low range ssrna ladder  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Low Range ssRNA Ladder
    Description:
    Low Range ssRNA Ladder 25 gel lanes
    Catalog Number:
    n0364s
    Price:
    69
    Size:
    100 gel lanes
    Category:
    RNA Ladders
    Buy from Supplier


    Structured Review

    New England Biolabs low range ssrna ladder
    Low Range ssRNA Ladder
    Low Range ssRNA Ladder 25 gel lanes
    https://www.bioz.com/result/low range ssrna ladder/product/New England Biolabs
    Average 95 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    low range ssrna ladder - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs"

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw786

    Incubation of in vitro transcripts of CRISPR1, 2 and 3 with Cas6-1. ( A ) A total of 2.3 μM of CRISPR1 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( B ) A total of 2 μM of CRISPR2 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( C ) A total of 3.2 μM of CRISPR3 transcript is not cleaved by 6.5 μM Cas6-1 by incubation for 2 h. ( D ) The cleavage of 6.6 μM of the shorter CRISPR1* in vitro transcript by 5.8 μM Cas6-1 monitored over a time of 2 h 20 min. Since no finally mature crRNA ( 17 ) was detected, the in vivo presence of an unknown ribonuclease is suggested. All reactions were performed at 37°C in a reaction volume of 5 μl. RNA was separated by 8 M urea 10% PAGE and bands were visualized by ethidium bromide staining. Diamonds represent repeats and rectangles spacer sequences. Transcripts were not gel purified, explaining the appearance of fragments smaller than the full length transcripts of CRISPR1 and 2 in absence of Cas6-1. Eb1, elution buffer 1 used as negative control. Molecular markers: MN, Low Range ssRNA Ladder (NEB); MF, RiboRuler Low Range RNA Ladder (Thermo Fisher Scientific).
    Figure Legend Snippet: Incubation of in vitro transcripts of CRISPR1, 2 and 3 with Cas6-1. ( A ) A total of 2.3 μM of CRISPR1 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( B ) A total of 2 μM of CRISPR2 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( C ) A total of 3.2 μM of CRISPR3 transcript is not cleaved by 6.5 μM Cas6-1 by incubation for 2 h. ( D ) The cleavage of 6.6 μM of the shorter CRISPR1* in vitro transcript by 5.8 μM Cas6-1 monitored over a time of 2 h 20 min. Since no finally mature crRNA ( 17 ) was detected, the in vivo presence of an unknown ribonuclease is suggested. All reactions were performed at 37°C in a reaction volume of 5 μl. RNA was separated by 8 M urea 10% PAGE and bands were visualized by ethidium bromide staining. Diamonds represent repeats and rectangles spacer sequences. Transcripts were not gel purified, explaining the appearance of fragments smaller than the full length transcripts of CRISPR1 and 2 in absence of Cas6-1. Eb1, elution buffer 1 used as negative control. Molecular markers: MN, Low Range ssRNA Ladder (NEB); MF, RiboRuler Low Range RNA Ladder (Thermo Fisher Scientific).

    Techniques Used: Incubation, In Vitro, In Vivo, Polyacrylamide Gel Electrophoresis, Staining, Purification, Negative Control

    2) Product Images from "The Zinc-Fingers of KREPA3 Are Essential for the Complete Editing of Mitochondrial mRNAs in Trypanosoma brucei"

    Article Title: The Zinc-Fingers of KREPA3 Are Essential for the Complete Editing of Mitochondrial mRNAs in Trypanosoma brucei

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0008913

    Loss of KREPA3 or mutation of KREPA3 ZF2 has no effect on gRNA levels. Total cellular RNA from KREPA3-RKO, RKO-KREPA3 WT-myc and ZFm2-myc cells with KREP3 Reg expressed (E) or repressed (R) were examined by a capping assay using guanylyltransferse and [α- 32 P]GTP. The similarly labeled ssRNA ladder was used to size the gRNAs which show their characteristics size heterogeneity due to their variable oligo-U tails.
    Figure Legend Snippet: Loss of KREPA3 or mutation of KREPA3 ZF2 has no effect on gRNA levels. Total cellular RNA from KREPA3-RKO, RKO-KREPA3 WT-myc and ZFm2-myc cells with KREP3 Reg expressed (E) or repressed (R) were examined by a capping assay using guanylyltransferse and [α- 32 P]GTP. The similarly labeled ssRNA ladder was used to size the gRNAs which show their characteristics size heterogeneity due to their variable oligo-U tails.

    Techniques Used: Mutagenesis, Labeling

    3) Product Images from "Biochemical analysis of the Cas6-1 RNA endonuclease associated with the subtype I-D CRISPR-Cas system in Synechocystis sp. PCC 6803"

    Article Title: Biochemical analysis of the Cas6-1 RNA endonuclease associated with the subtype I-D CRISPR-Cas system in Synechocystis sp. PCC 6803

