deoxynucleotides  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Deoxynucleotide Solution Set
    Description:
    Deoxynucleotide Solution Set 25 umol of each
    Catalog Number:
    n0446s
    Price:
    172
    Size:
    25 umol of each
    Category:
    Deoxynucleotides
    Buy from Supplier


    Structured Review

    New England Biolabs deoxynucleotides
    Deoxynucleotide Solution Set
    Deoxynucleotide Solution Set 25 umol of each
    https://www.bioz.com/result/deoxynucleotides/product/New England Biolabs
    Average 95 stars, based on 769 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotides - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Methylation Sequencing:

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Paragraph title: Reduced representation bisulfite sequencing ... Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl.

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Paragraph title: Reduced representation bisulfite sequencing ... Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl.

    Amplification:

    Article Title: MYC-driven epigenetic reprogramming favors the onset of tumorigenesis by inducing a stem cell-like state
    Article Snippet: Briefly, end repair of DNA fragments was achieved by sequential 15 min incubations at 12 °C and 25 °C with 0.15 U/μl T4 PNK (NEB #M0201L), 0.04 U/μl T4 POL (NEB #M0203L) and 0.1 m m dNTPs (NEB #N0446S). .. Processed DNA fragments were finally amplified with a thermal cycler for 14 cycles, by using the PfuUltra II Fusion HS DNA Pol kit (Agilent #600674).

    Article Title: A modified protocol yields high-quality RNA from highly mucilaginous Dioscorea tubers
    Article Snippet: Paragraph title: cDNA synthesis and amplification of genes from the extracted RNA ... The PCR components used were dNTPs (NEB, Catalog No N0446S), primers, Phusion High-Fidelity DNA polymerase (Cat no M0530S), and buffer.

    Titration:

    Article Title: Microdroplet-based PCR amplification for large scale targeted sequencing
    Article Snippet: .. The genomic DNA samples are processed on ice: 7.8 μg of genomic DNA in 25 μL nuclease free water (Fisher, 50843418), 37.5 μL of NEBuffer 2 (NEB, B7002S), 37.5 μL of a mixture of 1 mM each dCTP, dGTP, dTTP (NEB, N0446S), 18.75 μL of 0.4 mM Biotin-14 dATP (Invitrogen, 19524-016), 211.25 μL nuclease free water (Fisher, 50843418), 7.5 μL DNA polymerase I (10 units/μL) (NEB, M0209S), 37.5 μL of DNase I (NEB, M0303S) at a concentration determined by titration to achieve a 2-4 kb size distribution. .. The Genomic DNA fragmentation reaction mix is incubated at 15°C for 90 minutes and the reaction stopped by adding 37.5 μL of 0.5 M EDTA, pH 8.0 (Ambion, AM9260G).

    Synthesized:

    Article Title: A modified protocol yields high-quality RNA from highly mucilaginous Dioscorea tubers
    Article Snippet: The dioscorin (storage protein) gene (partial) was amplified using primers CA 5.1F (GAGGATGAGTTTAGCTACATT) and CA 3.1R (TAAGCATCACCATATTACACT) designed employing NCBI primer BLAST tool and the software Primer 3 and synthesized at Eurofins Genomics, Bangalore, India. .. The PCR components used were dNTPs (NEB, Catalog No N0446S), primers, Phusion High-Fidelity DNA polymerase (Cat no M0530S), and buffer.

    Article Title: Mutation of DNA Polymerase β R137Q Results in Retarded Embryo Development Due to Impaired DNA Base Excision Repair in Mice
    Article Snippet: Reagents and antibodies All primers and DNA substrates used in this paper were synthesized by GenScript Inc. using polyacrylamide gel electrophoresis (PAGE) purification. .. Four deoxynucleotide triphosphates (dNTPs) were purchased from New England Biolabs (N0446S).

    Article Title: R152C DNA Pol β mutation impairs base excision repair and induces cellular transformation
    Article Snippet: Reagents and antibodies All primers and DNA substrates used in this paper were synthesized by GenScript, Inc. using polyacrylamide gel electrophoresis (PAGE) purification. .. Four deoxynucleotide triphosphates (dNTPs) were purchased from New England Biolabs (N0446S).

    Construct:

    Article Title: An Immunocompetent Mouse Model of HPV16(+) Head and Neck Squamous Cell Carcinoma
    Article Snippet: RNA was then prepared using NucleoZOL (Macherey-Nagel, cat. #: 740404.200) in accordance with the manufacturer’s instructions. cDNA was made from 0.5–1 µg of RNA using SuperScript IV Reverse Transcriptase (Invitrogen, cat. #: 18090050) with dNTPs (NEB, cat. #: N0446S), RNase inhibitor (Applied Biosystems, cat. #: N808–0119), and 50 µM oligo d(T)20 primers (Invitrogen, cat. #: 100023441). .. HPV16 E6 and E7 copy number was determined by establishing standard curves with 100 to 1×106 copies of the pBigT-E7iresE6 construct.

