dna ladder  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    1 kb DNA Ladder
    Description:
    1 kb DNA Ladder 1 000 gel lanes
    Catalog Number:
    n3232l
    Price:
    213
    Size:
    1 000 gel lanes
    Category:
    DNA Ladders
    Buy from Supplier


    Structured Review

    New England Biolabs dna ladder
    1 kb DNA Ladder
    1 kb DNA Ladder 1 000 gel lanes
    https://www.bioz.com/result/dna ladder/product/New England Biolabs
    Average 90 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    dna ladder - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: PCR1, PCR2, and PCR3 indicate the amplicons generated by the diagnostic PCRs (shown in panel B). (B) PCR analysis validating the replacement of the endogenous locus with the drug selection cassette (shown in panel A) using the genomic DNA of Δprp1 and parental RHΔku80 parasites as the templates. .. Specific primer pairs correspond to the PCRs illustrated in panel A. M represents 1-kb DNA ladder (NEB).

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: PCR1 to PCR5 indicate the diagnostic PCRs (shown in panel B). (B) Diagnostic PCRs validating the replacement of the pgm2 locus with the DHFR cassette in both the RHΔku80 and Δprp1 background. .. M represents 1-kb DNA ladder (NEB).

    Clone Assay:

    Article Title: Novel ?-Lactamase Genes from Two Environmental Isolates of Vibrio harveyi
    Article Snippet: Paragraph title: DNA cloning and analysis of recombinant plasmids. ... Fragment sizes were estimated by comparison to the 1-kb DNA ladder (New England Biolabs) as the molecular size standard.

    Centrifugation:

    Article Title: The aqueous extract of Albizia adianthifolia leaves attenuates 6-hydroxydopamine-induced anxiety, depression and oxidative stress in rat amygdala
    Article Snippet: DNA seen as stringy precipitate was pelleted by centrifugation and washed with 70 % ethanol to remove traces of sodium dodecyl sulfate and phenol. .. A 1-kb DNA ladder (New England Biolabs, Ipswich, MA) was used as a standard size marker.

    Amplification:

    Article Title: The prevalence of molecular markers of drug resistance in Plasmodium vivax from the border regions of Thailand in 2008 and 2014
    Article Snippet: .. The amplified PCR products were resolved on 1.0% agarose gel, and the sizes of the PCR products were determined using a 1-Kb DNA ladder (New England Biolabs® Inc., Ipswich, MA). ..

    Article Title: FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system
    Article Snippet: .. sbt-1 genomic DNA rescue strains were generated by injecting 15 ng/μL of sbt-1 genomic DNA (amplified by PCR with forward primer CTGTGAAGCGCTCATCTGAA and reverse primer TTCAGGCAAATCCATCATCA), 50 ng/μL coelomocyte-specific ofm-1p::rfp coinjection marker, and 135 ng/μL 1-kb DNA ladder (New England Biolabs) carrier DNA into the adult gonads of sbt-1(ok901) animals, followed by integration into the genome by X-ray ( , ). .. Two independent integration lines were generated: PS7274 sbt-1(ok901); Is444[sbt-1p::sbt-1; ofm-1p::rfp] (line 1, outcrossed two times) and PS7275 sbt-1(ok901); Is445[sbt-1p::sbt-1; ofm-1p::rfp] (line 2, outcrossed three times).

    Article Title: A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1 [w]
    Article Snippet: .. More than 95% of the fragments were successfully PCR amplified as single band or multiple bands including the target band, with a DNA concentration above 100 ng μL-1 , based on ethidium bromide-staining intensity compared with 1-kb DNA ladder (New England Biolabs, Beverly, MA). .. For printing, the resuspended PCR fragments were combined 1:1 with dimethyl sulfoxide, and an 8-μL sample of each fragment was transferred to 384-well printing source plates (Whatman, Clifton, NJ).