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1447742

    Purification and in vitro cleavage assay of Synechocystis WT Cas6-1 and mutated Cas6-1 proteins. (A) Coomassie-stained 15% SDS-PAGE of heterologously overexpressed and purified Cas6-1 protein variants. The expected molecular weight of Cas6-1_6xHis is ∼ 30 kDa. 66.67 pmol recombinant enzyme was loaded on each lane and PageRuler™ Prestained Protein Ladder (Thermo Fisher Scientific) served for protein size estimation. (B, C) In in vitro cleavage assays both the (B) CRISPR1 RNA oligo repeat sequence and the (C) pre-acrRNA cassette is processed with variable efficiency by the purified Cas6-1 protein variants shown in (A). After incubation at 30°C the RNA fragments were electrophoretically size separated on a 15% PAA sequencing gel and visualized with SYBR® Gold Nucleic Acid Gel Stain. The processing results in a pattern of RNA fragments of distinct lengths. Cleavage assays were conducted with a three-fold excess (B) or a 1:1 ratio (C) of protein to RNA-substrate in cleavage buffer and incubated at 30°C for the indicated time. Expected RNA fragments and their corresponding sizes are illustrated by cartoons. Another Cas6-1 WT protein sample, which was overexpressed and purified independently, is indicated by an asterisk. Negative controls were complemented with 1 μL of H 2 O or 1 μL eluate of a mock control. Two additional nucleotides resulting from in vitro transcription were added to the 215 nt long acrRNA yielding a 217 nt long pre-acrRNA. For RNA size estimation a CRISPR1 repeat oligo ladder (C1L), RiboRuler low range RNA ladder (Thermo Fisher Scientific), low range ssRNA ladder or microRNA marker (both from New England Biolabs) were used.
    Figure Legend Snippet: Purification and in vitro cleavage assay of Synechocystis WT Cas6-1 and mutated Cas6-1 proteins. (A) Coomassie-stained 15% SDS-PAGE of heterologously overexpressed and purified Cas6-1 protein variants. The expected molecular weight of Cas6-1_6xHis is ∼ 30 kDa. 66.67 pmol recombinant enzyme was loaded on each lane and PageRuler™ Prestained Protein Ladder (Thermo Fisher Scientific) served for protein size estimation. (B, C) In in vitro cleavage assays both the (B) CRISPR1 RNA oligo repeat sequence and the (C) pre-acrRNA cassette is processed with variable efficiency by the purified Cas6-1 protein variants shown in (A). After incubation at 30°C the RNA fragments were electrophoretically size separated on a 15% PAA sequencing gel and visualized with SYBR® Gold Nucleic Acid Gel Stain. The processing results in a pattern of RNA fragments of distinct lengths. Cleavage assays were conducted with a three-fold excess (B) or a 1:1 ratio (C) of protein to RNA-substrate in cleavage buffer and incubated at 30°C for the indicated time. Expected RNA fragments and their corresponding sizes are illustrated by cartoons. Another Cas6-1 WT protein sample, which was overexpressed and purified independently, is indicated by an asterisk. Negative controls were complemented with 1 μL of H 2 O or 1 μL eluate of a mock control. Two additional nucleotides resulting from in vitro transcription were added to the 215 nt long acrRNA yielding a 217 nt long pre-acrRNA. For RNA size estimation a CRISPR1 repeat oligo ladder (C1L), RiboRuler low range RNA ladder (Thermo Fisher Scientific), low range ssRNA ladder or microRNA marker (both from New England Biolabs) were used.

    Techniques Used: Purification, In Vitro, Cleavage Assay, Staining, SDS Page, Molecular Weight, Recombinant, Sequencing, Incubation, Marker

    Related Articles

    Centrifugation:

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: After 4 h of growth, the cells were harvested by centrifugation and snap-frozen. .. For Northern blotting, 1 μg of total S. cerevisiae RNA and 20 μg of C. albicans total RNA was mixed with an equal volume of formamide loading dye (98% deionized formamide, 10 mM EDTA [pH 8.0], 0.025% bromophenol blue, 0.025% xylene cyanol), denatured for 2 min at 95°C, and separated on a Tris-borate-EDTA (TBE)/urea (8 M)–10% polyacrylamide gel for 3 h at 220 V after a pre-run of 30 min. As a size standard, the low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols.

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: The nucleic acids were pelleted by centrifugation for 30 min at 12,000 × g and 4°C. .. As a size standard, a low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols.

    Synthesized:

    Article Title: Detection of Endogenous MazF Enzymatic Activity in Staphylococcus aureus
    Article Snippet: Primers and oligonucleotides were synthesized by IDT. .. Restriction enzymes, BSA, Low-Range ssRNA Ladder, RNase Inhibitor—Human Placenta, and E. coli strains DH5α and NiCo21(DE3) [ ] were purchased from New England Biolabs (NEB).

    Autoradiography:

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly. .. Northern Blots were analyzed by autoradiography and phosphorimager analysis.

    Blocking Assay:

    Article Title: Distinct E-cadherin-based complexes regulate cell behaviour through miRNA processing or Src and p120 catenin activity
    Article Snippet: 10–20 μg of total RNA or the Low Range ssRNA Ladder (NEB) were mixed in a 1:1 volume ratio with Gel Loading Buffer II (Life Technologies), denatured at 95 °C for 5 min and loaded onto 12% denaturing PAGE RNA gels (SequaGel; National Diagnostics). .. Northern blot was carried out using the DIG Northern Starter Kit (Roche) and the DIG Wash and Block Buffer Set (Roche) according to the manufacturer’s protocol.

    Electrophoresis:

    Article Title: In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies
    Article Snippet: RiboRuler Low Range RNA Ladder (Thermo Scientific) or Low Range ssRNA Ladder (NEB) were used as molecular weight standard. .. After electrophoresis, the gel was washed 3×5 min with water and then stained for 10–30 min in 10 μM DFHBI or DFHBI-1T in buffer containing 40 mM HEPES pH 7.4, 100 mM KCl, 1 mM MgCl2 .

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: Northern blot analysis To detect full length mRNA and replication products generated from minigenomes, RNA samples were subjected to electrophoresis in 1.5% agarose-formaldehyde gels in MOPS buffer and subjected to Northern blot analysis as previously described [ ]. .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly.

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: As a size standard, a low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols. .. After electrophoresis, the gel was stained in a 0.1 M sodium acetate (pH 5.0), 50,000-fold dilution of SYBR gold stain (Invitrogen).

    Article Title: Expression and evolutionary patterns of mycobacteriophage D29 and its temperate close relatives
    Article Snippet: A Low Range ssRNA Ladder (NEB) as well as 10–15 μg total RNA was separated on a 15% TBE-Urea (7 M) polyacrylamide gel at 200 V for 2 h in 1X TBE running buffer (Ambion). .. The gel was then transferred to a Hybond-N membrane (Amersham Biosciences) by electrophoresis in 0.5X TBE running buffer (Ambion).

    Incubation:

    Article Title: Bacteriophage DNA glucosylation impairs target DNA binding by type I and II but not by type V CRISPR–Cas effector complexes
    Article Snippet: The reaction was incubated for 4 h at 37°C, thereafter 20 μl Milli-Q and 2 units DNase I (NEB) were added to remove target DNA for 15 min at 37°C. .. The samples were heated for 5 min at 95°C and loaded on a 7 M urea 8% PAGE gel, together with a Low Range ssRNA Ladder (NEB).

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs
    Article Snippet: .. Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ). .. RNA was visualized after ethidium bromide staining under UV light (254 nm) in a gel documentation system (E-Box-3026, peQlab).

    Article Title: Plant microRNAs as novel immunomodulatory agents
    Article Snippet: .. Different gel slices (covering the range from 10 to 60 nt, 70–100 nt and 100–150 nt), were recovered according to the band profile and the two ladders used (the Low Range ssRNA Ladder and the microRNA Marker, both from New England BioLabs inc.) and crushed in 1 M NaCl and incubated overnight at 4 °C. ..