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: Other sequencing libraries were constructed from 25 pg to 1 ng of ChIP DNA using TELP as described below. .. Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA.

    Real-time Polymerase Chain Reaction:

    Article Title: An Immunocompetent Mouse Model of HPV16(+) Head and Neck Squamous Cell Carcinoma
    Article Snippet: Paragraph title: PCR and qPCR ... RNA was then prepared using NucleoZOL (Macherey-Nagel, cat. #: 740404.200) in accordance with the manufacturer’s instructions. cDNA was made from 0.5–1 µg of RNA using SuperScript IV Reverse Transcriptase (Invitrogen, cat. #: 18090050) with dNTPs (NEB, cat. #: N0446S), RNase inhibitor (Applied Biosystems, cat. #: N808–0119), and 50 µM oligo d(T)20 primers (Invitrogen, cat. #: 100023441).

    Incubation:

    Article Title: MYC-driven epigenetic reprogramming favors the onset of tumorigenesis by inducing a stem cell-like state
    Article Snippet: Briefly, end repair of DNA fragments was achieved by sequential 15 min incubations at 12 °C and 25 °C with 0.15 U/μl T4 PNK (NEB #M0201L), 0.04 U/μl T4 POL (NEB #M0203L) and 0.1 m m dNTPs (NEB #N0446S). .. Adaptor ligation was achieved by using the Quick ligation kit (NEB #M2200L) and performing an incubation of 15 min at 25 °C.

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: 1 μl of 5 U/μl Klenow exo- enzyme (M0212M, NEB) and 1.1 μl dNTP mixture (10 mM dATP, 1 mM dGTP and 1 mM dCTP, N0446S, NEB) were added into 20 μl digested sample. .. The sample was incubated at 30 °C for 20 min (end-repair), 37 °C for 20 min (A-tailing) and 75 °C for 20 min (enzyme inactivation).

    Article Title: Microdroplet-based PCR amplification for large scale targeted sequencing
    Article Snippet: The genomic DNA samples are processed on ice: 7.8 μg of genomic DNA in 25 μL nuclease free water (Fisher, 50843418), 37.5 μL of NEBuffer 2 (NEB, B7002S), 37.5 μL of a mixture of 1 mM each dCTP, dGTP, dTTP (NEB, N0446S), 18.75 μL of 0.4 mM Biotin-14 dATP (Invitrogen, 19524-016), 211.25 μL nuclease free water (Fisher, 50843418), 7.5 μL DNA polymerase I (10 units/μL) (NEB, M0209S), 37.5 μL of DNase I (NEB, M0303S) at a concentration determined by titration to achieve a 2-4 kb size distribution. .. The Genomic DNA fragmentation reaction mix is incubated at 15°C for 90 minutes and the reaction stopped by adding 37.5 μL of 0.5 M EDTA, pH 8.0 (Ambion, AM9260G).

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: MspI digestion reactions were then incubated at 37 °C for 2 h followed by a 15 min incubation at 65 °C. .. Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl.

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: The lysate was digested by adding 0.9 μl of 10 U/μl MspI enzyme (ER0541, Thermofisher), 1.8 μl of 10× Tango buffer and 10.3 μl H2 O into each well and heating at 37 °C for 3 h followed by inactivating at 80 °C for 20 min. 1 μl of 5 U/μl Klenow exo- enzyme (EP0421, Thermofisher), 0.8 μl dNTP mixture (1 mM dATP, 0.1 mM dGTP and 0.1 mM dCTP, N0446S, NEB) and 0.2 μl of 10× Tango buffer were added into each well of digested sample. .. The samples were incubated at 37 °C for 40 min and 75 °C for 15 min. 1 μl of 30 U/μl T4 ligase (EL0013, Thermofisher), 0.5 μl of 10× Tango buffer, 0.25 μl of 100 mM ATP (R0441, Thermofisher), 1 μl of NEXTflex bisulfite-seq barcode (250 times diluted by EB buffer) and 2.25 μl H2 O were mixed with each sample for ligation.

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: MspI digestion reactions were then incubated at 37 °C for 2 h followed by a 15 min incubation at 65 °C. .. Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl.

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA. .. Subsequently, 1 μl of terminal deoxynucleotidyl transferase (TDT; NEB, M0315S) was added, and the reaction mixture was incubated at 37°C for 35 min. After poly-C tailing, TDT was inactivated by heating to 75°C for 20 min. An extension step was performed by adding the following extension mix to the above-mentioned TDT reaction: 6.2 μl of H2 O; 0.8 μl of KAPA2G Robust HS (KAPA, KK5515); 12 μl of 5× KAPA buffer A (KAPA, supplied with enzyme); 4.8 μl of 2.5 mM dNTP (Takara, supplied with RR006A) and 6 μl of 2 μM biotin-labeled anchor primer.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. Following adaptor ligation, bisulfite conversion and subsequent sample purification were performed using the QIAGEN EpiTect kit according to the manufacturer’s recommended protocol designated for DNA extracted from FFPE tissues (QIAGEN, 59104).

