophoresed in the relevant buffer. ( B ) Unmodified and H2B K34ub nucleosomes /hexasomes assembled on 177 bp 601 were digested with MNase at 26°C or 37°C and DNA was resolved in 6.5% PAGE and stained with SYBR Gold.

    Techniques Used: Clear Native PAGE, Electrophoresis, Polyacrylamide Gel Electrophoresis, Staining

    Effects of underlying DNA sequence on stability of H2B K120ub and K34ub nucleosomes. ( A ) Nucleosomes assembled on 146 bp 5S DNA. ( B ) Assembled nucleosomes were incubated with competitor DNA for 2.5 h at 26°C in a buffer containing at 200 mM NaCl. ( C ) Nucleosomes incubated with competitor DNA for 2.5 h at indicated temperature/ ionic conditions. ( D and E ) Nucleosomes assembled with unmodified or H2B K34ub histones, or their 1/0.57 mixture, were post-assembly incubated for 2.5 h at 26 or 37°C with (D) competitor DNA in a buffer containing at 100 mM NaCl or (E) NAP1 in a buffer containing at 150 mM NaCl. Densitometry tracing of indicated gel lanes is shown at the bottom of gel images.
    Figure Legend Snippet: Effects of underlying DNA sequence on stability of H2B K120ub and K34ub nucleosomes. ( A ) Nucleosomes assembled on 146 bp 5S DNA. ( B ) Assembled nucleosomes were incubated with competitor DNA for 2.5 h at 26°C in a buffer containing at 200 mM NaCl. ( C ) Nucleosomes incubated with competitor DNA for 2.5 h at indicated temperature/ ionic conditions. ( D and E ) Nucleosomes assembled with unmodified or H2B K34ub histones, or their 1/0.57 mixture, were post-assembly incubated for 2.5 h at 26 or 37°C with (D) competitor DNA in a buffer containing at 100 mM NaCl or (E) NAP1 in a buffer containing at 150 mM NaCl. Densitometry tracing of indicated gel lanes is shown at the bottom of gel images.

    Techniques Used: Sequencing, Incubation

    Stability and dynamics of H2B K34ub nucleosomes
    Figure Legend Snippet: Stability and dynamics of H2B K34ub nucleosomes

    Techniques Used:

    Related Articles

    Amplification:

    Article Title: A long non-coding RNA protects the heart from pathological hypertrophy
    Article Snippet: .. In brief, recombinant human core histone octamer, which consist of the 2:1 mix of histone H2A/H2B dimer and histone H3.1/H4 tetramer, were mixed with purified 5SrDNA (208bp, N1202S, NEB), Neo (512bp, amplified from pST18-Neo , 1175025, Roche), Myh6 core promoter (596bp, −426 to +170) and Mhrt core promoter (a3a4, 596bp, −2290 to −1775) DNA at 2 M NaCl. .. PCR primers to amplify Neo are CGATGCGCTGCGAATCGGGA and CACTGAAGCGGGAAGGGACT.

    Agarose Gel Electrophoresis:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: After MNase treatment for 10 min, DNA fragments were purified by DNA Clean & Concentrator Kit (Zymo Research, Cat. No. D4013) and loaded into agarose gel. .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: After MNase treatment for 10 min, DNA fragments were purified by DNA Clean & Concentrator Kit (Zymo Research, Cat. No. D4013) and loaded into agarose gel. .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site.

    In Vitro:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Methylation:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Isolation:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The ~ 150-bp band was isolated and extracted by Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Cat. No. D4007). .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The ~ 150-bp band was isolated and extracted by Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Cat. No. D4007). .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site.

    Construct:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: DNA library was constructed by NEBNext® DNA Library Prep Kit (NEB, Cat. No. E6040S) according to the standard Illumina DNA library preparation procedures. .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: DNA library was constructed by NEBNext® DNA Library Prep Kit (NEB, Cat. No. E6040S) according to the standard Illumina DNA library preparation procedures. .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site.