    Activity Assay:

    Article Title: An estimate of the total number of true human miRNAs
    Article Snippet: All buffers and solutions for NB were prepared using DEPC-treated H2 O to eliminate nuclease activity. .. A ssRNA marker was used to estimate the sizes of bands independently of the influence of external factors (temperature etc.) (RiboReady™ Color Micro RNA ladder, VWR, Radnor, PA, USA or Low range ssRNA Ladder and microRNA Marker, New England Biolabs, Frankfurt am Main, Germany).

    Acrylamide Gel Assay:

    Article Title: Plant microRNAs as novel immunomodulatory agents
    Article Snippet: Gel fractioning of sRNA A standard 12% acrylamide gel [1X TBE, 12% acrylamide (19:1 acryl:bis-acryl)] was used to separate the plant sRNA. .. Different gel slices (covering the range from 10 to 60 nt, 70–100 nt and 100–150 nt), were recovered according to the band profile and the two ladders used (the Low Range ssRNA Ladder and the microRNA Marker, both from New England BioLabs inc.) and crushed in 1 M NaCl and incubated overnight at 4 °C.

    Hybridization:

    Article Title: A multicolor riboswitch-based platform for imaging of RNA in live mammalian cells
    Article Snippet: 10 μL of a Low Range ssRNA Ladder (New England Biolabs) was loaded as well. .. The RNA was crosslinked to the membrane by exposure to UV light, washed in 0.1X SSC and 0.1% sodium dodecyl sulfate (SDS) at 65°C for 1 h and prehybridized for 1 h in hybridization solution (6X SSC, 10X Denhardts solution (Life Technologies), 0.1% SDS) at 42°C.

    Article Title: An estimate of the total number of true human miRNAs
    Article Snippet: A ssRNA marker was used to estimate the sizes of bands independently of the influence of external factors (temperature etc.) (RiboReady™ Color Micro RNA ladder, VWR, Radnor, PA, USA or Low range ssRNA Ladder and microRNA Marker, New England Biolabs, Frankfurt am Main, Germany). .. After cross-linking of endogenous RNA, the membranes were cut in half to prevent overlapping during hybridization.

    Article Title: Expression and evolutionary patterns of mycobacteriophage D29 and its temperate close relatives
    Article Snippet: A Low Range ssRNA Ladder (NEB) as well as 10–15 μg total RNA was separated on a 15% TBE-Urea (7 M) polyacrylamide gel at 200 V for 2 h in 1X TBE running buffer (Ambion). .. Hybridization was performed using oligonucleotides that were γ32 P-ATP labeled with T4 polynucleotide kinase (NEB) for 1 h at 37 °C or – for Northern Probe A - PCR was used to generate the dsDNA product, which was then denatured, and labeled as above.

    Electrotransfer:

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: As a size standard, a low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols. .. After electrotransfer, RNA was cross-linked to the membrane using a UV cross-linker (Stratalinker; Stratagene).

    Northern Blot:

    Article Title: A multicolor riboswitch-based platform for imaging of RNA in live mammalian cells
    Article Snippet: Paragraph title: Northern blotting ... 10 μL of a Low Range ssRNA Ladder (New England Biolabs) was loaded as well.

    Article Title: Distinct E-cadherin-based complexes regulate cell behaviour through miRNA processing or Src and p120 catenin activity
    Article Snippet: Paragraph title: Northern blot ... 10–20 μg of total RNA or the Low Range ssRNA Ladder (NEB) were mixed in a 1:1 volume ratio with Gel Loading Buffer II (Life Technologies), denatured at 95 °C for 5 min and loaded onto 12% denaturing PAGE RNA gels (SequaGel; National Diagnostics).

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: .. For Northern blotting, 1 μg of total S. cerevisiae RNA and 20 μg of C. albicans total RNA was mixed with an equal volume of formamide loading dye (98% deionized formamide, 10 mM EDTA [pH 8.0], 0.025% bromophenol blue, 0.025% xylene cyanol), denatured for 2 min at 95°C, and separated on a Tris-borate-EDTA (TBE)/urea (8 M)–10% polyacrylamide gel for 3 h at 220 V after a pre-run of 30 min. As a size standard, the low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols. .. If needed, the gel was SYBR gold stained (0.5× TBE and a 50,000-fold dilution of SYBR Gold [Invitrogen]).

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly. .. Northern Blots were analyzed by autoradiography and phosphorimager analysis.

    Article Title: An estimate of the total number of true human miRNAs
    Article Snippet: Paragraph title: Northern blotting ... A ssRNA marker was used to estimate the sizes of bands independently of the influence of external factors (temperature etc.) (RiboReady™ Color Micro RNA ladder, VWR, Radnor, PA, USA or Low range ssRNA Ladder and microRNA Marker, New England Biolabs, Frankfurt am Main, Germany).

    Article Title: Expression and evolutionary patterns of mycobacteriophage D29 and its temperate close relatives
    Article Snippet: Paragraph title: Northern blots ... A Low Range ssRNA Ladder (NEB) as well as 10–15 μg total RNA was separated on a 15% TBE-Urea (7 M) polyacrylamide gel at 200 V for 2 h in 1X TBE running buffer (Ambion).

    Generated:

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs
    Article Snippet: Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ). .. For size determination of RNA fragments generated in cleavage assays with Cas6-1 or Cas6-2a separation of fragments was performed with a sequencing gel electrophoresis apparatus (Model S2, Biometra).

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: Northern blot analysis To detect full length mRNA and replication products generated from minigenomes, RNA samples were subjected to electrophoresis in 1.5% agarose-formaldehyde gels in MOPS buffer and subjected to Northern blot analysis as previously described [ ]. .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly.

    other:

    Article Title: Analysis of bacterial transcription by “massively systematic transcript end readout,” MASTER
    Article Snippet: Mix nucleic acids with an equal volume of 2x RNA loading dye, heat in thermal cycler at 95 °C for 3 min. Load samples onto pre-cast 10% TBE-urea gel next to Low Range ssRNA ladder.

    Imaging:

    Article Title: In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies
    Article Snippet: Paragraph title: In-gel imaging of fluorescent RNAs ... RiboRuler Low Range RNA Ladder (Thermo Scientific) or Low Range ssRNA Ladder (NEB) were used as molecular weight standard.