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. Following adaptor ligation, bisulfite conversion and subsequent sample purification were performed using the QIAGEN EpiTect kit according to the manufacturer’s recommended protocol designated for DNA extracted from FFPE tissues (QIAGEN, 59104).

    Expressing:

    Article Title: An Immunocompetent Mouse Model of HPV16(+) Head and Neck Squamous Cell Carcinoma
    Article Snippet: For tissues, gene expression was measured by extracting RNA from tissues snap frozen in liquid nitrogen and homogenized with liquid nitrogen using mortar and pestle. .. RNA was then prepared using NucleoZOL (Macherey-Nagel, cat. #: 740404.200) in accordance with the manufacturer’s instructions. cDNA was made from 0.5–1 µg of RNA using SuperScript IV Reverse Transcriptase (Invitrogen, cat. #: 18090050) with dNTPs (NEB, cat. #: N0446S), RNase inhibitor (Applied Biosystems, cat. #: N808–0119), and 50 µM oligo d(T)20 primers (Invitrogen, cat. #: 100023441).

    Modification:

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: Library construction was conducted based on the protocol published by Gu et al. and modified for Illunima Hi-Seq system. .. 1 μl of 5 U/μl Klenow exo- enzyme (M0212M, NEB) and 1.1 μl dNTP mixture (10 mM dATP, 1 mM dGTP and 1 mM dCTP, N0446S, NEB) were added into 20 μl digested sample.

    Bisulfite Sequencing:

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: The lysate was digested by adding 0.9 μl of 10 U/μl MspI enzyme (ER0541, Thermofisher), 1.8 μl of 10× Tango buffer and 10.3 μl H2 O into each well and heating at 37 °C for 3 h followed by inactivating at 80 °C for 20 min. 1 μl of 5 U/μl Klenow exo- enzyme (EP0421, Thermofisher), 0.8 μl dNTP mixture (1 mM dATP, 0.1 mM dGTP and 0.1 mM dCTP, N0446S, NEB) and 0.2 μl of 10× Tango buffer were added into each well of digested sample. .. The samples were incubated at 37 °C for 40 min and 75 °C for 15 min. 1 μl of 30 U/μl T4 ligase (EL0013, Thermofisher), 0.5 μl of 10× Tango buffer, 0.25 μl of 100 mM ATP (R0441, Thermofisher), 1 μl of NEXTflex bisulfite-seq barcode (250 times diluted by EB buffer) and 2.25 μl H2 O were mixed with each sample for ligation.

    Ligation:

    Article Title: MYC-driven epigenetic reprogramming favors the onset of tumorigenesis by inducing a stem cell-like state
    Article Snippet: Briefly, end repair of DNA fragments was achieved by sequential 15 min incubations at 12 °C and 25 °C with 0.15 U/μl T4 PNK (NEB #M0201L), 0.04 U/μl T4 POL (NEB #M0203L) and 0.1 m m dNTPs (NEB #N0446S). .. Adaptor ligation was achieved by using the Quick ligation kit (NEB #M2200L) and performing an incubation of 15 min at 25 °C.

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: The 3′ terminal of digested DNA was end-repaired and an extra A (required by adapter ligation) was added on both strands in a single reaction. .. 1 μl of 5 U/μl Klenow exo- enzyme (M0212M, NEB) and 1.1 μl dNTP mixture (10 mM dATP, 1 mM dGTP and 1 mM dCTP, N0446S, NEB) were added into 20 μl digested sample.

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. Adaptor ligation reactions were then incubated at 16 °C overnight (16–20 h) followed by incubation at 65 °C for 15 min. Adaptor ligated material was purified using 1.2× volumes of Ampure XP according to the manufacturer’s recommended protocol (Beckman Coulter, A63881).

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: The lysate was digested by adding 0.9 μl of 10 U/μl MspI enzyme (ER0541, Thermofisher), 1.8 μl of 10× Tango buffer and 10.3 μl H2 O into each well and heating at 37 °C for 3 h followed by inactivating at 80 °C for 20 min. 1 μl of 5 U/μl Klenow exo- enzyme (EP0421, Thermofisher), 0.8 μl dNTP mixture (1 mM dATP, 0.1 mM dGTP and 0.1 mM dCTP, N0446S, NEB) and 0.2 μl of 10× Tango buffer were added into each well of digested sample. .. The samples were incubated at 37 °C for 40 min and 75 °C for 15 min. 1 μl of 30 U/μl T4 ligase (EL0013, Thermofisher), 0.5 μl of 10× Tango buffer, 0.25 μl of 100 mM ATP (R0441, Thermofisher), 1 μl of NEXTflex bisulfite-seq barcode (250 times diluted by EB buffer) and 2.25 μl H2 O were mixed with each sample for ligation.

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. Adaptor ligation reactions were then incubated at 16 °C overnight (16–20 h) followed by incubation at 65 °C for 15 min. Adaptor ligated material was purified using 1.2× volumes of Ampure XP according to the manufacturer’s recommended protocol (Beckman Coulter, ).

