single stranded rna ladder  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85

    Structured Review

    New England Biolabs single stranded rna ladder
    Single Stranded Rna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded rna ladder/product/New England Biolabs
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    single stranded rna ladder - by Bioz Stars, 2019-10
    85/100 stars

    Images

    Related Articles

    Polyacrylamide Gel Electrophoresis:

    Article Title:
    Article Snippet: Total RNAs were isolated using the Tris-HCl–saturated phenol extraction method, quantitated with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), and analyzed by denaturing urea (8 M) PAGE (8%) to assess the expression of recombinant ncRNAs. .. The single-stranded RNA ladder and small interfering RNA marker were purchased from New England Biolabs.

    Agarose Gel Electrophoresis:

    Article Title: Light-activated communication in synthetic tissues
    Article Snippet: DNAse I (M0303, NEB) was then added to the tubes, which were held at 37°C for an additional 20 min. EDTA was then added (5 mM final concentration), and the enzymes were denatured at 75°C for 10 min. .. The entire sample was then run on a 2% (w/v) TAE agarose gel with a single-stranded RNA ladder (N0364, NEB). .. Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s protocol with the addition of a murine RNAse inhibitor (MB0314, NEB).

    In Vitro:

    Article Title: Ubiquitin accumulation in autophagy-deficient mice is dependent on the Nrf2-mediated stress response pathway: a potential role for protein aggregation in autophagic substrate selection
    Article Snippet: To determine the size of the transcript, we used a single-stranded RNA ladder (New England Biolabs, Inc.). .. A chFP probe (584 bases) was constructed by PCR using pcDNA3.1-chFP as a template and 5′-GTGAGCAAGGGCGAGGAG-3′ as the forward primer and 5′- TAATACGACTCACTATAGGG CTTGTACAGCTCGTCCATG-3′ as the reverse primer (t7 tag is underlined).

    Concentration Assay:

    Article Title: Light-activated communication in synthetic tissues
    Article Snippet: DNAse I (M0303, NEB) was then added to the tubes, which were held at 37°C for an additional 20 min. EDTA was then added (5 mM final concentration), and the enzymes were denatured at 75°C for 10 min. .. The entire sample was then run on a 2% (w/v) TAE agarose gel with a single-stranded RNA ladder (N0364, NEB).

    Isolation:

    Article Title:
    Article Snippet: Total RNAs were isolated using the Tris-HCl–saturated phenol extraction method, quantitated with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), and analyzed by denaturing urea (8 M) PAGE (8%) to assess the expression of recombinant ncRNAs. .. The single-stranded RNA ladder and small interfering RNA marker were purchased from New England Biolabs.

    Article Title: Growth-Regulated Expression of a Bacteriocin, Produced by the Sweet Potato Pathogen Streptomyces ipomoeae, That Exhibits Interstrain Inhibition
    Article Snippet: RNA was isolated by using modified Kirby mixture, phenol-chloroform extraction, and treatment with DNase I as described previously ( ). .. For Northern blot analysis, 10-μg (or, for some experiments, 30-μg) samples of total RNA, along with a single-stranded RNA ladder (New England Biolabs), were electrophoresed overnight at 20 V on 1% agarose gels containing formaldehyde ( ) and were then blotted to a Hybond N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ) using the VacuGene XL vacuum blotting system (Amersham Pharmacia Biotech).

    Northern Blot:

    Article Title: Ubiquitin accumulation in autophagy-deficient mice is dependent on the Nrf2-mediated stress response pathway: a potential role for protein aggregation in autophagic substrate selection
    Article Snippet: Paragraph title: Northern blotting ... To determine the size of the transcript, we used a single-stranded RNA ladder (New England Biolabs, Inc.).

    Article Title: Growth-Regulated Expression of a Bacteriocin, Produced by the Sweet Potato Pathogen Streptomyces ipomoeae, That Exhibits Interstrain Inhibition
    Article Snippet: RNA was isolated by using modified Kirby mixture, phenol-chloroform extraction, and treatment with DNase I as described previously ( ). .. For Northern blot analysis, 10-μg (or, for some experiments, 30-μg) samples of total RNA, along with a single-stranded RNA ladder (New England Biolabs), were electrophoresed overnight at 20 V on 1% agarose gels containing formaldehyde ( ) and were then blotted to a Hybond N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ) using the VacuGene XL vacuum blotting system (Amersham Pharmacia Biotech). .. RNA was cross-linked to membranes by using UV light.

    Small Interfering RNA:

    Article Title:
    Article Snippet: We usually loaded 0.2–1.0 μ g RNAs per lane for the urea-PAGE analysis. .. The single-stranded RNA ladder and small interfering RNA marker were purchased from New England Biolabs. .. Images were acquired with a ChemiDo MP Imaging System (Bio-Rad), and intensities of bands were used to provide a rough estimation of relative levels of recombinant ncRNAs present in the total RNAs.

    Spectrophotometry:

    Article Title:
    Article Snippet: Total RNAs were isolated using the Tris-HCl–saturated phenol extraction method, quantitated with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), and analyzed by denaturing urea (8 M) PAGE (8%) to assess the expression of recombinant ncRNAs. .. The single-stranded RNA ladder and small interfering RNA marker were purchased from New England Biolabs.