    Article Title: An estimate of the total number of true human miRNAs
    Article Snippet: A ssRNA marker was used to estimate the sizes of bands independently of the influence of external factors (temperature etc.) (RiboReady™ Color Micro RNA ladder, VWR, Radnor, PA, USA or Low range ssRNA Ladder and microRNA Marker, New England Biolabs, Frankfurt am Main, Germany). .. To check for loading control, the gel was stained with ethidiumbromide (10 mg/ml EtBr in 1× TBE) or 1× SYBR™ Gold in 1× TBE (Invitrogen/ThermoFisher Scientific, Waltham, Massachusetts, USA) and documented with a ChemiDoc Touch Imaging System (Bio-Rad, Munich, Germany).

    Sequencing:

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs
    Article Snippet: Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ). .. For size determination of RNA fragments generated in cleavage assays with Cas6-1 or Cas6-2a separation of fragments was performed with a sequencing gel electrophoresis apparatus (Model S2, Biometra).

    Molecular Weight:

    Article Title: In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies
    Article Snippet: .. RiboRuler Low Range RNA Ladder (Thermo Scientific) or Low Range ssRNA Ladder (NEB) were used as molecular weight standard. .. After electrophoresis, the gel was washed 3×5 min with water and then stained for 10–30 min in 10 μM DFHBI or DFHBI-1T in buffer containing 40 mM HEPES pH 7.4, 100 mM KCl, 1 mM MgCl2 .

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs
    Article Snippet: .. Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ). .. RNA was visualized after ethidium bromide staining under UV light (254 nm) in a gel documentation system (E-Box-3026, peQlab).

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: To detect low molecular weight RNAs, RNA was analyzed by gel electrophoresis in 6% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA buffer. .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly.

    Nucleic Acid Electrophoresis:

    Article Title: A multicolor riboswitch-based platform for imaging of RNA in live mammalian cells
    Article Snippet: All solutions for gel electrophoresis and Northern blotting were made in diethylpyrocarbonate (DEPC)-treated and autoclaved water. .. 10 μL of a Low Range ssRNA Ladder (New England Biolabs) was loaded as well.

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs
    Article Snippet: Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ). .. For size determination of RNA fragments generated in cleavage assays with Cas6-1 or Cas6-2a separation of fragments was performed with a sequencing gel electrophoresis apparatus (Model S2, Biometra).

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: To detect low molecular weight RNAs, RNA was analyzed by gel electrophoresis in 6% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA buffer. .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly.

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: Paragraph title: Acid urea-polyacrylamide gel electrophoresis (acid urea-PAGE). ... As a size standard, a low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols.

    Isolation:

    Article Title: A multicolor riboswitch-based platform for imaging of RNA in live mammalian cells
    Article Snippet: 10 μL of a Low Range ssRNA Ladder (New England Biolabs) was loaded as well. .. The gel was run in running buffer (50 mM sodium acetate pH 5.2, 10 mM EDTA pH 8.0, 6.3% formaldehyde) at 60 V for 2.5 h. To assess the quality of the isolated RNA, the gel was then stained with ethidium bromide (10 μL of 10 mg/mL ethidium bromide in 400 mL running buffer).

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: RNA was isolated with the Qiagen RNeasy minikit according to the manufacturer's recommendations. .. For Northern blotting, 1 μg of total S. cerevisiae RNA and 20 μg of C. albicans total RNA was mixed with an equal volume of formamide loading dye (98% deionized formamide, 10 mM EDTA [pH 8.0], 0.025% bromophenol blue, 0.025% xylene cyanol), denatured for 2 min at 95°C, and separated on a Tris-borate-EDTA (TBE)/urea (8 M)–10% polyacrylamide gel for 3 h at 220 V after a pre-run of 30 min. As a size standard, the low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols.

    Subcloning:

    Article Title: Detection of Endogenous MazF Enzymatic Activity in Staphylococcus aureus
    Article Snippet: Restriction enzymes, BSA, Low-Range ssRNA Ladder, RNase Inhibitor—Human Placenta, and E. coli strains DH5α and NiCo21(DE3) [ ] were purchased from New England Biolabs (NEB). .. Subcloning Efficiency DH5α Chemically Competent E. coli was purchased from Invitrogen.

    Transfection:

    Article Title: A multicolor riboswitch-based platform for imaging of RNA in live mammalian cells
    Article Snippet: Cells were harvested 48 h after transfection and total RNA was extracted using the RNeasy (Qiagen) kit according to manufacturer recommendations. .. 10 μL of a Low Range ssRNA Ladder (New England Biolabs) was loaded as well.

    Labeling:

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: For Northern blotting, 1 μg of total S. cerevisiae RNA and 20 μg of C. albicans total RNA was mixed with an equal volume of formamide loading dye (98% deionized formamide, 10 mM EDTA [pH 8.0], 0.025% bromophenol blue, 0.025% xylene cyanol), denatured for 2 min at 95°C, and separated on a Tris-borate-EDTA (TBE)/urea (8 M)–10% polyacrylamide gel for 3 h at 220 V after a pre-run of 30 min. As a size standard, the low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols. .. The heterologous Ec TyrtRNACUA was detected by using a complementary oligonucleotide (tRNA probe 2, TCTGCTCCCTTTGGCCGCTCGGGAACCCCACC [ ]), which was 5′ 32 P labeled.

    Article Title: Expression and evolutionary patterns of mycobacteriophage D29 and its temperate close relatives
    Article Snippet: A Low Range ssRNA Ladder (NEB) as well as 10–15 μg total RNA was separated on a 15% TBE-Urea (7 M) polyacrylamide gel at 200 V for 2 h in 1X TBE running buffer (Ambion). .. Hybridization was performed using oligonucleotides that were γ32 P-ATP labeled with T4 polynucleotide kinase (NEB) for 1 h at 37 °C or – for Northern Probe A - PCR was used to generate the dsDNA product, which was then denatured, and labeled as above.

    Purification:

    Article Title: In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies
    Article Snippet: Total bacterial or mammalian cell RNA was purified using Trizol LS reagent (Life Technologies) following the manufacturer's protocol. .. RiboRuler Low Range RNA Ladder (Thermo Scientific) or Low Range ssRNA Ladder (NEB) were used as molecular weight standard.

