quick load 1 kb dna ladder  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Quick Load 1 kb DNA Ladder
    Description:
    Quick Load 1 kb DNA Ladder 375 gel lanes
    Catalog Number:
    n0468l
    Price:
    150
    Size:
    375 gel lanes
    Category:
    DNA Ladders
    Buy from Supplier


    Structured Review

    New England Biolabs quick load 1 kb dna ladder
    Quick Load 1 kb DNA Ladder
    Quick Load 1 kb DNA Ladder 375 gel lanes
    https://www.bioz.com/result/quick load 1 kb dna ladder/product/New England Biolabs
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    quick load 1 kb dna ladder - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Molecular and phenotypic characterization of Als1 and Als2 mutations conferring tolerance to acetolactate synthase herbicides in soybean
    Article Snippet: .. Expression of Als1 and Als2 mutations Results of the cDNA cloning of the Als1 and Als2 mutations are shown in the 1% Tris-borate-EDTA (TBE) agarose gel in Fig. [30 min at 100 V, 1 kb ladder (NEB Cat. No. N0468S)]. .. The amplified cDNA fragments appear to match the expected fragment sizes of 2066 bp and 1942 bp for Als1 (see Fig. , lanes marked ‘a’ and ‘b’ respectively) and 2083 bp and 1957 bp for Als2 (see Fig. , lanes marked ‘c’ and ‘d’ respectively).

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: The amplification product was purified by the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) following the supplier's recommendations and was cloned into the pCR4 vector using the TOPO TA Cloning Kit (Invitrogen, Leek, The Netherland), according to the manufacturer's instructions. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: The insert was cloned into the pGEX-6P-1 vector . .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C .

    Amplification:

    Article Title: Heterologous Immunity between Adenoviruses and Hepatitis C Virus: A New Paradigm in HCV Immunity and Vaccines
    Article Snippet: .. PCR amplification products were run on 1% agarose gel at 80 volts to resolve amplification products along with 1 KB sized Quick Load DNA Ladder (Cat.# N0468S, NEB Biolab, Germany). .. Adjuvants Toll-like receptor-3 agonist poly I:C (Cat.# P1530, Sigma-Aldrich, St. Louis, MO, USA) was used as an adjuvant for immunization with Ad vector.

    Article Title: Molecular and phenotypic characterization of Als1 and Als2 mutations conferring tolerance to acetolactate synthase herbicides in soybean
    Article Snippet: Expression of Als1 and Als2 mutations Results of the cDNA cloning of the Als1 and Als2 mutations are shown in the 1% Tris-borate-EDTA (TBE) agarose gel in Fig. [30 min at 100 V, 1 kb ladder (NEB Cat. No. N0468S)]. .. The amplified cDNA fragments appear to match the expected fragment sizes of 2066 bp and 1942 bp for Als1 (see Fig. , lanes marked ‘a’ and ‘b’ respectively) and 2083 bp and 1957 bp for Als2 (see Fig. , lanes marked ‘c’ and ‘d’ respectively).

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: In order to simulate the amplification efficiency of viral reverse-transcribed RNA more closely and to avoid the presence of supercoiled plasmid DNA, the plasmid was linearised above the bat-SARS-like CoV fragment sequence using restriction endonuclease Spe I (Fermentas, Burlington, Ontario, Canada). .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Article Title: Characterization of newly isolated oleaginous yeasts - Cryptococcus podzolicus, Trichosporon porosum and Pichia segobiensis
    Article Snippet: .. The final extension was done at 72°C for 10 min. PCR products were visualized on 1% agarose gel (1× TAE-buffer: 40 mM Tris base, 1 mM EDTA, pH 8 adjusted with acetic acid; 0.1 μg/ml ethidium bromide) after carrying out gel electrophoresis of each PCR amplification product and 6 μl Quick Load 1 kb DNA Ladder (New England Biolabs, Frankfurt/Main, Germany; N0468 S) with 1× TAE buffer at 100 V for 1 h. Distilled water was used as negative control. ..

    Article Title: Occurrence of Isopenicillin-N-Synthase Homologs in Bioluminescent Ctenophores and Implications for Coelenterazine Biosynthesis
    Article Snippet: Paragraph title: PCR amplification ... 5μ L of Quick-Load 1kb DNA Ladder (New England Biolabs) were used for band-size comparison.

    Article Title: Naked mole-rats maintain healthy skeletal muscle and Complex IV mitochondrial enzyme function into old age
    Article Snippet: 8 μL of Second Round amplified products were combined with 2 μL Loading buffer and separated using a GelRed Nucleic Acid (Biotium) stained 0.8% agarose gel, electrophoresed at 85V for 3 hours. .. The products were ran alongside a Quick-Load® 1Kb DNA Ladder (New England BioLabs Inc.) and visualized for evaluation under UV light (BioRad ChemiDoc™ MP Imaging System).

    TA Cloning:

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: The amplification product was purified by the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) following the supplier's recommendations and was cloned into the pCR4 vector using the TOPO TA Cloning Kit (Invitrogen, Leek, The Netherland), according to the manufacturer's instructions. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Quantitative RT-PCR:

    Article Title: Molecular and phenotypic characterization of Als1 and Als2 mutations conferring tolerance to acetolactate synthase herbicides in soybean
    Article Snippet: Expression of Als1 and Als2 mutations Results of the cDNA cloning of the Als1 and Als2 mutations are shown in the 1% Tris-borate-EDTA (TBE) agarose gel in Fig. [30 min at 100 V, 1 kb ladder (NEB Cat. No. N0468S)]. .. The remaining RNA prep was subsequently DNase treated before cDNA synthesis and RT-qPCR.

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size. .. Expression of Hdh mRNA in wild-type and mutant mouse striatal cells (7/7 and 111/111) and EVs was carried with qRT-PCR out using m Hdh Forward/m Hdh reverse (5′-CAGATGTCAGAATGGTGGCT-3′/5′-GCCTTGGAAGAT TAGAATCCA-3′). hprt and beta-actin mRNAs were used to normalize the expression (mHPRT Forward/mHPRT Reverse (5′-GGTTAAGCAGTACAGCCCCA-3′/5′-AGAGGTCCTT TTCACCAGCA-3′); mActB Forward/mActB Reverse (5′-GCTTCTTTGCAGCTCCTTCGT/5′-CCAGCGCAGCGATATCG-3′).

    SYBR Green Assay:

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size. .. Reverse transcription was done using Sensiscript (Qiagen, Valencia, CA USA) and qPCR was carried out with Power SYBR green (Thermal Fisher Scientific) according to manufacture protocol.

    Incubation:

    Article Title: Heterologous Immunity between Adenoviruses and Hepatitis C Virus: A New Paradigm in HCV Immunity and Vaccines
    Article Snippet: PCR tubes containing reaction mixtures were incubated in a thermo-cycler with initial denaturation at 92°C and 40 amplification cycles (92°C: 30 Sec, 50–55°C: 30 Sec, 68°C: 60 Sec). .. PCR amplification products were run on 1% agarose gel at 80 volts to resolve amplification products along with 1 KB sized Quick Load DNA Ladder (Cat.# N0468S, NEB Biolab, Germany).

    Article Title: Fabrication of DNA Polymer Brush Arrays by Destructive Micropatterning and Rolling-Circle Amplification
    Article Snippet: A solution containing 2 U · μL−1 of PvuII (Cat. # R0151M, New England Biolabs) in a digestion buffer (0.050 m potassium acetate, 0.020 m Tris acetate, 0.010 m magnesium acetate, and 0.010 m dithiothreitol, pH = 7.9) was then loaded into the channels and the chip was incubated at 37 °C for ≈12 h. The solution was then collected from each channel and analyzed using agarose gel electrophoresis. .. The length of the RCA products was estimated from the gel using a 1 kb DNA Ladder (Cat. # N0468S, New England Biolabs) and a 1 kb Plus Ladder (Cat. # 10787-026, Invitrogen).

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: A conventional PCR was carried out by Taq DNA Polymerase (Qiagen, Hilden, Germany) using 11FW-modified and 13RV-modified primers; the thermal cycler conditions consisted of an initial incubation at 94°C for 5 min followed by 50 cycles of denaturation at 94°C for 40 sec, annealing at 50°C for 40 sec, and polymerisation at 72°C for 40 sec. A final cycle of extension at 72°C for 30 min was performed to produce a single 3′ deoxiadenosine (A) overhang. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Expressing:

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: Paragraph title: Supporting Information PCR results using primers listed in to amplify DNA extracted from Temecula1 and EB92-1. SDS-PAGE gel analysis of protein extracts from induced E . coli expression cultures used in . Dendrogram and multiple sequence alignment generated using PD1702, PD1703, PD1211 and X . oryzae LipA (LipA). Dendrogram of 6 predicted hemagglutinin-like proteins from X . fastidiosa Temecula1. PCR primers used to attempt detection of selected pathogenicity genes apparently missing in EB92-1. ... Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file.

    Article Title: Molecular and phenotypic characterization of Als1 and Als2 mutations conferring tolerance to acetolactate synthase herbicides in soybean
    Article Snippet: .. Expression of Als1 and Als2 mutations Results of the cDNA cloning of the Als1 and Als2 mutations are shown in the 1% Tris-borate-EDTA (TBE) agarose gel in Fig. [30 min at 100 V, 1 kb ladder (NEB Cat. No. N0468S)]. .. The amplified cDNA fragments appear to match the expected fragment sizes of 2066 bp and 1942 bp for Als1 (see Fig. , lanes marked ‘a’ and ‘b’ respectively) and 2083 bp and 1957 bp for Als2 (see Fig. , lanes marked ‘c’ and ‘d’ respectively).

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: 14 ml polypropylene round-bottom tube (Corning, Falcon® , catalog number: 352057) 1.7 ml polypropylene microcentrifuge tube (Posi-Click Eppendorf) (Denville Scientific, catalog number: C2170) Polypropylene micropipette tips 50 ml polypropylene conical bottom tube (Corning, catalog number: 430291) Two-sided disposable plastic cuvettes 10 mm (VWR, catalog number: 97000-586) 250 ml wide-mouth plastic bottle (Thermo Fisher Scientific, Thermo Scientific™, catalog number: N411-0250) 15 ml polypropylene conical bottom tube (Corning, catalog number: 430052) Chemically competent E. coli (One Shot® BL21 Star (DE3)) (Thermo Fisher Scientific, Invitrogen™, catalog number: C601003); store at −80 °C pGEX-6P-1 plasmid expression vector (GE Healthcare, catalog number: 28-9546-48) containing GST-p300-CH1 domain cDNA Note: The p300-CH1 insert was isolated from a Thrombin-site containing expression vector (pGEX-2T vector containing p300-CH1 insert) ( ) using BamHI and EcoRI restriction enzymes. .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C .

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: RT-PCR to monitor expression of the HTT -exon 1 cassettes was carried out using the following set of HTT primers: HTT Forward/ HTT Reverse (5′-CTGCAGGTCGACTCTAGAGGAT-3′/5′-AAGTCGATGCCCTTCAGCTC-3′), which cover exon sequence at the 5′ end and GFP sequence at the 3′ end on either side of the repeat elements, and GAPDH Forward/GAPDH Reverse (5′-GAAGGTGAAGGTCGGAGTC-′3/5′-GAAGATGGTGATGGGATTTC-′3), using both transfected and stable 293T cells and EVs collected from them. .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size.

    Real-time Polymerase Chain Reaction:

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size. .. Reverse transcription was done using Sensiscript (Qiagen, Valencia, CA USA) and qPCR was carried out with Power SYBR green (Thermal Fisher Scientific) according to manufacture protocol.

    Hybridization:

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. Hybridization at 50 °C, washes, and detection with CDP-star (Roche) were carried out according manufacturer’s instructions.

    Transfection:

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: RT-PCR to monitor expression of the HTT -exon 1 cassettes was carried out using the following set of HTT primers: HTT Forward/ HTT Reverse (5′-CTGCAGGTCGACTCTAGAGGAT-3′/5′-AAGTCGATGCCCTTCAGCTC-3′), which cover exon sequence at the 5′ end and GFP sequence at the 3′ end on either side of the repeat elements, and GAPDH Forward/GAPDH Reverse (5′-GAAGGTGAAGGTCGGAGTC-′3/5′-GAAGATGGTGATGGGATTTC-′3), using both transfected and stable 293T cells and EVs collected from them. .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size.

    Sequencing:

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: Paragraph title: Supporting Information PCR results using primers listed in to amplify DNA extracted from Temecula1 and EB92-1. SDS-PAGE gel analysis of protein extracts from induced E . coli expression cultures used in . Dendrogram and multiple sequence alignment generated using PD1702, PD1703, PD1211 and X . oryzae LipA (LipA). Dendrogram of 6 predicted hemagglutinin-like proteins from X . fastidiosa Temecula1. PCR primers used to attempt detection of selected pathogenicity genes apparently missing in EB92-1. ... Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file.

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: In order to simulate the amplification efficiency of viral reverse-transcribed RNA more closely and to avoid the presence of supercoiled plasmid DNA, the plasmid was linearised above the bat-SARS-like CoV fragment sequence using restriction endonuclease Spe I (Fermentas, Burlington, Ontario, Canada). .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Article Title: Charge density and particle size effects on oligonucleotide and plasmid DNA binding to nanosized hydrotalcite
    Article Snippet: The oligonucleotides Pvu4a (sequence: AAATGAGTCACCCAGATCTAAATAA) and its complement, cPvu4a (sequence: TTATTTAGATCTGGGTGACTCATTT), were purchased from BioServe Biotechnologies, Ltd. .. The 50 bp ladder and Quick-Load 1 kb DNA ladders were purchased from New England BioLabs.

    Article Title: Occurrence of Isopenicillin-N-Synthase Homologs in Bioluminescent Ctenophores and Implications for Coelenterazine Biosynthesis
    Article Snippet: Primers used were: ML0329-end-F2 5′, CCA TGA AGA CTT ACG GAT TTT TCT ACG; ML3250-start-F 5′, GAG ATC AGG AGG AAC ATC GG; ML3250-R 3′, GGA GAA ACA GAA GAA AAA ACA TAC TGT TTA G. Genomic sequence failed to amplify when an alternate 5′ primer for ML0329-end-F1 (TTT CGT TAA TAG CTA TGA AGG TTA TCG C) suggesting there may be base errors. .. 5μ L of Quick-Load 1kb DNA Ladder (New England Biolabs) were used for band-size comparison.

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: RT-PCR to monitor expression of the HTT -exon 1 cassettes was carried out using the following set of HTT primers: HTT Forward/ HTT Reverse (5′-CTGCAGGTCGACTCTAGAGGAT-3′/5′-AAGTCGATGCCCTTCAGCTC-3′), which cover exon sequence at the 5′ end and GFP sequence at the 3′ end on either side of the repeat elements, and GAPDH Forward/GAPDH Reverse (5′-GAAGGTGAAGGTCGGAGTC-′3/5′-GAAGATGGTGATGGGATTTC-′3), using both transfected and stable 293T cells and EVs collected from them. .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size.

    Southern Blot:

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: .. For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. After electrophoresis the DNA was depurinated, denatured, and neutralized exactly as described by Cai et al. ( ) and transferred onto Hybond XL membrane (Amersham) by using the TurboBlotter system (GE Healthcare). (-) strand HBV DNA was detected with a DIG-labeled (+) strand HBV RNA probe transcribed from a ScaI-linearized pGEM3Z-HBV plasmid with DIG Northern Starter Kit (Roche) according to manufacturer’s instructions.

    Northern Blot:

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. After electrophoresis the DNA was depurinated, denatured, and neutralized exactly as described by Cai et al. ( ) and transferred onto Hybond XL membrane (Amersham) by using the TurboBlotter system (GE Healthcare). (-) strand HBV DNA was detected with a DIG-labeled (+) strand HBV RNA probe transcribed from a ScaI-linearized pGEM3Z-HBV plasmid with DIG Northern Starter Kit (Roche) according to manufacturer’s instructions.

    Generated:

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: Paragraph title: Supporting Information PCR results using primers listed in to amplify DNA extracted from Temecula1 and EB92-1. SDS-PAGE gel analysis of protein extracts from induced E . coli expression cultures used in . Dendrogram and multiple sequence alignment generated using PD1702, PD1703, PD1211 and X . oryzae LipA (LipA). Dendrogram of 6 predicted hemagglutinin-like proteins from X . fastidiosa Temecula1. PCR primers used to attempt detection of selected pathogenicity genes apparently missing in EB92-1. ... Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file.

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: The generated amplicons were resolved by horizontal electrophoresis on 1.5% (wt/vol) Tris-Borate-EDTA (Merck, Germany) agarose gels together with the Quick-load®1-kb (Biolabs, New England) and run in an electric field of 110 V for 2 h 30 min. Electrophoresis gels were visualized by a UV light trans-illuminator, images were captured using a Gel Doc™ XR+ system (BioRad Laboratories, CA, Foster City, USA) and analysed by Image Lab™ Software (version 4.0, BioRad Laboratories, CA, Foster City, USA). .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard.

    Imaging:

    Article Title: Naked mole-rats maintain healthy skeletal muscle and Complex IV mitochondrial enzyme function into old age
    Article Snippet: .. The products were ran alongside a Quick-Load® 1Kb DNA Ladder (New England BioLabs Inc.) and visualized for evaluation under UV light (BioRad ChemiDoc™ MP Imaging System). .. Sequencing of altered copies of mtDNA from long-range PCR products Long-range PCR was performed as previously, and putative deletion bands were extracted from agarose gels and purified.

    Polymerase Chain Reaction:

    Article Title: Heterologous Immunity between Adenoviruses and Hepatitis C Virus: A New Paradigm in HCV Immunity and Vaccines
    Article Snippet: .. PCR amplification products were run on 1% agarose gel at 80 volts to resolve amplification products along with 1 KB sized Quick Load DNA Ladder (Cat.# N0468S, NEB Biolab, Germany). .. Adjuvants Toll-like receptor-3 agonist poly I:C (Cat.# P1530, Sigma-Aldrich, St. Louis, MO, USA) was used as an adjuvant for immunization with Ad vector.

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: Paragraph title: Supporting Information PCR results using primers listed in to amplify DNA extracted from Temecula1 and EB92-1. SDS-PAGE gel analysis of protein extracts from induced E . coli expression cultures used in . Dendrogram and multiple sequence alignment generated using PD1702, PD1703, PD1211 and X . oryzae LipA (LipA). Dendrogram of 6 predicted hemagglutinin-like proteins from X . fastidiosa Temecula1. PCR primers used to attempt detection of selected pathogenicity genes apparently missing in EB92-1. ... Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file.

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: The amplification product was purified by the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) following the supplier's recommendations and was cloned into the pCR4 vector using the TOPO TA Cloning Kit (Invitrogen, Leek, The Netherland), according to the manufacturer's instructions. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Article Title: Characterization of newly isolated oleaginous yeasts - Cryptococcus podzolicus, Trichosporon porosum and Pichia segobiensis
    Article Snippet: .. The final extension was done at 72°C for 10 min. PCR products were visualized on 1% agarose gel (1× TAE-buffer: 40 mM Tris base, 1 mM EDTA, pH 8 adjusted with acetic acid; 0.1 μg/ml ethidium bromide) after carrying out gel electrophoresis of each PCR amplification product and 6 μl Quick Load 1 kb DNA Ladder (New England Biolabs, Frankfurt/Main, Germany; N0468 S) with 1× TAE buffer at 100 V for 1 h. Distilled water was used as negative control. ..

    Article Title: High-Resolution “Fleezers”: Dual-Trap Optical Tweezers Combined with Single-Molecule Fluorescence Detection
    Article Snippet: QIAquick PCR purification kit (Qiagen, 28104). .. 1 kb DNA ladder (NEB, N0468S).

    Article Title: Occurrence of Isopenicillin-N-Synthase Homologs in Bioluminescent Ctenophores and Implications for Coelenterazine Biosynthesis
    Article Snippet: Paragraph title: PCR amplification ... 5μ L of Quick-Load 1kb DNA Ladder (New England Biolabs) were used for band-size comparison.

    Article Title: Naked mole-rats maintain healthy skeletal muscle and Complex IV mitochondrial enzyme function into old age
    Article Snippet: Paragraph title: Analysis of wild-type and altered mtDNA by long-range PCR ... The products were ran alongside a Quick-Load® 1Kb DNA Ladder (New England BioLabs Inc.) and visualized for evaluation under UV light (BioRad ChemiDoc™ MP Imaging System).

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: The primers ERIC1 5’ATGTAAGCTCCTGGGGATTCAC3’ and ERIC2 5’AAGTAAGTGACTGGGGTGAGCG3’ [ ] were used and PCR reactions were carried out in a 10 μl volume containing 5 μl of DreamTaq Green Polymerase Master Mix 2X (Thermo Fisher Scientific, Johannesburg, South Africa), 2.8 μl of nuclease free water, 0.1 μl of each primer (100 μM), and 2 μl of DNA template. .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard.

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size. .. Expression of Hdh mRNA in wild-type and mutant mouse striatal cells (7/7 and 111/111) and EVs was carried with qRT-PCR out using m Hdh Forward/m Hdh reverse (5′-CAGATGTCAGAATGGTGGCT-3′/5′-GCCTTGGAAGAT TAGAATCCA-3′). hprt and beta-actin mRNAs were used to normalize the expression (mHPRT Forward/mHPRT Reverse (5′-GGTTAAGCAGTACAGCCCCA-3′/5′-AGAGGTCCTT TTCACCAGCA-3′); mActB Forward/mActB Reverse (5′-GCTTCTTTGCAGCTCCTTCGT/5′-CCAGCGCAGCGATATCG-3′).

    Recombinant:

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: The resulting recombinant plasmid purification was carried out using the PureLink Quick Plasmid Miniprep Kit (Invitrogen, Leek, the Netherland); purity was assessed by a spectrophotometer using the 260/280 nm ratio. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Molecular Weight:

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: .. Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file. .. SDS-PAGE gel analysis of protein extracts from induced E . coli expression cultures used in .

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard. .. For cluster analysis, data were exported to Bionumerics software (version 7.6, Applied Maths, TX, USA).

    DNA Extraction:

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C . .. Zinc chloride (ZnCl2 ), 99.999% trace metals basis powdered (Sigma-Aldrich, catalog number: 229997) Note: Prepare as 100 mM stock in deionized water .

    Nucleic Acid Electrophoresis:

    Article Title: Fabrication of DNA Polymer Brush Arrays by Destructive Micropatterning and Rolling-Circle Amplification
    Article Snippet: Paragraph title: Characterization by Gel Electrophoresis ... The length of the RCA products was estimated from the gel using a 1 kb DNA Ladder (Cat. # N0468S, New England Biolabs) and a 1 kb Plus Ladder (Cat. # 10787-026, Invitrogen).

    Article Title: Characterization of newly isolated oleaginous yeasts - Cryptococcus podzolicus, Trichosporon porosum and Pichia segobiensis
    Article Snippet: .. The final extension was done at 72°C for 10 min. PCR products were visualized on 1% agarose gel (1× TAE-buffer: 40 mM Tris base, 1 mM EDTA, pH 8 adjusted with acetic acid; 0.1 μg/ml ethidium bromide) after carrying out gel electrophoresis of each PCR amplification product and 6 μl Quick Load 1 kb DNA Ladder (New England Biolabs, Frankfurt/Main, Germany; N0468 S) with 1× TAE buffer at 100 V for 1 h. Distilled water was used as negative control. ..

    Mutagenesis:

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size. .. Expression of Hdh mRNA in wild-type and mutant mouse striatal cells (7/7 and 111/111) and EVs was carried with qRT-PCR out using m Hdh Forward/m Hdh reverse (5′-CAGATGTCAGAATGGTGGCT-3′/5′-GCCTTGGAAGAT TAGAATCCA-3′). hprt and beta-actin mRNAs were used to normalize the expression (mHPRT Forward/mHPRT Reverse (5′-GGTTAAGCAGTACAGCCCCA-3′/5′-AGAGGTCCTT TTCACCAGCA-3′); mActB Forward/mActB Reverse (5′-GCTTCTTTGCAGCTCCTTCGT/5′-CCAGCGCAGCGATATCG-3′).

    Isolation:

    Article Title: Molecular and phenotypic characterization of Als1 and Als2 mutations conferring tolerance to acetolactate synthase herbicides in soybean
    Article Snippet: Expression of Als1 and Als2 mutations Results of the cDNA cloning of the Als1 and Als2 mutations are shown in the 1% Tris-borate-EDTA (TBE) agarose gel in Fig. [30 min at 100 V, 1 kb ladder (NEB Cat. No. N0468S)]. .. The faint bands in the no-RT control lanes can be attributed to slight genomic contamination, as the original RNA isolation preparation was not DNase treated.

    Article Title: Characterization of newly isolated oleaginous yeasts - Cryptococcus podzolicus, Trichosporon porosum and Pichia segobiensis
    Article Snippet: Identification of the isolates Genomic DNA was isolated using the commercial kit “Precellys Bacterial/ Fungal DNA-Kit” (PEQLAB Biotechnologie GmbH, Erlangen, Germany; 12-7511-00). .. The final extension was done at 72°C for 10 min. PCR products were visualized on 1% agarose gel (1× TAE-buffer: 40 mM Tris base, 1 mM EDTA, pH 8 adjusted with acetic acid; 0.1 μg/ml ethidium bromide) after carrying out gel electrophoresis of each PCR amplification product and 6 μl Quick Load 1 kb DNA Ladder (New England Biolabs, Frankfurt/Main, Germany; N0468 S) with 1× TAE buffer at 100 V for 1 h. Distilled water was used as negative control.

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: 14 ml polypropylene round-bottom tube (Corning, Falcon® , catalog number: 352057) 1.7 ml polypropylene microcentrifuge tube (Posi-Click Eppendorf) (Denville Scientific, catalog number: C2170) Polypropylene micropipette tips 50 ml polypropylene conical bottom tube (Corning, catalog number: 430291) Two-sided disposable plastic cuvettes 10 mm (VWR, catalog number: 97000-586) 250 ml wide-mouth plastic bottle (Thermo Fisher Scientific, Thermo Scientific™, catalog number: N411-0250) 15 ml polypropylene conical bottom tube (Corning, catalog number: 430052) Chemically competent E. coli (One Shot® BL21 Star (DE3)) (Thermo Fisher Scientific, Invitrogen™, catalog number: C601003); store at −80 °C pGEX-6P-1 plasmid expression vector (GE Healthcare, catalog number: 28-9546-48) containing GST-p300-CH1 domain cDNA Note: The p300-CH1 insert was isolated from a Thrombin-site containing expression vector (pGEX-2T vector containing p300-CH1 insert) ( ) using BamHI and EcoRI restriction enzymes. .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C .

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: RNA and DNA were isolated from lentivirus-transduced cells and EVs collected from them. .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size.

    Size-exclusion Chromatography:

    Article Title: Heterologous Immunity between Adenoviruses and Hepatitis C Virus: A New Paradigm in HCV Immunity and Vaccines
    Article Snippet: PCR tubes containing reaction mixtures were incubated in a thermo-cycler with initial denaturation at 92°C and 40 amplification cycles (92°C: 30 Sec, 50–55°C: 30 Sec, 68°C: 60 Sec). .. PCR amplification products were run on 1% agarose gel at 80 volts to resolve amplification products along with 1 KB sized Quick Load DNA Ladder (Cat.# N0468S, NEB Biolab, Germany).

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: A conventional PCR was carried out by Taq DNA Polymerase (Qiagen, Hilden, Germany) using 11FW-modified and 13RV-modified primers; the thermal cycler conditions consisted of an initial incubation at 94°C for 5 min followed by 50 cycles of denaturation at 94°C for 40 sec, annealing at 50°C for 40 sec, and polymerisation at 72°C for 40 sec. A final cycle of extension at 72°C for 30 min was performed to produce a single 3′ deoxiadenosine (A) overhang. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Purification:

    Article Title: Heterologous Immunity between Adenoviruses and Hepatitis C Virus: A New Paradigm in HCV Immunity and Vaccines
    Article Snippet: DNA Purification and PCR Amplification DNA was purified from Ad, rAd-core, rAd-NS3, rAd-NS4, rAd-NS5a and rAd-NS5b vector stocks. .. PCR amplification products were run on 1% agarose gel at 80 volts to resolve amplification products along with 1 KB sized Quick Load DNA Ladder (Cat.# N0468S, NEB Biolab, Germany).

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: The resulting recombinant plasmid purification was carried out using the PureLink Quick Plasmid Miniprep Kit (Invitrogen, Leek, the Netherland); purity was assessed by a spectrophotometer using the 260/280 nm ratio. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Article Title: High-Resolution “Fleezers”: Dual-Trap Optical Tweezers Combined with Single-Molecule Fluorescence Detection
    Article Snippet: QIAquick PCR purification kit (Qiagen, 28104). .. 1 kb DNA ladder (NEB, N0468S).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: RT-PCR to monitor expression of the HTT -exon 1 cassettes was carried out using the following set of HTT primers: HTT Forward/ HTT Reverse (5′-CTGCAGGTCGACTCTAGAGGAT-3′/5′-AAGTCGATGCCCTTCAGCTC-3′), which cover exon sequence at the 5′ end and GFP sequence at the 3′ end on either side of the repeat elements, and GAPDH Forward/GAPDH Reverse (5′-GAAGGTGAAGGTCGGAGTC-′3/5′-GAAGATGGTGATGGGATTTC-′3), using both transfected and stable 293T cells and EVs collected from them. .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size.

    Construct:

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard. .. Dendrograms were constructed based on the average linkages of the matrix and using the Unweighted Pair-Group Method (UPGMA).

    Chromatin Immunoprecipitation:

    Article Title: Fabrication of DNA Polymer Brush Arrays by Destructive Micropatterning and Rolling-Circle Amplification
    Article Snippet: A solution containing 2 U · μL−1 of PvuII (Cat. # R0151M, New England Biolabs) in a digestion buffer (0.050 m potassium acetate, 0.020 m Tris acetate, 0.010 m magnesium acetate, and 0.010 m dithiothreitol, pH = 7.9) was then loaded into the channels and the chip was incubated at 37 °C for ≈12 h. The solution was then collected from each channel and analyzed using agarose gel electrophoresis. .. The length of the RCA products was estimated from the gel using a 1 kb DNA Ladder (Cat. # N0468S, New England Biolabs) and a 1 kb Plus Ladder (Cat. # 10787-026, Invitrogen).

    SDS Page:

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: Paragraph title: Supporting Information PCR results using primers listed in to amplify DNA extracted from Temecula1 and EB92-1. SDS-PAGE gel analysis of protein extracts from induced E . coli expression cultures used in . Dendrogram and multiple sequence alignment generated using PD1702, PD1703, PD1211 and X . oryzae LipA (LipA). Dendrogram of 6 predicted hemagglutinin-like proteins from X . fastidiosa Temecula1. PCR primers used to attempt detection of selected pathogenicity genes apparently missing in EB92-1. ... Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file.

    Plasmid Preparation:

    Article Title: Heterologous Immunity between Adenoviruses and Hepatitis C Virus: A New Paradigm in HCV Immunity and Vaccines
    Article Snippet: Briefly, 1x108 pfu of each vector was taken in individual tubes and DNA was prepared by using High-Pure Viral Nucleic Acid KitR (cat.# 11 858 874 001, Roche Applied Bio). .. PCR amplification products were run on 1% agarose gel at 80 volts to resolve amplification products along with 1 KB sized Quick Load DNA Ladder (Cat.# N0468S, NEB Biolab, Germany).

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. After electrophoresis the DNA was depurinated, denatured, and neutralized exactly as described by Cai et al. ( ) and transferred onto Hybond XL membrane (Amersham) by using the TurboBlotter system (GE Healthcare). (-) strand HBV DNA was detected with a DIG-labeled (+) strand HBV RNA probe transcribed from a ScaI-linearized pGEM3Z-HBV plasmid with DIG Northern Starter Kit (Roche) according to manufacturer’s instructions.

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file. .. Lane 1, protein marker (Precision Plus Protein All Blue Prestained Standards, #161–0373, Bio-Rad); Lane 2, total protein from empty vector pET27b cultures ("Total CK"); Lane 3, supernatant protein from empty vector pET27b ("Supernatant CK"); Lane 3, total protein from pSZ37 cultures ("Total LipA"); Lane 4, supernatant protein from pSZ37 cultures ("Supernatant LipA").

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA). .. The copy number (CN) of standard plasmid DNA was calculated using the equation described by the US Environmental Protection Agency protocol [ ].

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C . .. Zinc chloride (ZnCl2 ), 99.999% trace metals basis powdered (Sigma-Aldrich, catalog number: 229997) Note: Prepare as 100 mM stock in deionized water .

    Software:

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: The generated amplicons were resolved by horizontal electrophoresis on 1.5% (wt/vol) Tris-Borate-EDTA (Merck, Germany) agarose gels together with the Quick-load®1-kb (Biolabs, New England) and run in an electric field of 110 V for 2 h 30 min. Electrophoresis gels were visualized by a UV light trans-illuminator, images were captured using a Gel Doc™ XR+ system (BioRad Laboratories, CA, Foster City, USA) and analysed by Image Lab™ Software (version 4.0, BioRad Laboratories, CA, Foster City, USA). .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard.

    Electrophoresis:

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: .. For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. After electrophoresis the DNA was depurinated, denatured, and neutralized exactly as described by Cai et al. ( ) and transferred onto Hybond XL membrane (Amersham) by using the TurboBlotter system (GE Healthcare). (-) strand HBV DNA was detected with a DIG-labeled (+) strand HBV RNA probe transcribed from a ScaI-linearized pGEM3Z-HBV plasmid with DIG Northern Starter Kit (Roche) according to manufacturer’s instructions.

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA). .. The copy number (CN) of standard plasmid DNA was calculated using the equation described by the US Environmental Protection Agency protocol [ ].

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: .. Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C . .. Zinc chloride (ZnCl2 ), 99.999% trace metals basis powdered (Sigma-Aldrich, catalog number: 229997) Note: Prepare as 100 mM stock in deionized water .

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: The generated amplicons were resolved by horizontal electrophoresis on 1.5% (wt/vol) Tris-Borate-EDTA (Merck, Germany) agarose gels together with the Quick-load®1-kb (Biolabs, New England) and run in an electric field of 110 V for 2 h 30 min. Electrophoresis gels were visualized by a UV light trans-illuminator, images were captured using a Gel Doc™ XR+ system (BioRad Laboratories, CA, Foster City, USA) and analysed by Image Lab™ Software (version 4.0, BioRad Laboratories, CA, Foster City, USA). .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard.

    Negative Control:

    Article Title: Characterization of newly isolated oleaginous yeasts - Cryptococcus podzolicus, Trichosporon porosum and Pichia segobiensis
    Article Snippet: .. The final extension was done at 72°C for 10 min. PCR products were visualized on 1% agarose gel (1× TAE-buffer: 40 mM Tris base, 1 mM EDTA, pH 8 adjusted with acetic acid; 0.1 μg/ml ethidium bromide) after carrying out gel electrophoresis of each PCR amplification product and 6 μl Quick Load 1 kb DNA Ladder (New England Biolabs, Frankfurt/Main, Germany; N0468 S) with 1× TAE buffer at 100 V for 1 h. Distilled water was used as negative control. ..

    Agarose Gel Electrophoresis:

    Article Title: Heterologous Immunity between Adenoviruses and Hepatitis C Virus: A New Paradigm in HCV Immunity and Vaccines
    Article Snippet: .. PCR amplification products were run on 1% agarose gel at 80 volts to resolve amplification products along with 1 KB sized Quick Load DNA Ladder (Cat.# N0468S, NEB Biolab, Germany). .. Adjuvants Toll-like receptor-3 agonist poly I:C (Cat.# P1530, Sigma-Aldrich, St. Louis, MO, USA) was used as an adjuvant for immunization with Ad vector.

    Article Title: Fabrication of DNA Polymer Brush Arrays by Destructive Micropatterning and Rolling-Circle Amplification
    Article Snippet: A solution containing 2 U · μL−1 of PvuII (Cat. # R0151M, New England Biolabs) in a digestion buffer (0.050 m potassium acetate, 0.020 m Tris acetate, 0.010 m magnesium acetate, and 0.010 m dithiothreitol, pH = 7.9) was then loaded into the channels and the chip was incubated at 37 °C for ≈12 h. The solution was then collected from each channel and analyzed using agarose gel electrophoresis. .. The length of the RCA products was estimated from the gel using a 1 kb DNA Ladder (Cat. # N0468S, New England Biolabs) and a 1 kb Plus Ladder (Cat. # 10787-026, Invitrogen).

    Article Title: Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation
    Article Snippet: .. For Southern blot analysis, 0.5 μL of Quick-Load 1-kb DNA ladder (New England Biolabs) and 15 μg ( ) or 25 μg ( ) of HIRT-extracted DNA were loaded per lane and separated by electrophoresis in a 1.2% (wt/vol) agarose gel in 1× Tris-Acetate-EDTA buffer. .. After electrophoresis the DNA was depurinated, denatured, and neutralized exactly as described by Cai et al. ( ) and transferred onto Hybond XL membrane (Amersham) by using the TurboBlotter system (GE Healthcare). (-) strand HBV DNA was detected with a DIG-labeled (+) strand HBV RNA probe transcribed from a ScaI-linearized pGEM3Z-HBV plasmid with DIG Northern Starter Kit (Roche) according to manufacturer’s instructions.

    Article Title: Molecular and phenotypic characterization of Als1 and Als2 mutations conferring tolerance to acetolactate synthase herbicides in soybean
    Article Snippet: .. Expression of Als1 and Als2 mutations Results of the cDNA cloning of the Als1 and Als2 mutations are shown in the 1% Tris-borate-EDTA (TBE) agarose gel in Fig. [30 min at 100 V, 1 kb ladder (NEB Cat. No. N0468S)]. .. The amplified cDNA fragments appear to match the expected fragment sizes of 2066 bp and 1942 bp for Als1 (see Fig. , lanes marked ‘a’ and ‘b’ respectively) and 2083 bp and 1957 bp for Als2 (see Fig. , lanes marked ‘c’ and ‘d’ respectively).

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA). .. The copy number (CN) of standard plasmid DNA was calculated using the equation described by the US Environmental Protection Agency protocol [ ].

    Article Title: Characterization of newly isolated oleaginous yeasts - Cryptococcus podzolicus, Trichosporon porosum and Pichia segobiensis
    Article Snippet: .. The final extension was done at 72°C for 10 min. PCR products were visualized on 1% agarose gel (1× TAE-buffer: 40 mM Tris base, 1 mM EDTA, pH 8 adjusted with acetic acid; 0.1 μg/ml ethidium bromide) after carrying out gel electrophoresis of each PCR amplification product and 6 μl Quick Load 1 kb DNA Ladder (New England Biolabs, Frankfurt/Main, Germany; N0468 S) with 1× TAE buffer at 100 V for 1 h. Distilled water was used as negative control. ..

    Article Title: Occurrence of Isopenicillin-N-Synthase Homologs in Bioluminescent Ctenophores and Implications for Coelenterazine Biosynthesis
    Article Snippet: The 1% agarose gel containing 5μ L ethidium bromide was visualized and photographed under UV light. .. 5μ L of Quick-Load 1kb DNA Ladder (New England Biolabs) were used for band-size comparison.

    Article Title: Naked mole-rats maintain healthy skeletal muscle and Complex IV mitochondrial enzyme function into old age
    Article Snippet: 8 μL of Second Round amplified products were combined with 2 μL Loading buffer and separated using a GelRed Nucleic Acid (Biotium) stained 0.8% agarose gel, electrophoresed at 85V for 3 hours. .. The products were ran alongside a Quick-Load® 1Kb DNA Ladder (New England BioLabs Inc.) and visualized for evaluation under UV light (BioRad ChemiDoc™ MP Imaging System).

    Article Title: Potential Transfer of Polyglutamine and CAG-Repeat RNA in Extracellular Vesicles in Huntington’s Disease: Background and Evaluation in Cell Culture
    Article Snippet: .. The PCR product along with Quick-Load 1 Kb DNA ladder (NEB, Ipswich, MA USA) were then run on a 2 % agarose gel (Apex Bioresearch Product, Whitmore Lake, MI USA) to check if they were the right size. .. Expression of Hdh mRNA in wild-type and mutant mouse striatal cells (7/7 and 111/111) and EVs was carried with qRT-PCR out using m Hdh Forward/m Hdh reverse (5′-CAGATGTCAGAATGGTGGCT-3′/5′-GCCTTGGAAGAT TAGAATCCA-3′). hprt and beta-actin mRNAs were used to normalize the expression (mHPRT Forward/mHPRT Reverse (5′-GGTTAAGCAGTACAGCCCCA-3′/5′-AGAGGTCCTT TTCACCAGCA-3′); mActB Forward/mActB Reverse (5′-GCTTCTTTGCAGCTCCTTCGT/5′-CCAGCGCAGCGATATCG-3′).

    Nuclear Magnetic Resonance:

    Article Title: Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
    Article Snippet: Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: K0502) Bam HI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0054); store at −20 °C Restriction enzyme buffer FastDigest (10×; 5× 1 ml) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: B64); store at −20 °C Eco RI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo Scientific™, catalog number: FD0274); store at −20 °C Quick-Load 1 kb DNA ladder (New England Biolabs) 5× nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767) Deionized water Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4–20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094) Agar powdered (Fisher Scientific, catalog number: BP24662) 1× TAE running buffer Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15585011) Glycerol 100% (EMD Millipore, catalog number: GX0185) Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100) Note: Prepare 10 ml of 1 M (10,000×) stock in deionized water and store at −20 °C . .. Coomassie Brilliant Blue G-250 (Bio-Rad Laboratories, catalog number: 1610406) Ethylenediaminetetraacetate acid disodium salt (EDTA) Tris base (White Crystals or Crystalline Powder/Molecular Biology) (Fisher Scientific, catalog number: BP152) Sodium chloride (NaCl) (Fisher Scientific, catalog number: BP358-10) Sodium hydroxide (NaOH) (BioUltra, for molecular biology, 10 M in H2 O) (Sigma-Aldrich, catalog number: 72068) Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (powder, ≥ 98% purity, 10 g) (Sigma-Aldrich, catalog number: C4706) Tris-d11 DTT-d10 Acidic resuspension buffer (pH 6.3) (see Recipes) Alkaline resuspension buffer (pH 8.0) (see Recipes) HRV3C PreScission Site Protease buffer (pH 8.0) (see Recipes) 10% (v/v) deuterated Buffer for NMR (pH 8.0) (see Recipes) LB Miller medium (see Recipes)

    Spectrophotometry:

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: The resulting recombinant plasmid purification was carried out using the PureLink Quick Plasmid Miniprep Kit (Invitrogen, Leek, the Netherland); purity was assessed by a spectrophotometer using the 260/280 nm ratio. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Sampling:

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: Genomic fingerprinting Enterobacterial Repetitive Intergenic Consensus-Polymerase Chain Reaction (ERIC-PCR) was used to establish the link of different strains within and between hospitals, wards, carriage and clinical samples as well as across sampling points. .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard.

    Produced:

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: The template DNA to be inserted as a target sequence in the plasmid vector was produced by amplifying the cDNA obtained from sample 893/09-11, an Italian bat-SARS-like CoV detected and only partially sequenced by the authors in a preceding survey [ ]. .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA).

    Article Title: Characterization of newly isolated oleaginous yeasts - Cryptococcus podzolicus, Trichosporon porosum and Pichia segobiensis
    Article Snippet: Afterwards polymerase-chain reaction (PCR) fragments were produced applying universal primers ITS1 (5′-TCCGTAGGTGAACCTGCG-3′) (Eurofins MWG GmbH, Ebersberg, Germany) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) (Eurofins MWG GmbH, Ebersberg, Germany) (Fujita et al. [ ]). .. The final extension was done at 72°C for 10 min. PCR products were visualized on 1% agarose gel (1× TAE-buffer: 40 mM Tris base, 1 mM EDTA, pH 8 adjusted with acetic acid; 0.1 μg/ml ethidium bromide) after carrying out gel electrophoresis of each PCR amplification product and 6 μl Quick Load 1 kb DNA Ladder (New England Biolabs, Frankfurt/Main, Germany; N0468 S) with 1× TAE buffer at 100 V for 1 h. Distilled water was used as negative control.

    Concentration Assay:

    Article Title: Fabrication of DNA Polymer Brush Arrays by Destructive Micropatterning and Rolling-Circle Amplification
    Article Snippet: The enzyme was inactivated by heating the chip at 70 °C for 10 min. A poly-T oligonucleotide primer, 5′-TTT TTT TTT TTT TTT TTT TTT TTT T-3′ (PT25), at a concentration of 10−6 m in a 2X SSC solution was then hybridized to the polyA tails using the procedure described above. .. The length of the RCA products was estimated from the gel using a 1 kb DNA Ladder (Cat. # N0468S, New England Biolabs) and a 1 kb Plus Ladder (Cat. # 10787-026, Invitrogen).

    DNA Purification:

    Article Title: Heterologous Immunity between Adenoviruses and Hepatitis C Virus: A New Paradigm in HCV Immunity and Vaccines
    Article Snippet: Paragraph title: DNA Purification and PCR Amplification ... PCR amplification products were run on 1% agarose gel at 80 volts to resolve amplification products along with 1 KB sized Quick Load DNA Ladder (Cat.# N0468S, NEB Biolab, Germany).

    Marker:

    Article Title: Three New Pierce's Disease Pathogenicity Effectors Identified Using Xylella fastidiosa Biocontrol Strain EB92-1
    Article Snippet: Lane 1, Temecula1; Lane 2, EB92-1; Lane 3, water; PCR primer sets (gene target and PCR product sizes) used were: (A) PD1702+3-F and PD1703-R (PD1703, 1.2 Kb); (B) PD0911-F and PD0916-R (PD0915/PD0928, 4.2 kb); (C) ZOT-F and ZOT-R (PD0915/PD0928, 1.4 kb); (D) PD0956-F and PD0956-R (PD0956, 1.0 kb); (E) XFEB114-F and XFEB114-R1 (PD0956, 1.9 kb); (F) PD0956-NF and PD0956-NR (PD0956, 1.5 kb); (G) PD0986-F and PD0986-R (PD0986, 1.2 kb); (H) PD0986-NF and PD0986NR (PD0986, 2.0 kb); (I) RST31 and RST33 (X . fastidiosa marker gene, 0.7 kb). .. Molecular weight markers used were Quick-Load 1 kb DNA Ladder from New England Biolabs Inc. (Beverly, MA). (TIF) Click here for additional data file.

    Article Title: Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa
    Article Snippet: .. ERIC-PCR profiles were normalized using the Quick-load®1-kb (Biolabs, New England) DNA molecular weight marker as the external standard. .. For cluster analysis, data were exported to Bionumerics software (version 7.6, Applied Maths, TX, USA).

    Staining:

    Article Title: A Real-Time PCR Assay for Bat SARS-Like Coronavirus Detection and Its Application to Italian Greater Horseshoe Bat Faecal Sample Surveys
    Article Snippet: .. The linearised plasmid was visualised and quantified by electrophoresis on 1% (w/v) agarose gel stained with ethidium bromide in 1x standard TAE buffer and using a Quick-Load 1Kb DNA Ladder (New England BioLabs, Ipswich, MA, USA). .. The copy number (CN) of standard plasmid DNA was calculated using the equation described by the US Environmental Protection Agency protocol [ ].

    Article Title: Naked mole-rats maintain healthy skeletal muscle and Complex IV mitochondrial enzyme function into old age
    Article Snippet: 8 μL of Second Round amplified products were combined with 2 μL Loading buffer and separated using a GelRed Nucleic Acid (Biotium) stained 0.8% agarose gel, electrophoresed at 85V for 3 hours. .. The products were ran alongside a Quick-Load® 1Kb DNA Ladder (New England BioLabs Inc.) and visualized for evaluation under UV light (BioRad ChemiDoc™ MP Imaging System).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs quick load 1 kb dna ladder
    Quick Load 1 Kb Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick load 1 kb dna ladder/product/New England Biolabs
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    quick load 1 kb dna ladder - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results