    Purification:

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics
    Article Snippet: Assembled nucleosome (∼30 ng DNA) were digested with increasing amounts (typically 0.3/1/3/10/30/100 Kunitz units) of MNase (NEB) for 20 min at 26 or 37°C. .. DNA was purified and resolved on 6.5% polyacrylamide gel (37.5:1) in 1× TAE buffer (40 mM Tris-OH, 20.6 mM acetic acid, 5 mM sodium acetate, 2 mM EDTA) and stained with SYBR Gold.

    Article Title: A long non-coding RNA protects the heart from pathological hypertrophy
    Article Snippet: .. In brief, recombinant human core histone octamer, which consist of the 2:1 mix of histone H2A/H2B dimer and histone H3.1/H4 tetramer, were mixed with purified 5SrDNA (208bp, N1202S, NEB), Neo (512bp, amplified from pST18-Neo , 1175025, Roche), Myh6 core promoter (596bp, −426 to +170) and Mhrt core promoter (a3a4, 596bp, −2290 to −1775) DNA at 2 M NaCl. .. PCR primers to amplify Neo are CGATGCGCTGCGAATCGGGA and CACTGAAGCGGGAAGGGACT.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: After MNase treatment for 10 min, DNA fragments were purified by DNA Clean & Concentrator Kit (Zymo Research, Cat. No. D4013) and loaded into agarose gel. .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: After MNase treatment for 10 min, DNA fragments were purified by DNA Clean & Concentrator Kit (Zymo Research, Cat. No. D4013) and loaded into agarose gel. .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site.

    Concentration Assay:

    Article Title: A long non-coding RNA protects the heart from pathological hypertrophy
    Article Snippet: In brief, recombinant human core histone octamer, which consist of the 2:1 mix of histone H2A/H2B dimer and histone H3.1/H4 tetramer, were mixed with purified 5SrDNA (208bp, N1202S, NEB), Neo (512bp, amplified from pST18-Neo , 1175025, Roche), Myh6 core promoter (596bp, −426 to +170) and Mhrt core promoter (a3a4, 596bp, −2290 to −1775) DNA at 2 M NaCl. .. The salt concentration was gradually lowered by dilution to allow the formation of nucleosomes.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The salt concentration was sequentially diluted to allow the nucleosome generation on the DNA.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The salt concentration was sequentially diluted to allow the nucleosome generation on the DNA.

    Polymerase Chain Reaction:

    Article Title: A long non-coding RNA protects the heart from pathological hypertrophy
    Article Snippet: In brief, recombinant human core histone octamer, which consist of the 2:1 mix of histone H2A/H2B dimer and histone H3.1/H4 tetramer, were mixed with purified 5SrDNA (208bp, N1202S, NEB), Neo (512bp, amplified from pST18-Neo , 1175025, Roche), Myh6 core promoter (596bp, −426 to +170) and Mhrt core promoter (a3a4, 596bp, −2290 to −1775) DNA at 2 M NaCl. .. PCR primers to amplify Neo are CGATGCGCTGCGAATCGGGA and CACTGAAGCGGGAAGGGACT.

    Recombinant:

    Article Title: A long non-coding RNA protects the heart from pathological hypertrophy
    Article Snippet: .. In brief, recombinant human core histone octamer, which consist of the 2:1 mix of histone H2A/H2B dimer and histone H3.1/H4 tetramer, were mixed with purified 5SrDNA (208bp, N1202S, NEB), Neo (512bp, amplified from pST18-Neo , 1175025, Roche), Myh6 core promoter (596bp, −426 to +170) and Mhrt core promoter (a3a4, 596bp, −2290 to −1775) DNA at 2 M NaCl. .. PCR primers to amplify Neo are CGATGCGCTGCGAATCGGGA and CACTGAAGCGGGAAGGGACT.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Sequencing:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Staining:

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics
    Article Snippet: Assembled nucleosome (∼30 ng DNA) were digested with increasing amounts (typically 0.3/1/3/10/30/100 Kunitz units) of MNase (NEB) for 20 min at 26 or 37°C. .. DNA was purified and resolved on 6.5% polyacrylamide gel (37.5:1) in 1× TAE buffer (40 mM Tris-OH, 20.6 mM acetic acid, 5 mM sodium acetate, 2 mM EDTA) and stained with SYBR Gold.