    Article Title: Bacteriophage DNA glucosylation impairs target DNA binding by type I and II but not by type V CRISPR–Cas effector complexes
    Article Snippet: DNA oligonucleotides (oligos) used for IVT were PAGE purified ( ). .. The samples were heated for 5 min at 95°C and loaded on a 7 M urea 8% PAGE gel, together with a Low Range ssRNA Ladder (NEB).

    Article Title: Analysis of bacterial transcription by “massively systematic transcript end readout,” MASTER
    Article Snippet: .. Acid phenol:chloroform, pH 4.5 BSA fraction V, OmniPur 98% Chloramphenicol Direct-zol RNA MiniPrep DNase I DTT 0.5 M EDTA, pH 8 Elution buffer (0.3 M NaCl, 10 mM Tris-HCl pH 8, 1 mM EDTA) Ethyl alcohol, absolute Glycerol Glycogen ultrapure Heparin sulfate LB (10 g bacto tryptone, 5 g yeast extract, and 10 g sodium chloride per 1 L) Low Range ssRNA ladder (NEB) Magnesium chloride MICROBExpress Kit NTP set (ultra-pure), 100 mM solutions Potassium chloride QIAprep Spin Miniprep Kit (Qiagen) 2x RNA Gel loading dye (9.5 ml deionized formamide, 0.5 ml 0.5 M EDTA pH 8.0, 12.5 μl 20% SDS; bromophenol blue, xylene cyanol and amaranth powders are added to desired color intensity) RNAP holoenzyme, purified as in ( ) RNase OUT Sodium acetate Spin-X centrifuge tube filter, 0.45 µm, RNase/DNase free 10% TBE-Urea gels, 1mm x 10 wells TBE buffer (54 g Tris base, 27.5 g boric acid, 20 ml 0.5 M EDTA per 1 L) TRI Reagent Tris-HCl pH 8 TURBO DNase SYBR Gold nucleic acid gel stain .. Transcription assays: Mix template DNA from ( 3.2.3, A ) or ( 3.2.3, B ) with RNAP holoenzyme in transcription buffer (50 mM Tris HCl pH 8.0, 10 mM MgCl2 , 0.01 mg/ml BSA, 100 mM KCl, 5% glycerol, 10 mM DTT, 0.4 U/μl RNase OUT) and equilibrate at 37 °C on heat block for 10 min to form open complexes.

    Article Title: Plant microRNAs as novel immunomodulatory agents
    Article Snippet: Different gel slices (covering the range from 10 to 60 nt, 70–100 nt and 100–150 nt), were recovered according to the band profile and the two ladders used (the Low Range ssRNA Ladder and the microRNA Marker, both from New England BioLabs inc.) and crushed in 1 M NaCl and incubated overnight at 4 °C. .. The pooled supernatants were purified with MEGAclear Kit (Life Technologies).

    Polymerase Chain Reaction:

    Article Title: Expression and evolutionary patterns of mycobacteriophage D29 and its temperate close relatives
    Article Snippet: A Low Range ssRNA Ladder (NEB) as well as 10–15 μg total RNA was separated on a 15% TBE-Urea (7 M) polyacrylamide gel at 200 V for 2 h in 1X TBE running buffer (Ambion). .. Hybridization was performed using oligonucleotides that were γ32 P-ATP labeled with T4 polynucleotide kinase (NEB) for 1 h at 37 °C or – for Northern Probe A - PCR was used to generate the dsDNA product, which was then denatured, and labeled as above.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Bacteriophage DNA glucosylation impairs target DNA binding by type I and II but not by type V CRISPR–Cas effector complexes
    Article Snippet: .. The samples were heated for 5 min at 95°C and loaded on a 7 M urea 8% PAGE gel, together with a Low Range ssRNA Ladder (NEB). ..

    Article Title: Distinct E-cadherin-based complexes regulate cell behaviour through miRNA processing or Src and p120 catenin activity
    Article Snippet: .. 10–20 μg of total RNA or the Low Range ssRNA Ladder (NEB) were mixed in a 1:1 volume ratio with Gel Loading Buffer II (Life Technologies), denatured at 95 °C for 5 min and loaded onto 12% denaturing PAGE RNA gels (SequaGel; National Diagnostics). .. RNAs were then transferred to Hybond N+ membranes (Amersham, GE Healthcare) for 2 h at 250 mA using a semidry apparatus (Hoefer TE70) and cross linked using a Stratalinker (Stratagene).

    Lysis:

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: Cell powder was resuspended in RLT lysis buffer (Qiagen) supplemented with 0.01% of β-mercaptoethanol. .. For Northern blotting, 1 μg of total S. cerevisiae RNA and 20 μg of C. albicans total RNA was mixed with an equal volume of formamide loading dye (98% deionized formamide, 10 mM EDTA [pH 8.0], 0.025% bromophenol blue, 0.025% xylene cyanol), denatured for 2 min at 95°C, and separated on a Tris-borate-EDTA (TBE)/urea (8 M)–10% polyacrylamide gel for 3 h at 220 V after a pre-run of 30 min. As a size standard, the low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: In each experiment, the levels of input minigenome RNA were determined by probing Northern blots with a positive sense CAT riboprobe. .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly.

    Software:

    Article Title: Plant microRNAs as novel immunomodulatory agents
    Article Snippet: Different gel slices (covering the range from 10 to 60 nt, 70–100 nt and 100–150 nt), were recovered according to the band profile and the two ladders used (the Low Range ssRNA Ladder and the microRNA Marker, both from New England BioLabs inc.) and crushed in 1 M NaCl and incubated overnight at 4 °C. .. Obtained fractions were analyzed using the Agilent Small RNA kit, to check the sizing and purity of the fractionation performed as well as the miRNA (21 nucleotides) content, according to the manufacturer’s software.

    In Vitro:

    Article Title: In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies
    Article Snippet: Typically 200–500 ng of total bacterial RNA, 2–5 μg of mammalian cell RNA or 50–100 ng of in vitro transcribed RNA was loaded into a well of precast 6% TBE Gel or 6% or 10% TBE-Urea Gel (Life Technologies) and ran at 270–300 V in 1x TBE buffer. .. RiboRuler Low Range RNA Ladder (Thermo Scientific) or Low Range ssRNA Ladder (NEB) were used as molecular weight standard.

    Article Title: Bacteriophage DNA glucosylation impairs target DNA binding by type I and II but not by type V CRISPR–Cas effector complexes
    Article Snippet: Preparation of crRNA and sgRNA The Cas9 sgRNA was made by in vitro transcription (IVT) of partly overlapping primers. .. The samples were heated for 5 min at 95°C and loaded on a 7 M urea 8% PAGE gel, together with a Low Range ssRNA Ladder (NEB).

