mmp 13 cdnas  (Sino Biological)

Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    MMP13 cDNA ORF Clone in Cloning Vector Mouse
    Full length Clone DNA of Mouse matrix metallopeptidase 13
    Catalog Number:
    cDNA Clone
    Product Aliases:
    Clg cDNA ORF Clone Mouse, MMP-13 cDNA ORF Clone Mouse, Mmp1 cDNA ORF Clone Mouse
    Molecule Name:
    Buy from Supplier

    Structured Review

    Sino Biological mmp 13 cdnas
    GP73-mediated CREB transactivation of <t>MMP-13</t> expression The influence of GP73 on CREB expression was demonstrated by Western blot. B. The impact of CREB on MMP-13 was illustrated by Western blot. C. Schematic representation of the promoter region of human MMP-13 gene. Site1, site2 and site3 indicate the predicted binding region (PBR) of CREB on MMP-13 promoter. PBR and nonspecific binding region (NBR) were amplified in ChIP qRT-PCR analysis. The transcription start site (TSS) is indicated by an arrow above the gene. ChIP assay demonstrated the interaction of CREB with one of the potential CREB-binding sites in MMP-13 promoter. qRT-PCR was performed to detect the amounts of immunoprecipitated products. D. The enhanced cell invasion by ectopic expression of GP73 in HepG2 cells was abrogated by depletion of CREB. ** P
    Full length Clone DNA of Mouse matrix metallopeptidase 13 13 cdnas/product/Sino Biological
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mmp 13 cdnas - by Bioz Stars, 2021-07
    86/100 stars


    1) Product Images from "Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion"

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion

    Journal: Oncotarget


    GP73-mediated CREB transactivation of MMP-13 expression The influence of GP73 on CREB expression was demonstrated by Western blot. B. The impact of CREB on MMP-13 was illustrated by Western blot. C. Schematic representation of the promoter region of human MMP-13 gene. Site1, site2 and site3 indicate the predicted binding region (PBR) of CREB on MMP-13 promoter. PBR and nonspecific binding region (NBR) were amplified in ChIP qRT-PCR analysis. The transcription start site (TSS) is indicated by an arrow above the gene. ChIP assay demonstrated the interaction of CREB with one of the potential CREB-binding sites in MMP-13 promoter. qRT-PCR was performed to detect the amounts of immunoprecipitated products. D. The enhanced cell invasion by ectopic expression of GP73 in HepG2 cells was abrogated by depletion of CREB. ** P
    Figure Legend Snippet: GP73-mediated CREB transactivation of MMP-13 expression The influence of GP73 on CREB expression was demonstrated by Western blot. B. The impact of CREB on MMP-13 was illustrated by Western blot. C. Schematic representation of the promoter region of human MMP-13 gene. Site1, site2 and site3 indicate the predicted binding region (PBR) of CREB on MMP-13 promoter. PBR and nonspecific binding region (NBR) were amplified in ChIP qRT-PCR analysis. The transcription start site (TSS) is indicated by an arrow above the gene. ChIP assay demonstrated the interaction of CREB with one of the potential CREB-binding sites in MMP-13 promoter. qRT-PCR was performed to detect the amounts of immunoprecipitated products. D. The enhanced cell invasion by ectopic expression of GP73 in HepG2 cells was abrogated by depletion of CREB. ** P

    Techniques Used: Expressing, Western Blot, Binding Assay, Amplification, Chromatin Immunoprecipitation, Quantitative RT-PCR, Immunoprecipitation

    GP73 and MMP-13 are up-regulated in HCC tissues Tumors and the adjacent liver tissues from 11 HCC patients were prepared for Western blot analysis of GP73 and MMP-13 expression A. . The abundance of GP73 and MMP-13 was then analyzed B. .
    Figure Legend Snippet: GP73 and MMP-13 are up-regulated in HCC tissues Tumors and the adjacent liver tissues from 11 HCC patients were prepared for Western blot analysis of GP73 and MMP-13 expression A. . The abundance of GP73 and MMP-13 was then analyzed B. .