    Purification:

    Article Title: Ubiquitin accumulation in autophagy-deficient mice is dependent on the Nrf2-mediated stress response pathway: a potential role for protein aggregation in autophagic substrate selection
    Article Snippet: Total RNA was prepared using RNeasy Plus (QIAGEN) followed by mRNA purification (2×) from 125 µg of total RNA using Oligo25 beads (Invitrogen). .. To determine the size of the transcript, we used a single-stranded RNA ladder (New England Biolabs, Inc.).

    Labeling:

    Article Title: Ubiquitin accumulation in autophagy-deficient mice is dependent on the Nrf2-mediated stress response pathway: a potential role for protein aggregation in autophagic substrate selection
    Article Snippet: Northern blot analysis was performed as described previously ( ) with the exception that probes were digoxigenin (DIG) labeled (Roche). .. To determine the size of the transcript, we used a single-stranded RNA ladder (New England Biolabs, Inc.).

    Modification:

    Article Title: Growth-Regulated Expression of a Bacteriocin, Produced by the Sweet Potato Pathogen Streptomyces ipomoeae, That Exhibits Interstrain Inhibition
    Article Snippet: RNA was isolated by using modified Kirby mixture, phenol-chloroform extraction, and treatment with DNase I as described previously ( ). .. For Northern blot analysis, 10-μg (or, for some experiments, 30-μg) samples of total RNA, along with a single-stranded RNA ladder (New England Biolabs), were electrophoresed overnight at 20 V on 1% agarose gels containing formaldehyde ( ) and were then blotted to a Hybond N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ) using the VacuGene XL vacuum blotting system (Amersham Pharmacia Biotech).

    Generated:

    Article Title: Growth-Regulated Expression of a Bacteriocin, Produced by the Sweet Potato Pathogen Streptomyces ipomoeae, That Exhibits Interstrain Inhibition
    Article Snippet: For Northern blot analysis, 10-μg (or, for some experiments, 30-μg) samples of total RNA, along with a single-stranded RNA ladder (New England Biolabs), were electrophoresed overnight at 20 V on 1% agarose gels containing formaldehyde ( ) and were then blotted to a Hybond N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ) using the VacuGene XL vacuum blotting system (Amersham Pharmacia Biotech). .. For Northern blot analysis, 10-μg (or, for some experiments, 30-μg) samples of total RNA, along with a single-stranded RNA ladder (New England Biolabs), were electrophoresed overnight at 20 V on 1% agarose gels containing formaldehyde ( ) and were then blotted to a Hybond N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ) using the VacuGene XL vacuum blotting system (Amersham Pharmacia Biotech).

    Polymerase Chain Reaction:

    Article Title: Ubiquitin accumulation in autophagy-deficient mice is dependent on the Nrf2-mediated stress response pathway: a potential role for protein aggregation in autophagic substrate selection
    Article Snippet: To determine the size of the transcript, we used a single-stranded RNA ladder (New England Biolabs, Inc.). .. To determine the size of the transcript, we used a single-stranded RNA ladder (New England Biolabs, Inc.).

    Article Title: Growth-Regulated Expression of a Bacteriocin, Produced by the Sweet Potato Pathogen Streptomyces ipomoeae, That Exhibits Interstrain Inhibition
    Article Snippet: For Northern blot analysis, 10-μg (or, for some experiments, 30-μg) samples of total RNA, along with a single-stranded RNA ladder (New England Biolabs), were electrophoresed overnight at 20 V on 1% agarose gels containing formaldehyde ( ) and were then blotted to a Hybond N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ) using the VacuGene XL vacuum blotting system (Amersham Pharmacia Biotech). .. For Northern blot analysis, 10-μg (or, for some experiments, 30-μg) samples of total RNA, along with a single-stranded RNA ladder (New England Biolabs), were electrophoresed overnight at 20 V on 1% agarose gels containing formaldehyde ( ) and were then blotted to a Hybond N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ) using the VacuGene XL vacuum blotting system (Amersham Pharmacia Biotech).

    Construct:

    Article Title: Ubiquitin accumulation in autophagy-deficient mice is dependent on the Nrf2-mediated stress response pathway: a potential role for protein aggregation in autophagic substrate selection
    Article Snippet: To determine the size of the transcript, we used a single-stranded RNA ladder (New England Biolabs, Inc.). .. To determine the size of the transcript, we used a single-stranded RNA ladder (New England Biolabs, Inc.).

    Expressing:

    Article Title:
    Article Snippet: Paragraph title: Expression of Recombinant ncRNAs in E. coli . ... The single-stranded RNA ladder and small interfering RNA marker were purchased from New England Biolabs.

    Marker:

    Article Title:
    Article Snippet: We usually loaded 0.2–1.0 μ g RNAs per lane for the urea-PAGE analysis. .. The single-stranded RNA ladder and small interfering RNA marker were purchased from New England Biolabs. .. Images were acquired with a ChemiDo MP Imaging System (Bio-Rad), and intensities of bands were used to provide a rough estimation of relative levels of recombinant ncRNAs present in the total RNAs.

    Recombinant:

    Article Title:
    Article Snippet: Paragraph title: Expression of Recombinant ncRNAs in E. coli . ... The single-stranded RNA ladder and small interfering RNA marker were purchased from New England Biolabs.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    New England Biolabs single stranded rna ladder
    Single Stranded Rna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded rna ladder/product/New England Biolabs
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    single stranded rna ladder - by Bioz Stars, 2019-10
    85/100 stars
      Buy from Supplier

    Image Search Results