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs
    Article Snippet: Paragraph title: RNase cleavage assays with in vitro transcripts ... Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ).

    Homogenization:

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: Homogenization was carried out with a Mixer Mill MM 200 (Retsch) and a shaking frequency of 30/s. .. For Northern blotting, 1 μg of total S. cerevisiae RNA and 20 μg of C. albicans total RNA was mixed with an equal volume of formamide loading dye (98% deionized formamide, 10 mM EDTA [pH 8.0], 0.025% bromophenol blue, 0.025% xylene cyanol), denatured for 2 min at 95°C, and separated on a Tris-borate-EDTA (TBE)/urea (8 M)–10% polyacrylamide gel for 3 h at 220 V after a pre-run of 30 min. As a size standard, the low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols.

    Produced:

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: The identities of each of the bands were determined by comparing the RNAs produced by minigenomes that have different arrangements of gs and ge sequences, and by examining RNAs with gene specific probes (e.g. as described in [ ]). .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly.

    Fractionation:

    Article Title: Plant microRNAs as novel immunomodulatory agents
    Article Snippet: Different gel slices (covering the range from 10 to 60 nt, 70–100 nt and 100–150 nt), were recovered according to the band profile and the two ladders used (the Low Range ssRNA Ladder and the microRNA Marker, both from New England BioLabs inc.) and crushed in 1 M NaCl and incubated overnight at 4 °C. .. Obtained fractions were analyzed using the Agilent Small RNA kit, to check the sizing and purity of the fractionation performed as well as the miRNA (21 nucleotides) content, according to the manufacturer’s software.

    Marker:

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs
    Article Snippet: .. Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ). .. RNA was visualized after ethidium bromide staining under UV light (254 nm) in a gel documentation system (E-Box-3026, peQlab).

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly. .. Northern Blots were analyzed by autoradiography and phosphorimager analysis.

    Article Title: An estimate of the total number of true human miRNAs
    Article Snippet: .. A ssRNA marker was used to estimate the sizes of bands independently of the influence of external factors (temperature etc.) (RiboReady™ Color Micro RNA ladder, VWR, Radnor, PA, USA or Low range ssRNA Ladder and microRNA Marker, New England Biolabs, Frankfurt am Main, Germany). .. To check for loading control, the gel was stained with ethidiumbromide (10 mg/ml EtBr in 1× TBE) or 1× SYBR™ Gold in 1× TBE (Invitrogen/ThermoFisher Scientific, Waltham, Massachusetts, USA) and documented with a ChemiDoc Touch Imaging System (Bio-Rad, Munich, Germany).

    Article Title: Plant microRNAs as novel immunomodulatory agents
    Article Snippet: .. Different gel slices (covering the range from 10 to 60 nt, 70–100 nt and 100–150 nt), were recovered according to the band profile and the two ladders used (the Low Range ssRNA Ladder and the microRNA Marker, both from New England BioLabs inc.) and crushed in 1 M NaCl and incubated overnight at 4 °C. ..

    Staining:

    Article Title: In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies
    Article Snippet: RiboRuler Low Range RNA Ladder (Thermo Scientific) or Low Range ssRNA Ladder (NEB) were used as molecular weight standard. .. After electrophoresis, the gel was washed 3×5 min with water and then stained for 10–30 min in 10 μM DFHBI or DFHBI-1T in buffer containing 40 mM HEPES pH 7.4, 100 mM KCl, 1 mM MgCl2 .

    Article Title: Bacteriophage DNA glucosylation impairs target DNA binding by type I and II but not by type V CRISPR–Cas effector complexes
    Article Snippet: The samples were heated for 5 min at 95°C and loaded on a 7 M urea 8% PAGE gel, together with a Low Range ssRNA Ladder (NEB). .. After 3 h, the gel was stained using 1× SYBR gold (Thermo Scientific) in 1× TBE for 10 min. For both RNA oligos, the band at 103 nt was cut from gel.

    Article Title: A multicolor riboswitch-based platform for imaging of RNA in live mammalian cells
    Article Snippet: 10 μL of a Low Range ssRNA Ladder (New England Biolabs) was loaded as well. .. The gel was run in running buffer (50 mM sodium acetate pH 5.2, 10 mM EDTA pH 8.0, 6.3% formaldehyde) at 60 V for 2.5 h. To assess the quality of the isolated RNA, the gel was then stained with ethidium bromide (10 μL of 10 mg/mL ethidium bromide in 400 mL running buffer).

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: For Northern blotting, 1 μg of total S. cerevisiae RNA and 20 μg of C. albicans total RNA was mixed with an equal volume of formamide loading dye (98% deionized formamide, 10 mM EDTA [pH 8.0], 0.025% bromophenol blue, 0.025% xylene cyanol), denatured for 2 min at 95°C, and separated on a Tris-borate-EDTA (TBE)/urea (8 M)–10% polyacrylamide gel for 3 h at 220 V after a pre-run of 30 min. As a size standard, the low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols. .. If needed, the gel was SYBR gold stained (0.5× TBE and a 50,000-fold dilution of SYBR Gold [Invitrogen]).

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs
    Article Snippet: Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ). .. RNA was visualized after ethidium bromide staining under UV light (254 nm) in a gel documentation system (E-Box-3026, peQlab).

    Article Title: RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V
    Article Snippet: .. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly. .. Northern Blots were analyzed by autoradiography and phosphorimager analysis.

    Article Title: An Expanded Genetic Code in Candida albicans To Study Protein-Protein Interactions In Vivo
    Article Snippet: As a size standard, a low-range ssRNA ladder (New England BioLabs) was used according to the manufacturer's protocols. .. After electrophoresis, the gel was stained in a 0.1 M sodium acetate (pH 5.0), 50,000-fold dilution of SYBR gold stain (Invitrogen).

    Article Title: An estimate of the total number of true human miRNAs
    Article Snippet: A ssRNA marker was used to estimate the sizes of bands independently of the influence of external factors (temperature etc.) (RiboReady™ Color Micro RNA ladder, VWR, Radnor, PA, USA or Low range ssRNA Ladder and microRNA Marker, New England Biolabs, Frankfurt am Main, Germany). .. To check for loading control, the gel was stained with ethidiumbromide (10 mg/ml EtBr in 1× TBE) or 1× SYBR™ Gold in 1× TBE (Invitrogen/ThermoFisher Scientific, Waltham, Massachusetts, USA) and documented with a ChemiDoc Touch Imaging System (Bio-Rad, Munich, Germany).