    Techniques Used: Western Blot, Expressing

    MMP-13 enhances invasion and metastasis of HCC cells A. , C. Cell invasion was assessed by Matrigel Transwell assay. A. HepG2 cells were stably transfected with PCDNA6-MMP-13 (HepG2-MMP-13) or PCDNA6 (HepG2-Vector; control). C. MMP-13 was knocked down in HCCLM3 cells. Western blot (top), transferred cells (magnification, 200×) (middle) and the histograms of transferred cells from triplicate tests (mean ±SD) (bottom). B. , D. Tail vein injection of cells was used for lung metastasis. B. Ectopic MMP-13 was stably expressed in HepG2 cells. D. MMP-13 was knocked down in HCCLM3 cells. Representative lung metastases (top), H E staining of the lung tissues (middle) and scattergram of the numbers of tumor nodules in 4 nude mice during 10 weeks of observation (bottom). A t -test was used to evaluate the statistical significance of these experiments, as compared to the control. ** P
    Figure Legend Snippet: MMP-13 enhances invasion and metastasis of HCC cells A. , C. Cell invasion was assessed by Matrigel Transwell assay. A. HepG2 cells were stably transfected with PCDNA6-MMP-13 (HepG2-MMP-13) or PCDNA6 (HepG2-Vector; control). C. MMP-13 was knocked down in HCCLM3 cells. Western blot (top), transferred cells (magnification, 200×) (middle) and the histograms of transferred cells from triplicate tests (mean ±SD) (bottom). B. , D. Tail vein injection of cells was used for lung metastasis. B. Ectopic MMP-13 was stably expressed in HepG2 cells. D. MMP-13 was knocked down in HCCLM3 cells. Representative lung metastases (top), H E staining of the lung tissues (middle) and scattergram of the numbers of tumor nodules in 4 nude mice during 10 weeks of observation (bottom). A t -test was used to evaluate the statistical significance of these experiments, as compared to the control. ** P

    Techniques Used: Transwell Assay, Stable Transfection, Transfection, Plasmid Preparation, Western Blot, Injection, Staining, Mouse Assay

    GP73 promotes HCC cell invasion through upregulation of MMP-13 expression Cell invasion was assessed by Matrigel Transwell assay. A. MMP-13 was knocked down in HepG2 cells with ectopic GP73 expression. B. HCCLM3 cells were first depleted for GP73 and then overexpressed for MMP-13. Western blot (top), transferred cells (magnification, 200×) (middle) and the histograms of transferred cells from triplicate tests (mean ±SD) (bottom).* P
    Figure Legend Snippet: GP73 promotes HCC cell invasion through upregulation of MMP-13 expression Cell invasion was assessed by Matrigel Transwell assay. A. MMP-13 was knocked down in HepG2 cells with ectopic GP73 expression. B. HCCLM3 cells were first depleted for GP73 and then overexpressed for MMP-13. Western blot (top), transferred cells (magnification, 200×) (middle) and the histograms of transferred cells from triplicate tests (mean ±SD) (bottom).* P

    Techniques Used: Expressing, Transwell Assay, Western Blot

    GP73 enhances MMP-13 expression Relative levels of GP73 in 4 liver cancer cell lines were detected by qRT-PCR A. and Western blot B. . qRT-PCR analysis of MMPs mRNA level in HepG2 cells with GP73 overexpression C. or HCCLM3 cells with GP73 knockdown D. . Cellular levels of GP73 and MMP-13 in HepG2 cells with GP73 overexpression ( E. , top) or HCCLM3 cells with GP73 knockdown ( F. , top). The levels of secreted MMP-13 (active form) in the culture supernatants were measured by ELISA ( E. , F. , bottom). A t -test was used to evaluate the statistical significance of these experiments, as compared to the control. * P
    Figure Legend Snippet: GP73 enhances MMP-13 expression Relative levels of GP73 in 4 liver cancer cell lines were detected by qRT-PCR A. and Western blot B. . qRT-PCR analysis of MMPs mRNA level in HepG2 cells with GP73 overexpression C. or HCCLM3 cells with GP73 knockdown D. . Cellular levels of GP73 and MMP-13 in HepG2 cells with GP73 overexpression ( E. , top) or HCCLM3 cells with GP73 knockdown ( F. , top). The levels of secreted MMP-13 (active form) in the culture supernatants were measured by ELISA ( E. , F. , bottom). A t -test was used to evaluate the statistical significance of these experiments, as compared to the control. * P