    Electrophoresis:

    Article Title: Duplex PCR Methods for the Molecular Detection of Escherichia fergusonii Isolates from Broiler Chickens
    Article Snippet: The PCR products were separated on a 2% Tris-acetate-EDTA buffer agarose electrophoresis gel stained with ethidium bromide (1 μl/10 ml) or using Gelred (Biotium Inc., Hayward, CA). .. The bands were referenced to a GeneRuler 100-bp DNA ladder (Fermentas, Ottawa, Ontario, Canada) and a 1-kb DNA ladder (New England BioLabs Inc., Whitby, Ontario, Canada) to size the amplicons.

    Article Title: The aqueous extract of Albizia adianthifolia leaves attenuates 6-hydroxydopamine-induced anxiety, depression and oxidative stress in rat amygdala
    Article Snippet: Electrophoresis was performed in TBE at 120 V until sufficient resolution was obtained. .. A 1-kb DNA ladder (New England Biolabs, Ipswich, MA) was used as a standard size marker.

    Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
    Article Snippet: .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers. ..

    Article Title: Construction and characterization of bacterial artificial chromosomes harboring the full-length genome of a highly attenuated vaccinia virus LC16m8
    Article Snippet: Restriction fragment analysis The purified BAC plasmid DNA was digested with Nco I and separated by electrophoresis for 2 hours at 50 V in 0.75% agarose/Tris-borate-EDTA buffer. .. A 1-kb DNA ladder (New England Biolabs) was used as molecular weight marker.

    Microarray:

    Article Title: A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1 [w]
    Article Snippet: Paragraph title: Microarray Construction ... More than 95% of the fragments were successfully PCR amplified as single band or multiple bands including the target band, with a DNA concentration above 100 ng μL-1 , based on ethidium bromide-staining intensity compared with 1-kb DNA ladder (New England Biolabs, Beverly, MA).

    Transformation Assay:

    Article Title: Novel ?-Lactamase Genes from Two Environmental Isolates of Vibrio harveyi
    Article Snippet: The ligation mixture was transformed into E. coli TOP10 cells (Invitrogen Corp., Carlsbad, Calif.), and transformants were selected for ampicillin resistance. .. Fragment sizes were estimated by comparison to the 1-kb DNA ladder (New England Biolabs) as the molecular size standard.

    Ligation:

    Article Title: Novel ?-Lactamase Genes from Two Environmental Isolates of Vibrio harveyi
    Article Snippet: The ligation mixture was transformed into E. coli TOP10 cells (Invitrogen Corp., Carlsbad, Calif.), and transformants were selected for ampicillin resistance. .. Fragment sizes were estimated by comparison to the 1-kb DNA ladder (New England Biolabs) as the molecular size standard.

    Generated:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: PCR1, PCR2, and PCR3 indicate the amplicons generated by the diagnostic PCRs (shown in panel B). (B) PCR analysis validating the replacement of the endogenous locus with the drug selection cassette (shown in panel A) using the genomic DNA of Δprp1 and parental RHΔku80 parasites as the templates. .. Specific primer pairs correspond to the PCRs illustrated in panel A. M represents 1-kb DNA ladder (NEB).

    Article Title: Reverse Genetics Mediated Recovery of Infectious Murine Norovirus
    Article Snippet: After DNA purification, MNV RNA transcripts are generated in vitro by using T7 RNA polymerase (lane 2). .. Transcription products are run on a non-denaturing 1% agarose gel in parallel to 1-Kb DNA ladder (New England Biolabs, lane 1).

    Article Title: FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system
    Article Snippet: .. sbt-1 genomic DNA rescue strains were generated by injecting 15 ng/μL of sbt-1 genomic DNA (amplified by PCR with forward primer CTGTGAAGCGCTCATCTGAA and reverse primer TTCAGGCAAATCCATCATCA), 50 ng/μL coelomocyte-specific ofm-1p::rfp coinjection marker, and 135 ng/μL 1-kb DNA ladder (New England Biolabs) carrier DNA into the adult gonads of sbt-1(ok901) animals, followed by integration into the genome by X-ray ( , ). .. Two independent integration lines were generated: PS7274 sbt-1(ok901); Is444[sbt-1p::sbt-1; ofm-1p::rfp] (line 1, outcrossed two times) and PS7275 sbt-1(ok901); Is445[sbt-1p::sbt-1; ofm-1p::rfp] (line 2, outcrossed three times).