    Article Title: Analysis of bacterial transcription by “massively systematic transcript end readout,” MASTER
    Article Snippet: .. Acid phenol:chloroform, pH 4.5 BSA fraction V, OmniPur 98% Chloramphenicol Direct-zol RNA MiniPrep DNase I DTT 0.5 M EDTA, pH 8 Elution buffer (0.3 M NaCl, 10 mM Tris-HCl pH 8, 1 mM EDTA) Ethyl alcohol, absolute Glycerol Glycogen ultrapure Heparin sulfate LB (10 g bacto tryptone, 5 g yeast extract, and 10 g sodium chloride per 1 L) Low Range ssRNA ladder (NEB) Magnesium chloride MICROBExpress Kit NTP set (ultra-pure), 100 mM solutions Potassium chloride QIAprep Spin Miniprep Kit (Qiagen) 2x RNA Gel loading dye (9.5 ml deionized formamide, 0.5 ml 0.5 M EDTA pH 8.0, 12.5 μl 20% SDS; bromophenol blue, xylene cyanol and amaranth powders are added to desired color intensity) RNAP holoenzyme, purified as in ( ) RNase OUT Sodium acetate Spin-X centrifuge tube filter, 0.45 µm, RNase/DNase free 10% TBE-Urea gels, 1mm x 10 wells TBE buffer (54 g Tris base, 27.5 g boric acid, 20 ml 0.5 M EDTA per 1 L) TRI Reagent Tris-HCl pH 8 TURBO DNase SYBR Gold nucleic acid gel stain .. Transcription assays: Mix template DNA from ( 3.2.3, A ) or ( 3.2.3, B ) with RNAP holoenzyme in transcription buffer (50 mM Tris HCl pH 8.0, 10 mM MgCl2 , 0.01 mg/ml BSA, 100 mM KCl, 5% glycerol, 10 mM DTT, 0.4 U/μl RNase OUT) and equilibrate at 37 °C on heat block for 10 min to form open complexes.

    Article Title: Plant microRNAs as novel immunomodulatory agents
    Article Snippet: The gel was run until the leading dye travels about 4–5 cm down the gel, at 70 V. Gel was stained with SYBR Gold (Life Technologies) according to manufacturer’s extraction. .. Different gel slices (covering the range from 10 to 60 nt, 70–100 nt and 100–150 nt), were recovered according to the band profile and the two ladders used (the Low Range ssRNA Ladder and the microRNA Marker, both from New England BioLabs inc.) and crushed in 1 M NaCl and incubated overnight at 4 °C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs low range ssrna ladder
    Incubation of in vitro transcripts of CRISPR1, 2 and 3 with Cas6-1. ( A ) A total of 2.3 μM of CRISPR1 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( B ) A total of 2 μM of CRISPR2 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( C ) A total of 3.2 μM of CRISPR3 transcript is not cleaved by 6.5 μM Cas6-1 by incubation for 2 h. ( D ) The cleavage of 6.6 μM of the shorter CRISPR1* in vitro transcript by 5.8 μM Cas6-1 monitored over a time of 2 h 20 min. Since no finally mature crRNA ( 17 ) was detected, the in vivo presence of an unknown ribonuclease is suggested. All reactions were performed at 37°C in a reaction volume of 5 μl. RNA was separated by 8 M urea 10% PAGE and bands were visualized by ethidium bromide staining. Diamonds represent repeats and rectangles spacer sequences. Transcripts were not gel purified, explaining the appearance of fragments smaller than the full length transcripts of CRISPR1 and 2 in absence of Cas6-1. Eb1, elution buffer 1 used as negative control. Molecular markers: MN, Low Range <t>ssRNA</t> Ladder (NEB); MF, <t>RiboRuler</t> Low Range RNA Ladder (Thermo Fisher Scientific).
    Low Range Ssrna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/low range ssrna ladder/product/New England Biolabs
    Average 95 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    low range ssrna ladder - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Incubation of in vitro transcripts of CRISPR1, 2 and 3 with Cas6-1. ( A ) A total of 2.3 μM of CRISPR1 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( B ) A total of 2 μM of CRISPR2 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( C ) A total of 3.2 μM of CRISPR3 transcript is not cleaved by 6.5 μM Cas6-1 by incubation for 2 h. ( D ) The cleavage of 6.6 μM of the shorter CRISPR1* in vitro transcript by 5.8 μM Cas6-1 monitored over a time of 2 h 20 min. Since no finally mature crRNA ( 17 ) was detected, the in vivo presence of an unknown ribonuclease is suggested. All reactions were performed at 37°C in a reaction volume of 5 μl. RNA was separated by 8 M urea 10% PAGE and bands were visualized by ethidium bromide staining. Diamonds represent repeats and rectangles spacer sequences. Transcripts were not gel purified, explaining the appearance of fragments smaller than the full length transcripts of CRISPR1 and 2 in absence of Cas6-1. Eb1, elution buffer 1 used as negative control. Molecular markers: MN, Low Range ssRNA Ladder (NEB); MF, RiboRuler Low Range RNA Ladder (Thermo Fisher Scientific).

    Journal: Nucleic Acids Research

    Article Title: Structural constraints and enzymatic promiscuity in the Cas6-dependent generation of crRNAs

    doi: 10.1093/nar/gkw786

    Figure Lengend Snippet: Incubation of in vitro transcripts of CRISPR1, 2 and 3 with Cas6-1. ( A ) A total of 2.3 μM of CRISPR1 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( B ) A total of 2 μM of CRISPR2 transcript is cleaved by 6.2 μM Cas6-1 by incubation for 1 h. ( C ) A total of 3.2 μM of CRISPR3 transcript is not cleaved by 6.5 μM Cas6-1 by incubation for 2 h. ( D ) The cleavage of 6.6 μM of the shorter CRISPR1* in vitro transcript by 5.8 μM Cas6-1 monitored over a time of 2 h 20 min. Since no finally mature crRNA ( 17 ) was detected, the in vivo presence of an unknown ribonuclease is suggested. All reactions were performed at 37°C in a reaction volume of 5 μl. RNA was separated by 8 M urea 10% PAGE and bands were visualized by ethidium bromide staining. Diamonds represent repeats and rectangles spacer sequences. Transcripts were not gel purified, explaining the appearance of fragments smaller than the full length transcripts of CRISPR1 and 2 in absence of Cas6-1. Eb1, elution buffer 1 used as negative control. Molecular markers: MN, Low Range ssRNA Ladder (NEB); MF, RiboRuler Low Range RNA Ladder (Thermo Fisher Scientific).