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Over Expression, Enzyme-linked Immunosorbent Assay

    Related Articles


    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion
    Article Snippet: Generation of stable hepG2 cell lines expressing ectopic GP73 and MMP-13The full-length GP73 and non-secreted GP73 cDNA (GP73-Δ(1-55)) was amplified by forward (5′ CCCAAGCTTGGGATGGGCTTGGGAAACGGG 3′) and reverse (5′ TGCTCT AGAGCAGAGTGTATGATTCCGCT 3′) oligonucleotides, and forward (5′ CCCAAGCTTGGGTTCAACTACTGGATTGC 3′) and reverse (5′ TGCTCTAGAGCAGAGTGTATGATTCCGCT 3′) oligonucleotides, respectively, using a cDNA template obtained from Sino Biological (Beijing, China). .. MMP-13 cDNAs were amplified by forward (5′ CCCAAGCTTGGGATGCATCCAGGGGTCC TGGCTGCCTTCCTCTTCTT 3′) and reverse (5′ TGCTCTAGAGCATTAACACCACAAAATGGAATTTG CTGGCATGACGCG 3′) oligonucleotides, using a cDNA template obtained from Sino Biological. .. PCR products were digested with HindIII and XbaI and inserted into a modified pcDNA6/V5-HisB plasmid (Invitrogen, Carlsbad, CA, USA), which contains an V5 epitope at the C-terminus.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Sino Biological mmp 13 cdnas
    GP73-mediated CREB transactivation of <t>MMP-13</t> expression The influence of GP73 on CREB expression was demonstrated by Western blot. B. The impact of CREB on MMP-13 was illustrated by Western blot. C. Schematic representation of the promoter region of human MMP-13 gene. Site1, site2 and site3 indicate the predicted binding region (PBR) of CREB on MMP-13 promoter. PBR and nonspecific binding region (NBR) were amplified in ChIP qRT-PCR analysis. The transcription start site (TSS) is indicated by an arrow above the gene. ChIP assay demonstrated the interaction of CREB with one of the potential CREB-binding sites in MMP-13 promoter. qRT-PCR was performed to detect the amounts of immunoprecipitated products. D. The enhanced cell invasion by ectopic expression of GP73 in HepG2 cells was abrogated by depletion of CREB. ** P
    Mmp 13 Cdnas, supplied by Sino Biological, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more 13 cdnas/product/Sino Biological
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mmp 13 cdnas - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Sino Biological mmp 13the full length gp73
    GP73-mediated CREB transactivation of <t>MMP-13</t> expression The influence of GP73 on CREB expression was demonstrated by Western blot. B. The impact of CREB on MMP-13 was illustrated by Western blot. C. Schematic representation of the promoter region of human MMP-13 gene. Site1, site2 and site3 indicate the predicted binding region (PBR) of CREB on MMP-13 promoter. PBR and nonspecific binding region (NBR) were amplified in ChIP qRT-PCR analysis. The transcription start site (TSS) is indicated by an arrow above the gene. ChIP assay demonstrated the interaction of CREB with one of the potential CREB-binding sites in MMP-13 promoter. qRT-PCR was performed to detect the amounts of immunoprecipitated products. D. The enhanced cell invasion by ectopic expression of GP73 in HepG2 cells was abrogated by depletion of CREB. ** P
    Mmp 13the Full Length Gp73, supplied by Sino Biological, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more 13the full length gp73/product/Sino Biological
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mmp 13the full length gp73 - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results

    GP73-mediated CREB transactivation of MMP-13 expression The influence of GP73 on CREB expression was demonstrated by Western blot. B. The impact of CREB on MMP-13 was illustrated by Western blot. C. Schematic representation of the promoter region of human MMP-13 gene. Site1, site2 and site3 indicate the predicted binding region (PBR) of CREB on MMP-13 promoter. PBR and nonspecific binding region (NBR) were amplified in ChIP qRT-PCR analysis. The transcription start site (TSS) is indicated by an arrow above the gene. ChIP assay demonstrated the interaction of CREB with one of the potential CREB-binding sites in MMP-13 promoter. qRT-PCR was performed to detect the amounts of immunoprecipitated products. D. The enhanced cell invasion by ectopic expression of GP73 in HepG2 cells was abrogated by depletion of CREB. ** P