    Nick Translation:

    Article Title: Microdroplet-based PCR amplification for large scale targeted sequencing
    Article Snippet: Paragraph title: Genomic DNA Fragmentation and Nick Translation ... The genomic DNA samples are processed on ice: 7.8 μg of genomic DNA in 25 μL nuclease free water (Fisher, 50843418), 37.5 μL of NEBuffer 2 (NEB, B7002S), 37.5 μL of a mixture of 1 mM each dCTP, dGTP, dTTP (NEB, N0446S), 18.75 μL of 0.4 mM Biotin-14 dATP (Invitrogen, 19524-016), 211.25 μL nuclease free water (Fisher, 50843418), 7.5 μL DNA polymerase I (10 units/μL) (NEB, M0209S), 37.5 μL of DNase I (NEB, M0303S) at a concentration determined by titration to achieve a 2-4 kb size distribution.

    Polymerase Chain Reaction:

    Article Title: A modified protocol yields high-quality RNA from highly mucilaginous Dioscorea tubers
    Article Snippet: .. The PCR components used were dNTPs (NEB, Catalog No N0446S), primers, Phusion High-Fidelity DNA polymerase (Cat no M0530S), and buffer. .. The PCR mixture contained 5× Phusion HF buffer (5 µl), 50 mM MgCl2 (1 µl), 10 mM dNTP (0.5 µl), forward and reverse primer (1.25 µl each), 100% DMSO (0.75 µl), 2 U/µl Phusion DNA Taq polymerase (0.25 µl), template cDNA (approx.

    Article Title: Microdroplet-based PCR amplification for large scale targeted sequencing
    Article Snippet: The genomic DNA samples are processed on ice: 7.8 μg of genomic DNA in 25 μL nuclease free water (Fisher, 50843418), 37.5 μL of NEBuffer 2 (NEB, B7002S), 37.5 μL of a mixture of 1 mM each dCTP, dGTP, dTTP (NEB, N0446S), 18.75 μL of 0.4 mM Biotin-14 dATP (Invitrogen, 19524-016), 211.25 μL nuclease free water (Fisher, 50843418), 7.5 μL DNA polymerase I (10 units/μL) (NEB, M0209S), 37.5 μL of DNase I (NEB, M0303S) at a concentration determined by titration to achieve a 2-4 kb size distribution. .. The DNA is purified over a Qiagen MinElute PCR purification column (Qiagen, 28004 (28006)) using the manufacturer's recommended conditions except for eluting with 13 μL of 10 mM Tris-Cl, pH 8.5.

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: 96-well PCR plate was preloaded with 5 μl of lysis buffer (20 mM Tris, 2 mM EDTA, 20 mM KCl, 1 mg/ml protease and 0.3% Triton X-100) in each well. .. The lysate was digested by adding 0.9 μl of 10 U/μl MspI enzyme (ER0541, Thermofisher), 1.8 μl of 10× Tango buffer and 10.3 μl H2 O into each well and heating at 37 °C for 3 h followed by inactivating at 80 °C for 20 min. 1 μl of 5 U/μl Klenow exo- enzyme (EP0421, Thermofisher), 0.8 μl dNTP mixture (1 mM dATP, 0.1 mM dGTP and 0.1 mM dCTP, N0446S, NEB) and 0.2 μl of 10× Tango buffer were added into each well of digested sample.

    Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
    Article Snippet: .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500) .. SpectraMax M2 multimode microplate reader (Molecular Devices) AFA S2 (Covaris) DynaMag-2 (Invitrogen, cat. no. 123-21D) NanoDrop 1000 (Thermo Scientific) Thermocycler (Applied Biosystems, 2720) Nutator (Southwest Science, SB3D2300) Desktop centrifuge (Eppendorf, 5424)

    Article Title: An Immunocompetent Mouse Model of HPV16(+) Head and Neck Squamous Cell Carcinoma
    Article Snippet: Paragraph title: PCR and qPCR ... RNA was then prepared using NucleoZOL (Macherey-Nagel, cat. #: 740404.200) in accordance with the manufacturer’s instructions. cDNA was made from 0.5–1 µg of RNA using SuperScript IV Reverse Transcriptase (Invitrogen, cat. #: 18090050) with dNTPs (NEB, cat. #: N0446S), RNase inhibitor (Applied Biosystems, cat. #: N808–0119), and 50 µM oligo d(T)20 primers (Invitrogen, cat. #: 100023441).

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: End repair products were purified with the MinElute PCR purification kit (Qiagen, 28006). .. Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA.

    Sonication:

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: This step is only required for library construction from small amounts of DNA fragmented by mechanical shearing (e.g. sonication). .. Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA.

    ChIP-sequencing:

    Article Title: MYC-driven epigenetic reprogramming favors the onset of tumorigenesis by inducing a stem cell-like state
    Article Snippet: Paragraph title: ChIP-seq library generation and data analysis ... Briefly, end repair of DNA fragments was achieved by sequential 15 min incubations at 12 °C and 25 °C with 0.15 U/μl T4 PNK (NEB #M0201L), 0.04 U/μl T4 POL (NEB #M0203L) and 0.1 m m dNTPs (NEB #N0446S).