    Polymerase Chain Reaction:

    Article Title: Production of Myxoma Virus Gateway Entry and Expression Libraries and Validation of Viral Protein Expression
    Article Snippet: .. Run 2 μl of a 1-kb DNA ladder in one lane to determine the size of the PCR products. ..

    Article Title: Duplex PCR Methods for the Molecular Detection of Escherichia fergusonii Isolates from Broiler Chickens
    Article Snippet: Paragraph title: Conventional PCR assay. ... The bands were referenced to a GeneRuler 100-bp DNA ladder (Fermentas, Ottawa, Ontario, Canada) and a 1-kb DNA ladder (New England BioLabs Inc., Whitby, Ontario, Canada) to size the amplicons.

    Article Title: The prevalence of molecular markers of drug resistance in Plasmodium vivax from the border regions of Thailand in 2008 and 2014
    Article Snippet: .. The amplified PCR products were resolved on 1.0% agarose gel, and the sizes of the PCR products were determined using a 1-Kb DNA ladder (New England Biolabs® Inc., Ipswich, MA). ..

    Article Title: Production of Myxoma Virus Gateway Entry and Expression Libraries and Validation of Viral Protein Expression
    Article Snippet: .. Run 2 μl of a 1-kb DNA ladder in one lane to determine PCR products’ size. .. 6 Visualize the bands on a gel doc system to determine PCR size and whether or not multiple bands are present.

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: PCR1, PCR2, and PCR3 indicate the amplicons generated by the diagnostic PCRs (shown in panel B). (B) PCR analysis validating the replacement of the endogenous locus with the drug selection cassette (shown in panel A) using the genomic DNA of Δprp1 and parental RHΔku80 parasites as the templates. .. Specific primer pairs correspond to the PCRs illustrated in panel A. M represents 1-kb DNA ladder (NEB).

    Article Title: FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system
    Article Snippet: .. sbt-1 genomic DNA rescue strains were generated by injecting 15 ng/μL of sbt-1 genomic DNA (amplified by PCR with forward primer CTGTGAAGCGCTCATCTGAA and reverse primer TTCAGGCAAATCCATCATCA), 50 ng/μL coelomocyte-specific ofm-1p::rfp coinjection marker, and 135 ng/μL 1-kb DNA ladder (New England Biolabs) carrier DNA into the adult gonads of sbt-1(ok901) animals, followed by integration into the genome by X-ray ( , ). .. Two independent integration lines were generated: PS7274 sbt-1(ok901); Is444[sbt-1p::sbt-1; ofm-1p::rfp] (line 1, outcrossed two times) and PS7275 sbt-1(ok901); Is445[sbt-1p::sbt-1; ofm-1p::rfp] (line 2, outcrossed three times).

    Article Title: A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1 [w]
    Article Snippet: .. More than 95% of the fragments were successfully PCR amplified as single band or multiple bands including the target band, with a DNA concentration above 100 ng μL-1 , based on ethidium bromide-staining intensity compared with 1-kb DNA ladder (New England Biolabs, Beverly, MA). .. For printing, the resuspended PCR fragments were combined 1:1 with dimethyl sulfoxide, and an 8-μL sample of each fragment was transferred to 384-well printing source plates (Whatman, Clifton, NJ).

    Recombinant:

    Article Title: Novel ?-Lactamase Genes from Two Environmental Isolates of Vibrio harveyi
    Article Snippet: Paragraph title: DNA cloning and analysis of recombinant plasmids. ... Fragment sizes were estimated by comparison to the 1-kb DNA ladder (New England Biolabs) as the molecular size standard.

    Molecular Weight:

    Article Title: Construction and characterization of bacterial artificial chromosomes harboring the full-length genome of a highly attenuated vaccinia virus LC16m8
    Article Snippet: .. A 1-kb DNA ladder (New England Biolabs) was used as molecular weight marker. .. Prediction of the restriction fragment patterns was computed by a software SnapGene version 4.0.6 (GSL Biotech).