    Journal: Oncotarget

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion


    Figure Lengend Snippet: GP73-mediated CREB transactivation of MMP-13 expression The influence of GP73 on CREB expression was demonstrated by Western blot. B. The impact of CREB on MMP-13 was illustrated by Western blot. C. Schematic representation of the promoter region of human MMP-13 gene. Site1, site2 and site3 indicate the predicted binding region (PBR) of CREB on MMP-13 promoter. PBR and nonspecific binding region (NBR) were amplified in ChIP qRT-PCR analysis. The transcription start site (TSS) is indicated by an arrow above the gene. ChIP assay demonstrated the interaction of CREB with one of the potential CREB-binding sites in MMP-13 promoter. qRT-PCR was performed to detect the amounts of immunoprecipitated products. D. The enhanced cell invasion by ectopic expression of GP73 in HepG2 cells was abrogated by depletion of CREB. ** P

    Article Snippet: MMP-13 cDNAs were amplified by forward (5′ CCCAAGCTTGGGATGCATCCAGGGGTCC TGGCTGCCTTCCTCTTCTT 3′) and reverse (5′ TGCTCTAGAGCATTAACACCACAAAATGGAATTTG CTGGCATGACGCG 3′) oligonucleotides, using a cDNA template obtained from Sino Biological.

    Techniques: Expressing, Western Blot, Binding Assay, Amplification, Chromatin Immunoprecipitation, Quantitative RT-PCR, Immunoprecipitation

    GP73 and MMP-13 are up-regulated in HCC tissues Tumors and the adjacent liver tissues from 11 HCC patients were prepared for Western blot analysis of GP73 and MMP-13 expression A. . The abundance of GP73 and MMP-13 was then analyzed B. .

    Journal: Oncotarget

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion


    Figure Lengend Snippet: GP73 and MMP-13 are up-regulated in HCC tissues Tumors and the adjacent liver tissues from 11 HCC patients were prepared for Western blot analysis of GP73 and MMP-13 expression A. . The abundance of GP73 and MMP-13 was then analyzed B. .

    Article Snippet: MMP-13 cDNAs were amplified by forward (5′ CCCAAGCTTGGGATGCATCCAGGGGTCC TGGCTGCCTTCCTCTTCTT 3′) and reverse (5′ TGCTCTAGAGCATTAACACCACAAAATGGAATTTG CTGGCATGACGCG 3′) oligonucleotides, using a cDNA template obtained from Sino Biological.

    Techniques: Western Blot, Expressing

    MMP-13 enhances invasion and metastasis of HCC cells A. , C. Cell invasion was assessed by Matrigel Transwell assay. A. HepG2 cells were stably transfected with PCDNA6-MMP-13 (HepG2-MMP-13) or PCDNA6 (HepG2-Vector; control). C. MMP-13 was knocked down in HCCLM3 cells. Western blot (top), transferred cells (magnification, 200×) (middle) and the histograms of transferred cells from triplicate tests (mean ±SD) (bottom). B. , D. Tail vein injection of cells was used for lung metastasis. B. Ectopic MMP-13 was stably expressed in HepG2 cells. D. MMP-13 was knocked down in HCCLM3 cells. Representative lung metastases (top), H E staining of the lung tissues (middle) and scattergram of the numbers of tumor nodules in 4 nude mice during 10 weeks of observation (bottom). A t -test was used to evaluate the statistical significance of these experiments, as compared to the control. ** P

    Journal: Oncotarget

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion


    Figure Lengend Snippet: MMP-13 enhances invasion and metastasis of HCC cells A. , C. Cell invasion was assessed by Matrigel Transwell assay. A. HepG2 cells were stably transfected with PCDNA6-MMP-13 (HepG2-MMP-13) or PCDNA6 (HepG2-Vector; control). C. MMP-13 was knocked down in HCCLM3 cells. Western blot (top), transferred cells (magnification, 200×) (middle) and the histograms of transferred cells from triplicate tests (mean ±SD) (bottom). B. , D. Tail vein injection of cells was used for lung metastasis. B. Ectopic MMP-13 was stably expressed in HepG2 cells. D. MMP-13 was knocked down in HCCLM3 cells. Representative lung metastases (top), H E staining of the lung tissues (middle) and scattergram of the numbers of tumor nodules in 4 nude mice during 10 weeks of observation (bottom). A t -test was used to evaluate the statistical significance of these experiments, as compared to the control. ** P