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: Paragraph title: ChIP and high-sensitivity ChIP-seq library preparation ... Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA.

    Methylation:

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. A-tailing reactions were then incubated at 30 °C for 20 min, followed by 37 °C for 20 min, followed by 65 °C for 15 min. Methylated Illumina sequencing adapters were then ligated to the A-tailed material (30 μl) by adding 1 μl 10× CutSmart Buffer, 5 μl 10 mM ATP (NEB, P0756S), 1 μl T4 DNA Ligase (2,000,000 U/ml) (NEB, M0202M) and 2 μl methylated adapters in a total reaction volume of 40 μl.

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. A-tailing reactions were then incubated at 30 °C for 20 min, followed by 37 °C for 20 min, followed by 65 °C for 15 min. Methylated Illumina sequencing adapters were then ligated to the A-tailed material (30 μl) by adding 1 μl 10× CutSmart Buffer, 5 μl 10 mM ATP (NEB, P0756S), 1 μl T4 DNA Ligase (2,000,000 U/ml) (NEB, M0202M) and 2 μl methylated adapters in a total reaction volume of 40 μl.

    Mouse Assay:

    Article Title: An Immunocompetent Mouse Model of HPV16(+) Head and Neck Squamous Cell Carcinoma
    Article Snippet: Briefly, MEFs from founders and established lines were tested by transducing cells with Adeno-Cre virus (MOI = 20) and analyzing the recombined allele from the Rosa26-LSL-E7iresE6 mice by PCR (PrimeSTAR GXL DNA polymerase - Takara Bio USA, cat. #: R050A) using pBigT-E7iresE6 as a control with the following primers ( ) and cycling conditions: 95 °C for 3 min followed by 98 °C for 10 s, 55 °C for 15 s and 68 °C for 40 s for 34 cycles and 5 min for 68°C. .. RNA was then prepared using NucleoZOL (Macherey-Nagel, cat. #: 740404.200) in accordance with the manufacturer’s instructions. cDNA was made from 0.5–1 µg of RNA using SuperScript IV Reverse Transcriptase (Invitrogen, cat. #: 18090050) with dNTPs (NEB, cat. #: N0446S), RNase inhibitor (Applied Biosystems, cat. #: N808–0119), and 50 µM oligo d(T)20 primers (Invitrogen, cat. #: 100023441).

    Sequencing:

    Article Title: A modified protocol yields high-quality RNA from highly mucilaginous Dioscorea tubers
    Article Snippet: Full-length coding sequence of the dioscorin gene was amplified using the forward primer CA A1F (ATAAATCAAAGAGCCCTCAA) and oligo (dT)18 as reverse primer. .. The PCR components used were dNTPs (NEB, Catalog No N0446S), primers, Phusion High-Fidelity DNA polymerase (Cat no M0530S), and buffer.

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. A-tailing reactions were then incubated at 30 °C for 20 min, followed by 37 °C for 20 min, followed by 65 °C for 15 min. Methylated Illumina sequencing adapters were then ligated to the A-tailed material (30 μl) by adding 1 μl 10× CutSmart Buffer, 5 μl 10 mM ATP (NEB, P0756S), 1 μl T4 DNA Ligase (2,000,000 U/ml) (NEB, M0202M) and 2 μl methylated adapters in a total reaction volume of 40 μl.

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. A-tailing reactions were then incubated at 30 °C for 20 min, followed by 37 °C for 20 min, followed by 65 °C for 15 min. Methylated Illumina sequencing adapters were then ligated to the A-tailed material (30 μl) by adding 1 μl 10× CutSmart Buffer, 5 μl 10 mM ATP (NEB, P0756S), 1 μl T4 DNA Ligase (2,000,000 U/ml) (NEB, M0202M) and 2 μl methylated adapters in a total reaction volume of 40 μl.

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: Other sequencing libraries were constructed from 25 pg to 1 ng of ChIP DNA using TELP as described below. .. Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA.

    FACS:

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: The lysate was digested by adding 0.9 μl of 10 U/μl MspI enzyme (ER0541, Thermofisher), 1.8 μl of 10× Tango buffer and 10.3 μl H2 O into each well and heating at 37 °C for 3 h followed by inactivating at 80 °C for 20 min. 1 μl of 5 U/μl Klenow exo- enzyme (EP0421, Thermofisher), 0.8 μl dNTP mixture (1 mM dATP, 0.1 mM dGTP and 0.1 mM dCTP, N0446S, NEB) and 0.2 μl of 10× Tango buffer were added into each well of digested sample. .. The lysate was digested by adding 0.9 μl of 10 U/μl MspI enzyme (ER0541, Thermofisher), 1.8 μl of 10× Tango buffer and 10.3 μl H2 O into each well and heating at 37 °C for 3 h followed by inactivating at 80 °C for 20 min. 1 μl of 5 U/μl Klenow exo- enzyme (EP0421, Thermofisher), 0.8 μl dNTP mixture (1 mM dATP, 0.1 mM dGTP and 0.1 mM dCTP, N0446S, NEB) and 0.2 μl of 10× Tango buffer were added into each well of digested sample.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Mutation of DNA Polymerase β R137Q Results in Retarded Embryo Development Due to Impaired DNA Base Excision Repair in Mice
    Article Snippet: Reagents and antibodies All primers and DNA substrates used in this paper were synthesized by GenScript Inc. using polyacrylamide gel electrophoresis (PAGE) purification. .. Four deoxynucleotide triphosphates (dNTPs) were purchased from New England Biolabs (N0446S).

