quick load 1 kb  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Quick Load 1 kb Plus DNA Ladder
    Description:
    Quick Load 2 log DNA Ladder 125 250 gel lanes
    Catalog Number:
    n0469s
    Price:
    77
    Size:
    250 gel lanes
    Category:
    DNA Ladders
    Buy from Supplier


    Structured Review

    New England Biolabs quick load 1 kb
    Quick Load 1 kb Plus DNA Ladder
    Quick Load 2 log DNA Ladder 125 250 gel lanes
    https://www.bioz.com/result/quick load 1 kb/product/New England Biolabs
    Average 93 stars, based on 112 article reviews
    Price from $9.99 to $1999.99
    quick load 1 kb - by Bioz Stars, 2020-08
    93/100 stars

    Images

    Related Articles

    High Performance Liquid Chromatography:

    Article Title: A 3D human neural cell culture system for modeling Alzheimer’s disease
    Article Snippet: .. HPLC-grade H2 O (Fisher Scientific, cat. no. W5-1) QIAshredder (Qiagen, cat. no. 79656) RNeasy Mini Kit (Qiagen, cat. no. 74104 or 74106, depending on size) Ethanol 200 proof (absolute) (Sigma-Aldrich, cat. no. E7023) Buffer RW1 (Qiagen, cat. no. 1053394) Buffer RPE (Qiagen, cat. no. 1018013) RNase-free H2 O (Qiagen, cat. no. 129112) Oligo(dT)20 Primer (Life Technologies, cat. no. 18418020) 10 mM dNTP Mix (Life Technologies, cat. no. 18427013, 18427088, depending on size) 10x RT Buffer (Life Technologies, cat. no. 18067-017) 25 mM MgCl2 (Life Technologies, cat. no. 18080-051) 0.1 M DTT (Life Technologies, cat. no. 18080-051) RNaseOUT™ (40U/μl) (Life Technologies, cat. no. 10777-019) SuperScript® III RT (200U/μl) (Life Technologies, cat. no. 18080-093) RNase-H (Life Technologies, cat. no. 18021-071) SYBR® Select Master Mix (Life Technologies, cat. no. 4472908) 3R4RTau Forward Primer: 5′-AAGTCGCCGTCTTCCGCCAAG-3′ (synthesized in the MGH DNA core facility) 3R4RTau Reverse Primer: 5′-GTCCAGGGACCCAATCTTCGA-3′ (synthesized in the MGH DNA core facility) Agarose (Apex, cat. no. 20–102) Quick-Load® 2-Log DNA ladder (0.1–10 kb) (New England Biolabs, cat. no. N0469S) DNA Loading Dye (6x) (Thermo Scientific, cat. no. R0611) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) 3R Tau forward primer (AGGCGGGAAGGTGCAAATAG) (synthesized in the MGH DNA core facility) 4R Tau forward primer (GAAGCTGGATCTTAGCAACG) (synthesized in the MGH DNA core facility) 3R Tau reverse primer (TCCTGGTTTATGATGGATGTT) (synthesized in the MGH DNA core facility) 4R Tau reverse primer (GACGTGTTTGATATTATCCT) (synthesized in the MGH DNA core facility) .. Paraformaldehyde (Electron Microscopy Sciences, cat. no. 15710) Tris (Fischer Scientific, cat. no. BP152) Tween-20 (Acros Organics, cat. no. 23360051) Bovine Serum Albumin (Sigma-Aldrich, cat. no. A2153) Gelatin from Bovine Skin, Type B (Sigma-Aldrich cat. no. G9391) Glycine (American Bioanalytical, cat. no. AB00730) Donkey serum (Sigma-Aldrich, cat. no. D9663) Anti-fade gold (Life Technologies, cat. no. ) H2 O2 (Sigma-Aldrich, cat. no. 1001582615) ImmPRESS Polymer Detection Kit (Vector Laboratories, cat. no. MP-7402 and MP-7401) DAB Peroxidase (HRP) Substrate Kit, 3,3′-diaminobenzidine (Vector Laboratories, cat. no. SK-4100) ImmPACT DAB Peroxidase Substrate kit (Vector Laboratories, cat. no. SK-4105) Amyloid β-Protein Immunohistostain Kit (Wako, cat. No. 299-56701) Chromopure goat IgG (Jackson Immuno Research, cat. No. 005-000-003) Amylo-Glo 100x (Biosensis, cat. no. TR-300-AG) 0.9% saline (B. Braun Medical Inc., cat. no. L8001) 1% Triton X-100 (Fischer Scientific, cat no. 11332481001) A summary of antibodies we used is shown in

    DNA Extraction:

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C . .. Zinc chloride (ZnCl2 ), 99.999% trace metals basis powdered (Sigma-Aldrich, catalog number: 229997) Note: Prepare as 100 mM stock in deionized water .