    Binding Assay:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The 208-bp model DNA was purchased from NEB (Cat. No. N1202S), which was originated from Lytechinus variegatus (sea urchin) 5S rDNA and supposed to contain one nucleosome binding site. .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs nucleosome control dna
    Mhrt inhibits chromatin targeting and gene regulation by Brg1 a, Gel electrophoresis and quantitation of nucleosomal 5SrDNA, Myh6 promoter and Neo <t>DNA.</t> Arrowheads: DNA-histone complex. Arrows: naked DNA. <t>Nucleosome</t> assembly efficiency is defined as the fraction of DNA bound to histones (arrowheads). P-value: Student’s t-test. Error bar: standard error of the mean (SEM). b-d, Quantification of amylose pull-down of MBP-D1D2 (D1D2) with nucleosomal and naked Myh6 promoter DNA ( b ), with nucleosomal Myh6 promoter, Neo , and 5SrDNA ( c ), or with nucleosomal Myh6 promoter in the presence of Mhrt779 ( d ). P-value: Student’s t-test. Error bar: SEM. e, Amylose pull-down of MBP-D1D2 and histone 3. Anti-histone 3 and anti-MBP antibodies were used for western blot analysis. f, ChIP analysis of Brg1 on chromatinized and naked Myh6 promoter in rat ventricular cardiomyocytes. GFP: green fluorescence protein control. P-value: Student’s t-test. Error bar: SEM. g, h, Luciferase reporter activity of Brg1 on naked Myh6 promoter ( g ) or of helicase-deficient Brg1 on chromatinized Myh6 promoter ( h ) in rat ventricular cardiomyocytes. ΔD1: Brg1 lacking amino acid 774–913; ΔD2: Brg1 lacking 1086–1246. GFP: green fluorescence protein control. ChIP: H-10 antibody recognizing N-terminus, non-disrupted region of Brg1. P-value: Student’s t-test. Error bar: SEM. i, j, ChIP analysis in SW13 cells of chromatinized Myh6 promoter in the presence of Mhrt779 ( i ) or helicase-deficient Brg1 ( j ). Vector: pAdd2 empty vector. Mhrt : pAdd2- Mhrt779 . P-value: Student’s t-test. Error bar: SEM. k, Schematic illustration and PCR of human MHRT. MHRT originates from MYH7 and is transcribed into MYH7. MYH7 e xons and introns are indicated. R1 and R2 are strand-specific PCR primers; F1 and R1 target MHRT and MYH7 ; F2 and R2 are specific for MHRT . l, Quantification of MHRT in human heart tissues. Ctrl: control. LVH: left ventricular hypertrophy. ICM: ischemic cardiomyopathy. IDCM: idiopathic dilated cardiomyopathy. P-value: Student’s t-test. Error bar: SEM. m, Working model of a Brg1- Mhrt negative feedback circuit in the heart. Brg1 represses Mhrt transcription, whereas Mhrt prevents Brg1 from recognizing its chromatin targets. Brg1 functions through two distinct promoter elements to bidirectionally repress Myh6 and Mhrt expression. n , Molecular model of how Brg1 binds to its genomic DNA targets. Brg1 helicase (D1D2) binds chromatinized DNA, C-terminal extension (CTE) binds histone 3 (H3), and bromodomain binds acetylated (Ac) histone 3 or 4 (H4).