    BAC Assay:

    Article Title: Construction and characterization of bacterial artificial chromosomes harboring the full-length genome of a highly attenuated vaccinia virus LC16m8
    Article Snippet: Restriction fragment analysis The purified BAC plasmid DNA was digested with Nco I and separated by electrophoresis for 2 hours at 50 V in 0.75% agarose/Tris-borate-EDTA buffer. .. A 1-kb DNA ladder (New England Biolabs) was used as molecular weight marker.

    Isolation:

    Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
    Article Snippet: Phage DNA was isolated from 50 ml lysate (6.75 × 107 PFU/ml) by using the Qiagen lambda midikit (Promega, Madison, WI) according to the manufacturer's instructions. .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers.

    Purification:

    Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
    Article Snippet: Paragraph title: Purification of bacteriophage DNA and restriction analysis. ... The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers.

    Article Title: Construction and characterization of bacterial artificial chromosomes harboring the full-length genome of a highly attenuated vaccinia virus LC16m8
    Article Snippet: Restriction fragment analysis The purified BAC plasmid DNA was digested with Nco I and separated by electrophoresis for 2 hours at 50 V in 0.75% agarose/Tris-borate-EDTA buffer. .. A 1-kb DNA ladder (New England Biolabs) was used as molecular weight marker.

    Article Title: Reverse Genetics Mediated Recovery of Infectious Murine Norovirus
    Article Snippet: RNA is then purified from free nucleotides by LiCl precipitation (lane 3). .. Transcription products are run on a non-denaturing 1% agarose gel in parallel to 1-Kb DNA ladder (New England Biolabs, lane 1).

    Article Title: A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1 [w]
    Article Snippet: The purified products were resuspended in water, and a sample from each PCR fragment was run on an agarose gel for quality control. .. More than 95% of the fragments were successfully PCR amplified as single band or multiple bands including the target band, with a DNA concentration above 100 ng μL-1 , based on ethidium bromide-staining intensity compared with 1-kb DNA ladder (New England Biolabs, Beverly, MA).

    Transgenic Assay:

    Article Title: FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system
    Article Snippet: Paragraph title: Transgenic Strains. ... sbt-1 genomic DNA rescue strains were generated by injecting 15 ng/μL of sbt-1 genomic DNA (amplified by PCR with forward primer CTGTGAAGCGCTCATCTGAA and reverse primer TTCAGGCAAATCCATCATCA), 50 ng/μL coelomocyte-specific ofm-1p::rfp coinjection marker, and 135 ng/μL 1-kb DNA ladder (New England Biolabs) carrier DNA into the adult gonads of sbt-1(ok901) animals, followed by integration into the genome by X-ray ( , ).

    Nested PCR:

    Article Title: The prevalence of molecular markers of drug resistance in Plasmodium vivax from the border regions of Thailand in 2008 and 2014
    Article Snippet: 2.2 Polymerase chain reaction (PCR) amplification for Pvdhfr, Pvdhps, Pvmdr1, Pvcrt-o and Pvk12 To amplify Pvdhfr, Pvdhps, Pvmdr1, Pvcrt-o and Pvk12 , both nested PCR and single PCR amplification methods were used following established protocols with some modifications ( ; , ; ; ). .. The amplified PCR products were resolved on 1.0% agarose gel, and the sizes of the PCR products were determined using a 1-Kb DNA ladder (New England Biolabs® Inc., Ipswich, MA).

    Activated Clotting Time Assay:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: Thus, our data suggest that PRP1 and PGM2 act similarly in the microneme secretion pathway, thereby eliminating any putatively compensatory function between the two proteins. .. M represents 1-kb DNA ladder (NEB).

    Plasmid Preparation:

    Article Title: Endemic, Epidemic Clone of Salmonella enterica Serovar Typhi Harboring a Single Multidrug-Resistant Plasmid in Vietnam between 1995 and 2002
    Article Snippet: Paragraph title: Extraction and determination of plasmid size. ... Then, restriction endonucleases KpnI, ScaI, and BglII (Roche Diagnostics, Meylan, France) were used to cleave the plasmids and compare the sizes of the fragments to the size markers, a 1-kb DNA ladder (New England Biolabs, Beverly, Mass.) containing 13 fragments (from 12.2 to 1.0 kbp); Raoul (QBiogène, Illkirch, France), containing 22 fragments (from 48.5 to 0.2 kbp); and Marker XV (Roche Diagnostics), containing 22 fragments (from 48.5 to 7.6 kbp).