    Article Snippet: Before loading onto denaturing 8 M urea 10% PAA gels, reactions were incubated at 95°C for 5 min. As size markers served the Low Range ssRNA Ladder from NEB (MN ), the RiboRuler Low Range RNA Ladder from Thermo Fisher Scientific (MF ) and the Low Molecular Weight Marker from Affymetrix (MA ).

    Techniques: Incubation, In Vitro, In Vivo, Polyacrylamide Gel Electrophoresis, Staining, Purification, Negative Control

    Loss of KREPA3 or mutation of KREPA3 ZF2 has no effect on gRNA levels. Total cellular RNA from KREPA3-RKO, RKO-KREPA3 WT-myc and ZFm2-myc cells with KREP3 Reg expressed (E) or repressed (R) were examined by a capping assay using guanylyltransferse and [α- 32 P]GTP. The similarly labeled ssRNA ladder was used to size the gRNAs which show their characteristics size heterogeneity due to their variable oligo-U tails.

    Journal: PLoS ONE

    Article Title: The Zinc-Fingers of KREPA3 Are Essential for the Complete Editing of Mitochondrial mRNAs in Trypanosoma brucei

    doi: 10.1371/journal.pone.0008913

    Figure Lengend Snippet: Loss of KREPA3 or mutation of KREPA3 ZF2 has no effect on gRNA levels. Total cellular RNA from KREPA3-RKO, RKO-KREPA3 WT-myc and ZFm2-myc cells with KREP3 Reg expressed (E) or repressed (R) were examined by a capping assay using guanylyltransferse and [α- 32 P]GTP. The similarly labeled ssRNA ladder was used to size the gRNAs which show their characteristics size heterogeneity due to their variable oligo-U tails.

    Article Snippet: Labeled gRNAs were identified by size in comparison to the labeled low range ssRNA ladder (NEB).

    Techniques: Mutagenesis, Labeling

    Purification and in vitro cleavage assay of Synechocystis WT Cas6-1 and mutated Cas6-1 proteins. (A) Coomassie-stained 15% SDS-PAGE of heterologously overexpressed and purified Cas6-1 protein variants. The expected molecular weight of Cas6-1_6xHis is ∼ 30 kDa. 66.67 pmol recombinant enzyme was loaded on each lane and PageRuler™ Prestained Protein Ladder (Thermo Fisher Scientific) served for protein size estimation. (B, C) In in vitro cleavage assays both the (B) CRISPR1 RNA oligo repeat sequence and the (C) pre-acrRNA cassette is processed with variable efficiency by the purified Cas6-1 protein variants shown in (A). After incubation at 30°C the RNA fragments were electrophoretically size separated on a 15% PAA sequencing gel and visualized with SYBR® Gold Nucleic Acid Gel Stain. The processing results in a pattern of RNA fragments of distinct lengths. Cleavage assays were conducted with a three-fold excess (B) or a 1:1 ratio (C) of protein to RNA-substrate in cleavage buffer and incubated at 30°C for the indicated time. Expected RNA fragments and their corresponding sizes are illustrated by cartoons. Another Cas6-1 WT protein sample, which was overexpressed and purified independently, is indicated by an asterisk. Negative controls were complemented with 1 μL of H 2 O or 1 μL eluate of a mock control. Two additional nucleotides resulting from in vitro transcription were added to the 215 nt long acrRNA yielding a 217 nt long pre-acrRNA. For RNA size estimation a CRISPR1 repeat oligo ladder (C1L), RiboRuler low range RNA ladder (Thermo Fisher Scientific), low range ssRNA ladder or microRNA marker (both from New England Biolabs) were used.

    Journal: RNA Biology

    Article Title: Biochemical analysis of the Cas6-1 RNA endonuclease associated with the subtype I-D CRISPR-Cas system in Synechocystis sp. PCC 6803

    doi: 10.1080/15476286.2018.1447742

    Figure Lengend Snippet: Purification and in vitro cleavage assay of Synechocystis WT Cas6-1 and mutated Cas6-1 proteins. (A) Coomassie-stained 15% SDS-PAGE of heterologously overexpressed and purified Cas6-1 protein variants. The expected molecular weight of Cas6-1_6xHis is ∼ 30 kDa. 66.67 pmol recombinant enzyme was loaded on each lane and PageRuler™ Prestained Protein Ladder (Thermo Fisher Scientific) served for protein size estimation. (B, C) In in vitro cleavage assays both the (B) CRISPR1 RNA oligo repeat sequence and the (C) pre-acrRNA cassette is processed with variable efficiency by the purified Cas6-1 protein variants shown in (A). After incubation at 30°C the RNA fragments were electrophoretically size separated on a 15% PAA sequencing gel and visualized with SYBR® Gold Nucleic Acid Gel Stain. The processing results in a pattern of RNA fragments of distinct lengths. Cleavage assays were conducted with a three-fold excess (B) or a 1:1 ratio (C) of protein to RNA-substrate in cleavage buffer and incubated at 30°C for the indicated time. Expected RNA fragments and their corresponding sizes are illustrated by cartoons. Another Cas6-1 WT protein sample, which was overexpressed and purified independently, is indicated by an asterisk. Negative controls were complemented with 1 μL of H 2 O or 1 μL eluate of a mock control. Two additional nucleotides resulting from in vitro transcription were added to the 215 nt long acrRNA yielding a 217 nt long pre-acrRNA. For RNA size estimation a CRISPR1 repeat oligo ladder (C1L), RiboRuler low range RNA ladder (Thermo Fisher Scientific), low range ssRNA ladder or microRNA marker (both from New England Biolabs) were used.

    Article Snippet: The low range ssRNA ladder (ssRNA marker) (New England Biolabs), the RiboRuler low range RNA ladder (Thermo Fisher Scientific) and the microRNA marker (New England Biolabs) served as RNA ladders for size estimation.

    Techniques: Purification, In Vitro, Cleavage Assay, Staining, SDS Page, Molecular Weight, Recombinant, Sequencing, Incubation, Marker