    Nucleosome Control Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleosome control dna/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    nucleosome control dna - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Mhrt inhibits chromatin targeting and gene regulation by Brg1 a, Gel electrophoresis and quantitation of nucleosomal 5SrDNA, Myh6 promoter and Neo DNA. Arrowheads: DNA-histone complex. Arrows: naked DNA. Nucleosome assembly efficiency is defined as the fraction of DNA bound to histones (arrowheads). P-value: Student’s t-test. Error bar: standard error of the mean (SEM). b-d, Quantification of amylose pull-down of MBP-D1D2 (D1D2) with nucleosomal and naked Myh6 promoter DNA ( b ), with nucleosomal Myh6 promoter, Neo , and 5SrDNA ( c ), or with nucleosomal Myh6 promoter in the presence of Mhrt779 ( d ). P-value: Student’s t-test. Error bar: SEM. e, Amylose pull-down of MBP-D1D2 and histone 3. Anti-histone 3 and anti-MBP antibodies were used for western blot analysis. f, ChIP analysis of Brg1 on chromatinized and naked Myh6 promoter in rat ventricular cardiomyocytes. GFP: green fluorescence protein control. P-value: Student’s t-test. Error bar: SEM. g, h, Luciferase reporter activity of Brg1 on naked Myh6 promoter ( g ) or of helicase-deficient Brg1 on chromatinized Myh6 promoter ( h ) in rat ventricular cardiomyocytes. ΔD1: Brg1 lacking amino acid 774–913; ΔD2: Brg1 lacking 1086–1246. GFP: green fluorescence protein control. ChIP: H-10 antibody recognizing N-terminus, non-disrupted region of Brg1. P-value: Student’s t-test. Error bar: SEM. i, j, ChIP analysis in SW13 cells of chromatinized Myh6 promoter in the presence of Mhrt779 ( i ) or helicase-deficient Brg1 ( j ). Vector: pAdd2 empty vector. Mhrt : pAdd2- Mhrt779 . P-value: Student’s t-test. Error bar: SEM. k, Schematic illustration and PCR of human MHRT. MHRT originates from MYH7 and is transcribed into MYH7. MYH7 e xons and introns are indicated. R1 and R2 are strand-specific PCR primers; F1 and R1 target MHRT and MYH7 ; F2 and R2 are specific for MHRT . l, Quantification of MHRT in human heart tissues. Ctrl: control. LVH: left ventricular hypertrophy. ICM: ischemic cardiomyopathy. IDCM: idiopathic dilated cardiomyopathy. P-value: Student’s t-test. Error bar: SEM. m, Working model of a Brg1- Mhrt negative feedback circuit in the heart. Brg1 represses Mhrt transcription, whereas Mhrt prevents Brg1 from recognizing its chromatin targets. Brg1 functions through two distinct promoter elements to bidirectionally repress Myh6 and Mhrt expression. n , Molecular model of how Brg1 binds to its genomic DNA targets. Brg1 helicase (D1D2) binds chromatinized DNA, C-terminal extension (CTE) binds histone 3 (H3), and bromodomain binds acetylated (Ac) histone 3 or 4 (H4).