    Article Title: Novel ?-Lactamase Genes from Two Environmental Isolates of Vibrio harveyi
    Article Snippet: Recombinant plasmid DNA was prepared by alkaline lysis ( ). .. Fragment sizes were estimated by comparison to the 1-kb DNA ladder (New England Biolabs) as the molecular size standard.

    Article Title: Construction and characterization of bacterial artificial chromosomes harboring the full-length genome of a highly attenuated vaccinia virus LC16m8
    Article Snippet: Restriction fragment analysis The purified BAC plasmid DNA was digested with Nco I and separated by electrophoresis for 2 hours at 50 V in 0.75% agarose/Tris-borate-EDTA buffer. .. A 1-kb DNA ladder (New England Biolabs) was used as molecular weight marker.

    Article Title: Reverse Genetics Mediated Recovery of Infectious Murine Norovirus
    Article Snippet: The plasmid pT7:MNV 3'Rz is firstly linearised using Nhe I restriction enzyme. .. Transcription products are run on a non-denaturing 1% agarose gel in parallel to 1-Kb DNA ladder (New England Biolabs, lane 1).

    Software:

    Article Title: Construction and characterization of bacterial artificial chromosomes harboring the full-length genome of a highly attenuated vaccinia virus LC16m8
    Article Snippet: A 1-kb DNA ladder (New England Biolabs) was used as molecular weight marker. .. Prediction of the restriction fragment patterns was computed by a software SnapGene version 4.0.6 (GSL Biotech).

    Functional Assay:

    Article Title: A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1 [w]
    Article Snippet: Negative and positive controls were selected from the Arabidopsis Functional Genomics Consortium (AFGC) microarray control set from the Michigan State University DNA Microarray Facility. .. More than 95% of the fragments were successfully PCR amplified as single band or multiple bands including the target band, with a DNA concentration above 100 ng μL-1 , based on ethidium bromide-staining intensity compared with 1-kb DNA ladder (New England Biolabs, Beverly, MA).

    Selection:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: PCR1, PCR2, and PCR3 indicate the amplicons generated by the diagnostic PCRs (shown in panel B). (B) PCR analysis validating the replacement of the endogenous locus with the drug selection cassette (shown in panel A) using the genomic DNA of Δprp1 and parental RHΔku80 parasites as the templates. .. Specific primer pairs correspond to the PCRs illustrated in panel A. M represents 1-kb DNA ladder (NEB).

    Agarose Gel Electrophoresis:

    Article Title: The prevalence of molecular markers of drug resistance in Plasmodium vivax from the border regions of Thailand in 2008 and 2014
    Article Snippet: .. The amplified PCR products were resolved on 1.0% agarose gel, and the sizes of the PCR products were determined using a 1-Kb DNA ladder (New England Biolabs® Inc., Ipswich, MA). ..

    Article Title: The aqueous extract of Albizia adianthifolia leaves attenuates 6-hydroxydopamine-induced anxiety, depression and oxidative stress in rat amygdala
    Article Snippet: Approximately 0.5 mg genomic DNA was dissolved in a mixture of 10 μL of TRIS-EDTA and 5 μL of gel loading buffer (0.25 % bromophenol blue, 0.25 % xylene cyanol FF, 30 % (v/v) glycerol) and then loaded on a 1.5 % agarose gel in TRIS-boric acid-EDTA (TBE) buffer (89 mM Tris boric acid, 2 mM EDTA, pH 8.0). .. A 1-kb DNA ladder (New England Biolabs, Ipswich, MA) was used as a standard size marker.

    Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
    Article Snippet: .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers. ..