    Article Snippet: MMP-13 cDNAs were amplified by forward (5′ CCCAAGCTTGGGATGCATCCAGGGGTCC TGGCTGCCTTCCTCTTCTT 3′) and reverse (5′ TGCTCTAGAGCATTAACACCACAAAATGGAATTTG CTGGCATGACGCG 3′) oligonucleotides, using a cDNA template obtained from Sino Biological.

    Techniques: Transwell Assay, Stable Transfection, Transfection, Plasmid Preparation, Western Blot, Injection, Staining, Mouse Assay

    GP73 promotes HCC cell invasion through upregulation of MMP-13 expression Cell invasion was assessed by Matrigel Transwell assay. A. MMP-13 was knocked down in HepG2 cells with ectopic GP73 expression. B. HCCLM3 cells were first depleted for GP73 and then overexpressed for MMP-13. Western blot (top), transferred cells (magnification, 200×) (middle) and the histograms of transferred cells from triplicate tests (mean ±SD) (bottom).* P

    Journal: Oncotarget

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion


    Figure Lengend Snippet: GP73 promotes HCC cell invasion through upregulation of MMP-13 expression Cell invasion was assessed by Matrigel Transwell assay. A. MMP-13 was knocked down in HepG2 cells with ectopic GP73 expression. B. HCCLM3 cells were first depleted for GP73 and then overexpressed for MMP-13. Western blot (top), transferred cells (magnification, 200×) (middle) and the histograms of transferred cells from triplicate tests (mean ±SD) (bottom).* P

    Article Snippet: MMP-13 cDNAs were amplified by forward (5′ CCCAAGCTTGGGATGCATCCAGGGGTCC TGGCTGCCTTCCTCTTCTT 3′) and reverse (5′ TGCTCTAGAGCATTAACACCACAAAATGGAATTTG CTGGCATGACGCG 3′) oligonucleotides, using a cDNA template obtained from Sino Biological.

    Techniques: Expressing, Transwell Assay, Western Blot

    GP73 enhances MMP-13 expression Relative levels of GP73 in 4 liver cancer cell lines were detected by qRT-PCR A. and Western blot B. . qRT-PCR analysis of MMPs mRNA level in HepG2 cells with GP73 overexpression C. or HCCLM3 cells with GP73 knockdown D. . Cellular levels of GP73 and MMP-13 in HepG2 cells with GP73 overexpression ( E. , top) or HCCLM3 cells with GP73 knockdown ( F. , top). The levels of secreted MMP-13 (active form) in the culture supernatants were measured by ELISA ( E. , F. , bottom). A t -test was used to evaluate the statistical significance of these experiments, as compared to the control. * P

    Journal: Oncotarget

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion


    Figure Lengend Snippet: GP73 enhances MMP-13 expression Relative levels of GP73 in 4 liver cancer cell lines were detected by qRT-PCR A. and Western blot B. . qRT-PCR analysis of MMPs mRNA level in HepG2 cells with GP73 overexpression C. or HCCLM3 cells with GP73 knockdown D. . Cellular levels of GP73 and MMP-13 in HepG2 cells with GP73 overexpression ( E. , top) or HCCLM3 cells with GP73 knockdown ( F. , top). The levels of secreted MMP-13 (active form) in the culture supernatants were measured by ELISA ( E. , F. , bottom). A t -test was used to evaluate the statistical significance of these experiments, as compared to the control. * P

    Article Snippet: MMP-13 cDNAs were amplified by forward (5′ CCCAAGCTTGGGATGCATCCAGGGGTCC TGGCTGCCTTCCTCTTCTT 3′) and reverse (5′ TGCTCTAGAGCATTAACACCACAAAATGGAATTTG CTGGCATGACGCG 3′) oligonucleotides, using a cDNA template obtained from Sino Biological.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot, Over Expression, Enzyme-linked Immunosorbent Assay