    Journal: Nature

    Article Title: A long non-coding RNA protects the heart from pathological hypertrophy

    doi: 10.1038/nature13596

    Figure Lengend Snippet: Mhrt inhibits chromatin targeting and gene regulation by Brg1 a, Gel electrophoresis and quantitation of nucleosomal 5SrDNA, Myh6 promoter and Neo DNA. Arrowheads: DNA-histone complex. Arrows: naked DNA. Nucleosome assembly efficiency is defined as the fraction of DNA bound to histones (arrowheads). P-value: Student’s t-test. Error bar: standard error of the mean (SEM). b-d, Quantification of amylose pull-down of MBP-D1D2 (D1D2) with nucleosomal and naked Myh6 promoter DNA ( b ), with nucleosomal Myh6 promoter, Neo , and 5SrDNA ( c ), or with nucleosomal Myh6 promoter in the presence of Mhrt779 ( d ). P-value: Student’s t-test. Error bar: SEM. e, Amylose pull-down of MBP-D1D2 and histone 3. Anti-histone 3 and anti-MBP antibodies were used for western blot analysis. f, ChIP analysis of Brg1 on chromatinized and naked Myh6 promoter in rat ventricular cardiomyocytes. GFP: green fluorescence protein control. P-value: Student’s t-test. Error bar: SEM. g, h, Luciferase reporter activity of Brg1 on naked Myh6 promoter ( g ) or of helicase-deficient Brg1 on chromatinized Myh6 promoter ( h ) in rat ventricular cardiomyocytes. ΔD1: Brg1 lacking amino acid 774–913; ΔD2: Brg1 lacking 1086–1246. GFP: green fluorescence protein control. ChIP: H-10 antibody recognizing N-terminus, non-disrupted region of Brg1. P-value: Student’s t-test. Error bar: SEM. i, j, ChIP analysis in SW13 cells of chromatinized Myh6 promoter in the presence of Mhrt779 ( i ) or helicase-deficient Brg1 ( j ). Vector: pAdd2 empty vector. Mhrt : pAdd2- Mhrt779 . P-value: Student’s t-test. Error bar: SEM. k, Schematic illustration and PCR of human MHRT. MHRT originates from MYH7 and is transcribed into MYH7. MYH7 e xons and introns are indicated. R1 and R2 are strand-specific PCR primers; F1 and R1 target MHRT and MYH7 ; F2 and R2 are specific for MHRT . l, Quantification of MHRT in human heart tissues. Ctrl: control. LVH: left ventricular hypertrophy. ICM: ischemic cardiomyopathy. IDCM: idiopathic dilated cardiomyopathy. P-value: Student’s t-test. Error bar: SEM. m, Working model of a Brg1- Mhrt negative feedback circuit in the heart. Brg1 represses Mhrt transcription, whereas Mhrt prevents Brg1 from recognizing its chromatin targets. Brg1 functions through two distinct promoter elements to bidirectionally repress Myh6 and Mhrt expression. n , Molecular model of how Brg1 binds to its genomic DNA targets. Brg1 helicase (D1D2) binds chromatinized DNA, C-terminal extension (CTE) binds histone 3 (H3), and bromodomain binds acetylated (Ac) histone 3 or 4 (H4).

    Article Snippet: In brief, recombinant human core histone octamer, which consist of the 2:1 mix of histone H2A/H2B dimer and histone H3.1/H4 tetramer, were mixed with purified 5SrDNA (208bp, N1202S, NEB), Neo (512bp, amplified from pST18-Neo , 1175025, Roche), Myh6 core promoter (596bp, −426 to +170) and Mhrt core promoter (a3a4, 596bp, −2290 to −1775) DNA at 2 M NaCl.

    Techniques: Nucleic Acid Electrophoresis, Quantitation Assay, Western Blot, Chromatin Immunoprecipitation, Fluorescence, Luciferase, Activity Assay, Plasmid Preparation, Polymerase Chain Reaction, Expressing

    Assembly of H2B K34ub and unmodified nucleosomes. ( A ) Left panel: SDS-PAGE of H2B K34ub- (lane 1) and unmodified (lane 2) histone octamers. Right panel: native PAGE of modified nucleosomes assembled on 147 bp 601 DNA using increasing amounts histones. ( B ) SDS-PAGE of faster- (lane 1) and slower- (lane 2) migrating H2B K34ub assembly products extracted from the native gel in A. The densitometric tracing of the gel lanes is shown on the right. Quantification, by ImageJ, is normalized to that of the histone H4, which is arbitrarily set as 1. ( C ) Native PAGE for samples prepared by serial dilution of 2M NaCl mixtures of 147 bp 601 DNA and modified or unmodified histones to 1 M NaCl. ( D ) Left panel: SDS-PAGE of recombinant linker histone H1 0 . Right panel: assembly of H2B K34ub modified and unmodified nucleosomes with increasing concentration of recombinant histone H1 0 .

    Journal: Nucleic Acids Research

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics

    doi: 10.1093/nar/gky526

    Figure Lengend Snippet: Assembly of H2B K34ub and unmodified nucleosomes. ( A ) Left panel: SDS-PAGE of H2B K34ub- (lane 1) and unmodified (lane 2) histone octamers. Right panel: native PAGE of modified nucleosomes assembled on 147 bp 601 DNA using increasing amounts histones. ( B ) SDS-PAGE of faster- (lane 1) and slower- (lane 2) migrating H2B K34ub assembly products extracted from the native gel in A. The densitometric tracing of the gel lanes is shown on the right. Quantification, by ImageJ, is normalized to that of the histone H4, which is arbitrarily set as 1. ( C ) Native PAGE for samples prepared by serial dilution of 2M NaCl mixtures of 147 bp 601 DNA and modified or unmodified histones to 1 M NaCl. ( D ) Left panel: SDS-PAGE of recombinant linker histone H1 0 . Right panel: assembly of H2B K34ub modified and unmodified nucleosomes with increasing concentration of recombinant histone H1 0 .