    Article Title: Reverse Genetics Mediated Recovery of Infectious Murine Norovirus
    Article Snippet: .. Transcription products are run on a non-denaturing 1% agarose gel in parallel to 1-Kb DNA ladder (New England Biolabs, lane 1). ..

    Article Title: A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1 [w]
    Article Snippet: The purified products were resuspended in water, and a sample from each PCR fragment was run on an agarose gel for quality control. .. More than 95% of the fragments were successfully PCR amplified as single band or multiple bands including the target band, with a DNA concentration above 100 ng μL-1 , based on ethidium bromide-staining intensity compared with 1-kb DNA ladder (New England Biolabs, Beverly, MA).

    In Vitro:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: On the basis of these results, we conclude that PRP1 is not essential for either microneme or rhoptry secretion and is not required for completing the Toxoplasma lytic cycle in vitro . .. Specific primer pairs correspond to the PCRs illustrated in panel A. M represents 1-kb DNA ladder (NEB).

    Article Title: Reverse Genetics Mediated Recovery of Infectious Murine Norovirus
    Article Snippet: After DNA purification, MNV RNA transcripts are generated in vitro by using T7 RNA polymerase (lane 2). .. Transcription products are run on a non-denaturing 1% agarose gel in parallel to 1-Kb DNA ladder (New England Biolabs, lane 1).

    Ethanol Precipitation:

    Article Title: A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1 [w]
    Article Snippet: PCR amplicons were purified by ethanol precipitation. .. More than 95% of the fragments were successfully PCR amplified as single band or multiple bands including the target band, with a DNA concentration above 100 ng μL-1 , based on ethidium bromide-staining intensity compared with 1-kb DNA ladder (New England Biolabs, Beverly, MA).

    Knock-Out:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: 10.1128/mSphere.00521-17.1 FIG S1 Generation and validation of the Δprp1 parasite line. (A) Schematic of the generation of prp1 knockout parasites. .. Specific primer pairs correspond to the PCRs illustrated in panel A. M represents 1-kb DNA ladder (NEB).

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: 10.1128/mSphere.00521-17.4 FIG S4 Generation of pgm2 knockout parasite lines. (A) Schematic representation of generating pgm2 knockouts by double homologous recombination into the RHΔku80 or Δprp1 parasite as the parent line. .. M represents 1-kb DNA ladder (NEB).

    Concentration Assay:

    Article Title: A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1A Genome-Wide Analysis of Blue-Light Regulation of Arabidopsis Transcription Factor Gene Expression during Seedling Development 1 [w]
    Article Snippet: .. More than 95% of the fragments were successfully PCR amplified as single band or multiple bands including the target band, with a DNA concentration above 100 ng μL-1 , based on ethidium bromide-staining intensity compared with 1-kb DNA ladder (New England Biolabs, Beverly, MA). .. For printing, the resuspended PCR fragments were combined 1:1 with dimethyl sulfoxide, and an 8-μL sample of each fragment was transferred to 384-well printing source plates (Whatman, Clifton, NJ).

    Alkaline Lysis:

    Article Title: Novel ?-Lactamase Genes from Two Environmental Isolates of Vibrio harveyi
    Article Snippet: Recombinant plasmid DNA was prepared by alkaline lysis ( ). .. Fragment sizes were estimated by comparison to the 1-kb DNA ladder (New England Biolabs) as the molecular size standard.

    DNA Purification:

    Article Title: Reverse Genetics Mediated Recovery of Infectious Murine Norovirus
    Article Snippet: After DNA purification, MNV RNA transcripts are generated in vitro by using T7 RNA polymerase (lane 2). .. Transcription products are run on a non-denaturing 1% agarose gel in parallel to 1-Kb DNA ladder (New England Biolabs, lane 1).

    Marker:

    Article Title: Endemic, Epidemic Clone of Salmonella enterica Serovar Typhi Harboring a Single Multidrug-Resistant Plasmid in Vietnam between 1995 and 2002
    Article Snippet: .. Then, restriction endonucleases KpnI, ScaI, and BglII (Roche Diagnostics, Meylan, France) were used to cleave the plasmids and compare the sizes of the fragments to the size markers, a 1-kb DNA ladder (New England Biolabs, Beverly, Mass.) containing 13 fragments (from 12.2 to 1.0 kbp); Raoul (QBiogène, Illkirch, France), containing 22 fragments (from 48.5 to 0.2 kbp); and Marker XV (Roche Diagnostics), containing 22 fragments (from 48.5 to 7.6 kbp). .. Among the plasmids extracted from the previous 107 E. coli transconjugants, 54 plasmids (18 from the north, 14 from the center, and 22 from the south of Vietnam) of similar size were digested by EcoRI or HindIII endonuclease in ERB-lab, INHE, Hanoï, according to the manufacturer's instructions (New England Biolabs).

    Article Title: The aqueous extract of Albizia adianthifolia leaves attenuates 6-hydroxydopamine-induced anxiety, depression and oxidative stress in rat amygdala
    Article Snippet: .. A 1-kb DNA ladder (New England Biolabs, Ipswich, MA) was used as a standard size marker. .. The bands were visualized by ethidium bromide staining under UV light.

    Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
    Article Snippet: .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers. ..

    Article Title: Construction and characterization of bacterial artificial chromosomes harboring the full-length genome of a highly attenuated vaccinia virus LC16m8
    Article Snippet: .. A 1-kb DNA ladder (New England Biolabs) was used as molecular weight marker. .. Prediction of the restriction fragment patterns was computed by a software SnapGene version 4.0.6 (GSL Biotech).

    Article Title: FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system
    Article Snippet: .. sbt-1 genomic DNA rescue strains were generated by injecting 15 ng/μL of sbt-1 genomic DNA (amplified by PCR with forward primer CTGTGAAGCGCTCATCTGAA and reverse primer TTCAGGCAAATCCATCATCA), 50 ng/μL coelomocyte-specific ofm-1p::rfp coinjection marker, and 135 ng/μL 1-kb DNA ladder (New England Biolabs) carrier DNA into the adult gonads of sbt-1(ok901) animals, followed by integration into the genome by X-ray ( , ). .. Two independent integration lines were generated: PS7274 sbt-1(ok901); Is444[sbt-1p::sbt-1; ofm-1p::rfp] (line 1, outcrossed two times) and PS7275 sbt-1(ok901); Is445[sbt-1p::sbt-1; ofm-1p::rfp] (line 2, outcrossed three times).

    Staining:

    Article Title: Duplex PCR Methods for the Molecular Detection of Escherichia fergusonii Isolates from Broiler Chickens
    Article Snippet: The PCR products were separated on a 2% Tris-acetate-EDTA buffer agarose electrophoresis gel stained with ethidium bromide (1 μl/10 ml) or using Gelred (Biotium Inc., Hayward, CA). .. The bands were referenced to a GeneRuler 100-bp DNA ladder (Fermentas, Ottawa, Ontario, Canada) and a 1-kb DNA ladder (New England BioLabs Inc., Whitby, Ontario, Canada) to size the amplicons.

    Article Title: The aqueous extract of Albizia adianthifolia leaves attenuates 6-hydroxydopamine-induced anxiety, depression and oxidative stress in rat amygdala
    Article Snippet: A 1-kb DNA ladder (New England Biolabs, Ipswich, MA) was used as a standard size marker. .. The bands were visualized by ethidium bromide staining under UV light.

    Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
    Article Snippet: .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers. ..

    Homologous Recombination:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: 10.1128/mSphere.00521-17.4 FIG S4 Generation of pgm2 knockout parasite lines. (A) Schematic representation of generating pgm2 knockouts by double homologous recombination into the RHΔku80 or Δprp1 parasite as the parent line. .. M represents 1-kb DNA ladder (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    New England Biolabs quick load 1 kb plus dna ladder
    Quick Load 1 Kb Plus Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick load 1 kb plus dna ladder/product/New England Biolabs
    Average 85 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    quick load 1 kb plus dna ladder - by Bioz Stars, 2020-01
    85/100 stars
      Buy from Supplier

    90
    New England Biolabs dna ladder
    Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna ladder/product/New England Biolabs
    Average 90 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    dna ladder - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results