    Article Title: R152C DNA Pol β mutation impairs base excision repair and induces cellular transformation
    Article Snippet: Reagents and antibodies All primers and DNA substrates used in this paper were synthesized by GenScript, Inc. using polyacrylamide gel electrophoresis (PAGE) purification. .. Four deoxynucleotide triphosphates (dNTPs) were purchased from New England Biolabs (N0446S).

    Lysis:

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: 96-well PCR plate was preloaded with 5 μl of lysis buffer (20 mM Tris, 2 mM EDTA, 20 mM KCl, 1 mg/ml protease and 0.3% Triton X-100) in each well. .. The lysate was digested by adding 0.9 μl of 10 U/μl MspI enzyme (ER0541, Thermofisher), 1.8 μl of 10× Tango buffer and 10.3 μl H2 O into each well and heating at 37 °C for 3 h followed by inactivating at 80 °C for 20 min. 1 μl of 5 U/μl Klenow exo- enzyme (EP0421, Thermofisher), 0.8 μl dNTP mixture (1 mM dATP, 0.1 mM dGTP and 0.1 mM dCTP, N0446S, NEB) and 0.2 μl of 10× Tango buffer were added into each well of digested sample.

    Agarose Gel Electrophoresis:

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: The fragment size was examined using 2.5% agarose gel (16550100, Thermo Fisher) in 0.5× TBE buffer (15581044, Thermo Fisher). .. 1 μl of 5 U/μl Klenow exo- enzyme (M0212M, NEB) and 1.1 μl dNTP mixture (10 mM dATP, 1 mM dGTP and 1 mM dCTP, N0446S, NEB) were added into 20 μl digested sample.

    Purification:

    Article Title: Microdroplet-based PCR amplification for large scale targeted sequencing
    Article Snippet: The genomic DNA samples are processed on ice: 7.8 μg of genomic DNA in 25 μL nuclease free water (Fisher, 50843418), 37.5 μL of NEBuffer 2 (NEB, B7002S), 37.5 μL of a mixture of 1 mM each dCTP, dGTP, dTTP (NEB, N0446S), 18.75 μL of 0.4 mM Biotin-14 dATP (Invitrogen, 19524-016), 211.25 μL nuclease free water (Fisher, 50843418), 7.5 μL DNA polymerase I (10 units/μL) (NEB, M0209S), 37.5 μL of DNase I (NEB, M0303S) at a concentration determined by titration to achieve a 2-4 kb size distribution. .. The DNA is purified over a Qiagen MinElute PCR purification column (Qiagen, 28004 (28006)) using the manufacturer's recommended conditions except for eluting with 13 μL of 10 mM Tris-Cl, pH 8.5.

    Article Title: Mutation of DNA Polymerase β R137Q Results in Retarded Embryo Development Due to Impaired DNA Base Excision Repair in Mice
    Article Snippet: Reagents and antibodies All primers and DNA substrates used in this paper were synthesized by GenScript Inc. using polyacrylamide gel electrophoresis (PAGE) purification. .. Four deoxynucleotide triphosphates (dNTPs) were purchased from New England Biolabs (N0446S).

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. Adaptor ligation reactions were then incubated at 16 °C overnight (16–20 h) followed by incubation at 65 °C for 15 min. Adaptor ligated material was purified using 1.2× volumes of Ampure XP according to the manufacturer’s recommended protocol (Beckman Coulter, A63881).