    Article Snippet: Assembled nucleosome (∼30 ng DNA) were digested with increasing amounts (typically 0.3/1/3/10/30/100 Kunitz units) of MNase (NEB) for 20 min at 26 or 37°C.

    Techniques: SDS Page, Clear Native PAGE, Modification, Serial Dilution, Recombinant, Concentration Assay

    Stability of H2B K34ub- versus H2B K120ub-nucleosomes. ( A ) Left panel: SDS-PAGE of H2B K120ub and K34ub histone octamers. Right panel: unmodified and H2B K120ub/ K34ub nucleosomes assembled on 147 bp 601 DNA. ( B ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA for 2.5 h at indicated temperature/ionic conditions. ( C ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with NAP1 for 2.5 h at 26/37°C in a buffer containing at 140 mM NaCl.

    Journal: Nucleic Acids Research

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics

    doi: 10.1093/nar/gky526

    Figure Lengend Snippet: Stability of H2B K34ub- versus H2B K120ub-nucleosomes. ( A ) Left panel: SDS-PAGE of H2B K120ub and K34ub histone octamers. Right panel: unmodified and H2B K120ub/ K34ub nucleosomes assembled on 147 bp 601 DNA. ( B ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA for 2.5 h at indicated temperature/ionic conditions. ( C ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with NAP1 for 2.5 h at 26/37°C in a buffer containing at 140 mM NaCl.

    Article Snippet: Assembled nucleosome (∼30 ng DNA) were digested with increasing amounts (typically 0.3/1/3/10/30/100 Kunitz units) of MNase (NEB) for 20 min at 26 or 37°C.

    Techniques: SDS Page, Incubation

    Eviction of histone dimer in H2B K34ub nucleosome by histone dimer acceptors. ( A ) Left panel: SDS-PAGE of NAP1. Middle, right panels: unmodified and H2B K34ub nucleosomes assembled on a 147 or 177 bp 601 DNA were post-assembly incubated with NAP1 for 2.5 h at 26 or 37°C in a buffer containing 100 mM NaCl. ( B ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA for 2.5 h at 26/37°C in a buffer containing at 100 mM NaCl. ( C ) H2B K34ub nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA at 26/37°C for 2.5 h or at 26°C for 20 h (the ‘20 h’ and ‘2.5 h’ samples were resolved in different gels).

    Journal: Nucleic Acids Research

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics

    doi: 10.1093/nar/gky526

    Figure Lengend Snippet: Eviction of histone dimer in H2B K34ub nucleosome by histone dimer acceptors. ( A ) Left panel: SDS-PAGE of NAP1. Middle, right panels: unmodified and H2B K34ub nucleosomes assembled on a 147 or 177 bp 601 DNA were post-assembly incubated with NAP1 for 2.5 h at 26 or 37°C in a buffer containing 100 mM NaCl. ( B ) Nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA for 2.5 h at 26/37°C in a buffer containing at 100 mM NaCl. ( C ) H2B K34ub nucleosomes assembled on 147 bp 601 DNA were post-assembly incubated with competitor DNA at 26/37°C for 2.5 h or at 26°C for 20 h (the ‘20 h’ and ‘2.5 h’ samples were resolved in different gels).

    Article Snippet: Assembled nucleosome (∼30 ng DNA) were digested with increasing amounts (typically 0.3/1/3/10/30/100 Kunitz units) of MNase (NEB) for 20 min at 26 or 37°C.