    Agarose Gel Electrophoresis:

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: .. For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. After electrophoresis the DNA was depurinated, denatured, and neutralized exactly as described by Cai et al. ( ) and transferred onto Hybond XL membrane (Amersham) by using the TurboBlotter system (GE Healthcare). (-) strand HBV DNA was detected with a DIG-labeled (+) strand HBV RNA probe transcribed from a ScaI-linearized pGEM3Z-HBV plasmid with DIG Northern Starter Kit (Roche) according to manufacturer’s instructions.

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size. .. Expression of Hdh mRNA in wild-type and mutant mouse striatal cells (7/7 and 111/111) and EVs was carried with qRT-PCR out using m Hdh Forward/m Hdh reverse (5′-CAGATGTCAGAATGGTGGCT-3′/5′-GCCTTGGAAGAT TAGAATCCA-3′). hprt and beta-actin mRNAs were used to normalize the expression (mHPRT Forward/mHPRT Reverse (5′-GGTTAAGCAGTACAGCCCCA-3′/5′-AGAGGTCCTT TTCACCAGCA-3′); mActB Forward/mActB Reverse (5′-GCTTCTTTGCAGCTCCTTCGT/5′-CCAGCGCAGCGATATCG-3′).

    Southern Blot:

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: .. For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. After electrophoresis the DNA was depurinated, denatured, and neutralized exactly as described by Cai et al. ( ) and transferred onto Hybond XL membrane (Amersham) by using the TurboBlotter system (GE Healthcare). (-) strand HBV DNA was detected with a DIG-labeled (+) strand HBV RNA probe transcribed from a ScaI-linearized pGEM3Z-HBV plasmid with DIG Northern Starter Kit (Roche) according to manufacturer’s instructions.

    Synthesized:

    Article Title: A 3D human neural cell culture system for modeling Alzheimer’s disease
    Article Snippet: .. HPLC-grade H2 O (Fisher Scientific, cat. no. W5-1) QIAshredder (Qiagen, cat. no. 79656) RNeasy Mini Kit (Qiagen, cat. no. 74104 or 74106, depending on size) Ethanol 200 proof (absolute) (Sigma-Aldrich, cat. no. E7023) Buffer RW1 (Qiagen, cat. no. 1053394) Buffer RPE (Qiagen, cat. no. 1018013) RNase-free H2 O (Qiagen, cat. no. 129112) Oligo(dT)20 Primer (Life Technologies, cat. no. 18418020) 10 mM dNTP Mix (Life Technologies, cat. no. 18427013, 18427088, depending on size) 10x RT Buffer (Life Technologies, cat. no. 18067-017) 25 mM MgCl2 (Life Technologies, cat. no. 18080-051) 0.1 M DTT (Life Technologies, cat. no. 18080-051) RNaseOUT™ (40U/μl) (Life Technologies, cat. no. 10777-019) SuperScript® III RT (200U/μl) (Life Technologies, cat. no. 18080-093) RNase-H (Life Technologies, cat. no. 18021-071) SYBR® Select Master Mix (Life Technologies, cat. no. 4472908) 3R4RTau Forward Primer: 5′-AAGTCGCCGTCTTCCGCCAAG-3′ (synthesized in the MGH DNA core facility) 3R4RTau Reverse Primer: 5′-GTCCAGGGACCCAATCTTCGA-3′ (synthesized in the MGH DNA core facility) Agarose (Apex, cat. no. 20–102) Quick-Load® 2-Log DNA ladder (0.1–10 kb) (New England Biolabs, cat. no. N0469S) DNA Loading Dye (6x) (Thermo Scientific, cat. no. R0611) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) 3R Tau forward primer (AGGCGGGAAGGTGCAAATAG) (synthesized in the MGH DNA core facility) 4R Tau forward primer (GAAGCTGGATCTTAGCAACG) (synthesized in the MGH DNA core facility) 3R Tau reverse primer (TCCTGGTTTATGATGGATGTT) (synthesized in the MGH DNA core facility) 4R Tau reverse primer (GACGTGTTTGATATTATCCT) (synthesized in the MGH DNA core facility) .. Paraformaldehyde (Electron Microscopy Sciences, cat. no. 15710) Tris (Fischer Scientific, cat. no. BP152) Tween-20 (Acros Organics, cat. no. 23360051) Bovine Serum Albumin (Sigma-Aldrich, cat. no. A2153) Gelatin from Bovine Skin, Type B (Sigma-Aldrich cat. no. G9391) Glycine (American Bioanalytical, cat. no. AB00730) Donkey serum (Sigma-Aldrich, cat. no. D9663) Anti-fade gold (Life Technologies, cat. no. ) H2 O2 (Sigma-Aldrich, cat. no. 1001582615) ImmPRESS Polymer Detection Kit (Vector Laboratories, cat. no. MP-7402 and MP-7401) DAB Peroxidase (HRP) Substrate Kit, 3,3′-diaminobenzidine (Vector Laboratories, cat. no. SK-4100) ImmPACT DAB Peroxidase Substrate kit (Vector Laboratories, cat. no. SK-4105) Amyloid β-Protein Immunohistostain Kit (Wako, cat. No. 299-56701) Chromopure goat IgG (Jackson Immuno Research, cat. No. 005-000-003) Amylo-Glo 100x (Biosensis, cat. no. TR-300-AG) 0.9% saline (B. Braun Medical Inc., cat. no. L8001) 1% Triton X-100 (Fischer Scientific, cat no. 11332481001) A summary of antibodies we used is shown in

    Electrophoresis:

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: .. For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. After electrophoresis the DNA was depurinated, denatured, and neutralized exactly as described by Cai et al. ( ) and transferred onto Hybond XL membrane (Amersham) by using the TurboBlotter system (GE Healthcare). (-) strand HBV DNA was detected with a DIG-labeled (+) strand HBV RNA probe transcribed from a ScaI-linearized pGEM3Z-HBV plasmid with DIG Northern Starter Kit (Roche) according to manufacturer’s instructions.

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: .. The generated amplicons were resolved by horizontal electrophoresis on 1.5% (wt/vol) Tris-Borate-EDTA (Merck, Germany) agarose gels together with the Quick-load®1-kb (Biolabs, New England) and run in an electric field of 110 V for 2 h 30 min. Electrophoresis gels were visualized by a UV light trans-illuminator, images were captured using a Gel Doc™ XR+ system (BioRad Laboratories, CA, Foster City, USA) and analysed by Image Lab™ Software (version 4.0, BioRad Laboratories, CA, Foster City, USA). .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard.

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C . .. Zinc chloride (ZnCl2 ), 99.999% trace metals basis powdered (Sigma-Aldrich, catalog number: 229997) Note: Prepare as 100 mM stock in deionized water .

    Generated:

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: .. The generated amplicons were resolved by horizontal electrophoresis on 1.5% (wt/vol) Tris-Borate-EDTA (Merck, Germany) agarose gels together with the Quick-load®1-kb (Biolabs, New England) and run in an electric field of 110 V for 2 h 30 min. Electrophoresis gels were visualized by a UV light trans-illuminator, images were captured using a Gel Doc™ XR+ system (BioRad Laboratories, CA, Foster City, USA) and analysed by Image Lab™ Software (version 4.0, BioRad Laboratories, CA, Foster City, USA). .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard.

    Molecular Weight:

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: .. Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file. .. SDS-PAGE gel analysis of protein extracts from induced E . coli expression cultures used in .

    Polymerase Chain Reaction:

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size. .. Expression of Hdh mRNA in wild-type and mutant mouse striatal cells (7/7 and 111/111) and EVs was carried with qRT-PCR out using m Hdh Forward/m Hdh reverse (5′-CAGATGTCAGAATGGTGGCT-3′/5′-GCCTTGGAAGAT TAGAATCCA-3′). hprt and beta-actin mRNAs were used to normalize the expression (mHPRT Forward/mHPRT Reverse (5′-GGTTAAGCAGTACAGCCCCA-3′/5′-AGAGGTCCTT TTCACCAGCA-3′); mActB Forward/mActB Reverse (5′-GCTTCTTTGCAGCTCCTTCGT/5′-CCAGCGCAGCGATATCG-3′).

    Plasmid Preparation:

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C . .. Zinc chloride (ZnCl2 ), 99.999% trace metals basis powdered (Sigma-Aldrich, catalog number: 229997) Note: Prepare as 100 mM stock in deionized water .

    Software:

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: .. The generated amplicons were resolved by horizontal electrophoresis on 1.5% (wt/vol) Tris-Borate-EDTA (Merck, Germany) agarose gels together with the Quick-load®1-kb (Biolabs, New England) and run in an electric field of 110 V for 2 h 30 min. Electrophoresis gels were visualized by a UV light trans-illuminator, images were captured using a Gel Doc™ XR+ system (BioRad Laboratories, CA, Foster City, USA) and analysed by Image Lab™ Software (version 4.0, BioRad Laboratories, CA, Foster City, USA). .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs quick load 1 kb
    Quick Load 1 Kb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick load 1 kb/product/New England Biolabs
    Average 93 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    quick load 1 kb - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results