    Article Title: Next-Generation DNA Curtains for Single-Molecule Studies of Homologous Recombination
    Article Snippet: .. TE buffer: 10m M Tris–HCl [pH 8.0]; 0.1m M EDTA RAD51 buffer: 40m M Tris–HCl [pH 8.0]; 1m M MgCl2 ; 5m M CaCl2 ; 100m M KCl; 1m M DTT; 1m M ATP; 0.2 mgmL−1 BSA; 1m M Trolox (Sigma-Aldrich); 1.0% glucose (w/v); 500units catalase (Sigma-Aldrich); 70units glucose oxidase (Sigma-Aldrich) 10× T4 DNA ligase reaction buffer (B0202S; NEB) T4 DNA ligase (M0202; NEB) Primer oligo (/Biosg/TC TCC TCC TTC T—HPLC purified; Integrated DNA Technologies) Template oligo (/5Phos/AG GAG AAA AAG AAA AAA AGA AAA GAA GG—PAGE purified; Integrated DNA Technologies) Nuclease-free water BSA, Molecular Biology Grade (B9000S; NEB) Thermocycler (Mastercycler pro S; Eppendorf ) 10× phi29 DNA polymerase reaction buffer (B0269S; NEB) phi29 DNA polymerase (homemade 5 μ M stock) Deoxynucleotide (dNTP) solution set (N0446S; NEB) .. Prepare a 49 μL ligation reaction containing: (i) 5 μL 10× T4 ligase reaction buffer; (ii) 2 μL template oligo (10 μ M stock in TE buffer); (iii) 1.8 μL primer oligo (10 μ M stock in TE buffer); and (iv) 40.2 μL nuclease-free water.

    Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
    Article Snippet: .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500) .. SpectraMax M2 multimode microplate reader (Molecular Devices) AFA S2 (Covaris) DynaMag-2 (Invitrogen, cat. no. 123-21D) NanoDrop 1000 (Thermo Scientific) Thermocycler (Applied Biosystems, 2720) Nutator (Southwest Science, SB3D2300) Desktop centrifuge (Eppendorf, 5424)

    Article Title: R152C DNA Pol β mutation impairs base excision repair and induces cellular transformation
    Article Snippet: Reagents and antibodies All primers and DNA substrates used in this paper were synthesized by GenScript, Inc. using polyacrylamide gel electrophoresis (PAGE) purification. .. Four deoxynucleotide triphosphates (dNTPs) were purchased from New England Biolabs (N0446S).

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl. .. Adaptor ligation reactions were then incubated at 16 °C overnight (16–20 h) followed by incubation at 65 °C for 15 min. Adaptor ligated material was purified using 1.2× volumes of Ampure XP according to the manufacturer’s recommended protocol (Beckman Coulter, ).

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: End repair products were purified with the MinElute PCR purification kit (Qiagen, 28006). .. Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA.

    Chromatin Immunoprecipitation:

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: Paragraph title: ChIP and high-sensitivity ChIP-seq library preparation ... Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA.

    Software:

    Article Title: A modified protocol yields high-quality RNA from highly mucilaginous Dioscorea tubers
    Article Snippet: The dioscorin (storage protein) gene (partial) was amplified using primers CA 5.1F (GAGGATGAGTTTAGCTACATT) and CA 3.1R (TAAGCATCACCATATTACACT) designed employing NCBI primer BLAST tool and the software Primer 3 and synthesized at Eurofins Genomics, Bangalore, India. .. The PCR components used were dNTPs (NEB, Catalog No N0446S), primers, Phusion High-Fidelity DNA polymerase (Cat no M0530S), and buffer.

    SYBR Green Assay:

    Article Title: An Immunocompetent Mouse Model of HPV16(+) Head and Neck Squamous Cell Carcinoma
    Article Snippet: RNA was then prepared using NucleoZOL (Macherey-Nagel, cat. #: 740404.200) in accordance with the manufacturer’s instructions. cDNA was made from 0.5–1 µg of RNA using SuperScript IV Reverse Transcriptase (Invitrogen, cat. #: 18090050) with dNTPs (NEB, cat. #: N0446S), RNase inhibitor (Applied Biosystems, cat. #: N808–0119), and 50 µM oligo d(T)20 primers (Invitrogen, cat. #: 100023441). .. Expression in HNSCC cell lines relative to NOKs was calculated using the ∆CT of OKF4-TERT1. qPCR was performed using FastStart Universal SYBR Green Master (Rox) Mix (Roche, cat. #: 04913850001) with 1/20 (tissue) or 1/40 (cells) volume of the cDNA iScript reaction, and 0.25 µM of primers ( ).

    Sample Prep:

    Article Title: TELP, a sensitive and versatile library construction method for next-generation sequencing
    Article Snippet: The Illumina standard ChIP-seq library was prepared with a ChIP-seq Sample Prep Kit (Illumina, IP-102–1001), using 10 ng of ChIP DNA as starting material. .. Next, poly-C tailing was initiated by mixing 28 μl of end-repaired DNA, 1 μl of 10× EX buffer (Takara, supplied with RR006A) and 1 μl of 1 mM dCTP (NEB, N0446S) and then denaturing the DNA.

    Ethanol Precipitation:

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics
    Article Snippet: The lysate was digested by adding 0.9 μl of 10 U/μl MspI enzyme (ER0541, Thermofisher), 1.8 μl of 10× Tango buffer and 10.3 μl H2 O into each well and heating at 37 °C for 3 h followed by inactivating at 80 °C for 20 min. 1 μl of 5 U/μl Klenow exo- enzyme (EP0421, Thermofisher), 0.8 μl dNTP mixture (1 mM dATP, 0.1 mM dGTP and 0.1 mM dCTP, N0446S, NEB) and 0.2 μl of 10× Tango buffer were added into each well of digested sample. .. 24 single-cell samples were pooled, concentrated by ethanol precipitation and suspended in EB buffer for loading into the microfluidic device for processing.

    Article Title: An Immunocompetent Mouse Model of HPV16(+) Head and Neck Squamous Cell Carcinoma
    Article Snippet: PCR and qPCR Recombination was assessed by lysing cells (100 mM NaCl, 10 mM Tris pH 8, 25mM EDTA pH 8, 0.5% SDS, and 50 µg/ml Proteinase K) and extracting genomic DNA using phenol-chloroform and ethanol precipitation. .. RNA was then prepared using NucleoZOL (Macherey-Nagel, cat. #: 740404.200) in accordance with the manufacturer’s instructions. cDNA was made from 0.5–1 µg of RNA using SuperScript IV Reverse Transcriptase (Invitrogen, cat. #: 18090050) with dNTPs (NEB, cat. #: N0446S), RNase inhibitor (Applied Biosystems, cat. #: N808–0119), and 50 µM oligo d(T)20 primers (Invitrogen, cat. #: 100023441).

    Concentration Assay:

    Article Title: Microdroplet-based PCR amplification for large scale targeted sequencing
    Article Snippet: .. The genomic DNA samples are processed on ice: 7.8 μg of genomic DNA in 25 μL nuclease free water (Fisher, 50843418), 37.5 μL of NEBuffer 2 (NEB, B7002S), 37.5 μL of a mixture of 1 mM each dCTP, dGTP, dTTP (NEB, N0446S), 18.75 μL of 0.4 mM Biotin-14 dATP (Invitrogen, 19524-016), 211.25 μL nuclease free water (Fisher, 50843418), 7.5 μL DNA polymerase I (10 units/μL) (NEB, M0209S), 37.5 μL of DNase I (NEB, M0303S) at a concentration determined by titration to achieve a 2-4 kb size distribution. .. The Genomic DNA fragmentation reaction mix is incubated at 15°C for 90 minutes and the reaction stopped by adding 37.5 μL of 0.5 M EDTA, pH 8.0 (Ambion, AM9260G).

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: In brief, genomic DNA samples were quantified using a Quant-It dsDNA high sensitivity kit (ThermoFisher, Q33120) and normalized to a concentration of 10 ng/μl. .. Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl.

    Article Title: Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases
    Article Snippet: In brief, genomic DNA samples were quantified using a Quant-It dsDNA high sensitivity kit (ThermoFisher, ) and normalized to a concentration of 10 ng/μl. .. Next, A-tailing reactions were performed by adding 1 μl dNTP mix (containing 10 mM dATP, 1 mM dCTP and 1 mM dGTP) (NEB, N0446S), 1 μl Klenow 3′-5′ exo- (NEB, M0212L) and 1 μl 10× CutSmart Buffer in a total reaction volume of 30 μl.

    Gel Extraction:

    Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
    Article Snippet: .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500) .. SpectraMax M2 multimode microplate reader (Molecular Devices) AFA S2 (Covaris) DynaMag-2 (Invitrogen, cat. no. 123-21D) NanoDrop 1000 (Thermo Scientific) Thermocycler (Applied Biosystems, 2720) Nutator (Southwest Science, SB3D2300) Desktop centrifuge (Eppendorf, 5424)

    Hood:

    Article Title: The GLIB technique for genome-wide mapping of 5-hydroxymethylcytosine
    Article Snippet: Wear protective clothing and gloves and handle under a fume hood. .. Sodium acetate (Sigma-Aldrich, cat. no. S2889-250G) QIAquick PCR purification kit (Qiagen, cat. no. 28106) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Illustra MicroSpin G-50 columns (GE Healthcare, cat. no. 27-5330-01) Dynabeads M280-Streptavidin (Invitrogen, cat. no. 11206D) QuantIt OliGreen kit (Invitrogen, cat. no. ) PBS, 10× (Meditech CellGro, cat. no. 46-013-CM) Deoxynucleotide solution set (New England Biolabs, cat. no. N0446S) Hydroxymethyl dCTP (Bioline, cat. no. BIO-39046) pUC19 DNA (New England Biolabs, cat. no. N3041S) T4 phage β-glucosyltransferase (T4-BGT; New England Biolabs, cat. no. M0357S) AhdI (New England Biolabs, cat. no. R0584S) FspI (New England Biolabs, cat. no. R0135S) HindIII (New England Biolabs, cat. no. R0104S) NdeI (New England Biolabs, cat. no. R0111S) DNA polymerase, Klenow fragment (New England Biolabs, cat. no. M0210S) Ethanol (Sigma-Aldrich, cat. no. E7023) Tris (Sigma-Aldrich, cat. no. 154563) Agarose (Invitrogen, cat. no. 16500500)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs deoxynucleotide triphosphates dntps
    Deoxynucleotide Triphosphates Dntps, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide triphosphates dntps/product/New England Biolabs
    Average 95 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide triphosphates dntps - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results