    Techniques: SDS Page, Incubation

    Dynamics of H2B K34ub nucleosomes. ( A ) Nucleosomes assembled on 147 bp 601 DNA were resolved in native PAGE under ionic and temperature conditions indicated on top. For the middle panel, although electrophoresis was performed at ∼26°C, the temperature at the glass surface was ∼35–37°C due to higher conductivity of the buffer. All gels were pre-electrophoresed in the relevant buffer. ( B ) Unmodified and H2B K34ub nucleosomes /hexasomes assembled on 177 bp 601 were digested with MNase at 26°C or 37°C and DNA was resolved in 6.5% PAGE and stained with SYBR Gold.

    Journal: Nucleic Acids Research

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics

    doi: 10.1093/nar/gky526

    Figure Lengend Snippet: Dynamics of H2B K34ub nucleosomes. ( A ) Nucleosomes assembled on 147 bp 601 DNA were resolved in native PAGE under ionic and temperature conditions indicated on top. For the middle panel, although electrophoresis was performed at ∼26°C, the temperature at the glass surface was ∼35–37°C due to higher conductivity of the buffer. All gels were pre-electrophoresed in the relevant buffer. ( B ) Unmodified and H2B K34ub nucleosomes /hexasomes assembled on 177 bp 601 were digested with MNase at 26°C or 37°C and DNA was resolved in 6.5% PAGE and stained with SYBR Gold.

    Article Snippet: Assembled nucleosome (∼30 ng DNA) were digested with increasing amounts (typically 0.3/1/3/10/30/100 Kunitz units) of MNase (NEB) for 20 min at 26 or 37°C.

    Techniques: Clear Native PAGE, Electrophoresis, Polyacrylamide Gel Electrophoresis, Staining

    Effects of underlying DNA sequence on stability of H2B K120ub and K34ub nucleosomes. ( A ) Nucleosomes assembled on 146 bp 5S DNA. ( B ) Assembled nucleosomes were incubated with competitor DNA for 2.5 h at 26°C in a buffer containing at 200 mM NaCl. ( C ) Nucleosomes incubated with competitor DNA for 2.5 h at indicated temperature/ ionic conditions. ( D and E ) Nucleosomes assembled with unmodified or H2B K34ub histones, or their 1/0.57 mixture, were post-assembly incubated for 2.5 h at 26 or 37°C with (D) competitor DNA in a buffer containing at 100 mM NaCl or (E) NAP1 in a buffer containing at 150 mM NaCl. Densitometry tracing of indicated gel lanes is shown at the bottom of gel images.

    Journal: Nucleic Acids Research

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics

    doi: 10.1093/nar/gky526

    Figure Lengend Snippet: Effects of underlying DNA sequence on stability of H2B K120ub and K34ub nucleosomes. ( A ) Nucleosomes assembled on 146 bp 5S DNA. ( B ) Assembled nucleosomes were incubated with competitor DNA for 2.5 h at 26°C in a buffer containing at 200 mM NaCl. ( C ) Nucleosomes incubated with competitor DNA for 2.5 h at indicated temperature/ ionic conditions. ( D and E ) Nucleosomes assembled with unmodified or H2B K34ub histones, or their 1/0.57 mixture, were post-assembly incubated for 2.5 h at 26 or 37°C with (D) competitor DNA in a buffer containing at 100 mM NaCl or (E) NAP1 in a buffer containing at 150 mM NaCl. Densitometry tracing of indicated gel lanes is shown at the bottom of gel images.

    Article Snippet: Assembled nucleosome (∼30 ng DNA) were digested with increasing amounts (typically 0.3/1/3/10/30/100 Kunitz units) of MNase (NEB) for 20 min at 26 or 37°C.

    Techniques: Sequencing, Incubation

    Stability and dynamics of H2B K34ub nucleosomes

    Journal: Nucleic Acids Research

    Article Title: Effects of histone H2B ubiquitylation on the nucleosome structure and dynamics

    doi: 10.1093/nar/gky526

    Figure Lengend Snippet: Stability and dynamics of H2B K34ub nucleosomes

    Article Snippet: Assembled nucleosome (∼30 ng DNA) were digested with increasing amounts (typically 0.3/1/3/10/30/100 Kunitz units) of MNase (NEB) for 20 min at 26 or 37°C.

    Techniques: