bst 2 0 warmstart dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Bst 2 0 WarmStart DNA Polymerase
    Description:
    Bst 2 0 WarmStart DNA Polymerase 8 000 units
    Catalog Number:
    M0538L
    Price:
    306
    Size:
    8 000 units
    Category:
    Thermostable DNA Polymerases
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bst 2 0 warmstart dna polymerase
    Bst 2 0 WarmStart DNA Polymerase
    Bst 2 0 WarmStart DNA Polymerase 8 000 units
    https://www.bioz.com/result/bst 2 0 warmstart dna polymerase/product/New England Biolabs
    Average 99 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    bst 2 0 warmstart dna polymerase - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform"

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.118.200087

    Optimization of MinION library preparation. A). Optimization of ligation condition for TA ligation and 6-bp sticky-end ligation. Condition 1. The manufacturer’s suggested condition; 2. the condition reported before ( wei and williams 2016 ); 3-5. the conditions with addition of 6%, 9%, and 12% enhancer mix. Efficiencies of 6-bp ligation were estimated using a pair of adaptor MP1-6bp and ME-6bp carrying complementary 6-bp sticky ends. Efficiencies of TA ligation were estimated using a pair of adaptor MP1-T and ME-A carrying complementary 3′T and 3′A overhangs. B). Titration experiment of Native Barcode (NB) adapter. 6.5ng, 9.8ng, 13ng of NB adapters were added in to the 1-step ligation reaction which contains the same amount of dA-tailed DNA and MP1-6bp adapter. The expected final products with 2-end ligated to a barcode and MP1-6bp adapter were marked in bold. The products separated on gel were also illustrated in cartoons (MP1-6bp adapter: green; NB adapter: blue; dA-tailed DNA: purple). C). Optimization of end-repair/dA-tailling condition. Lane 1, the input 434bp control fragment; lane 2, manufacturer’s recommended protocol; lane 3. the optimized condition; lane 4. The optimized condition with supplementation of Bst 2.0 WarmStart Polymerase. The expected products with 2-end ligated to an adapter were marked in bold and the products separated on gel were also illustrated in cartoons (434bp dA-tailed DNA: purple; MP1-T adapter: dark green). D). Optimization of AMPure XP bead purification by changing the volume of bead. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to onefold, 0.65-fold, 0.sixfold, 0.55-fold AMPure XP bead purification. The expected products are bands > 500 bp, and it’s marked in bold E). Optimization of AMPure XP bead purification by adjusting the concentration of PEG in wash buffer. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to 0.62-fold AMPure XP bead purification using wash buffer containing 10%, 9%, 8.5% and 8% PEG. The expected products are bands > 500 bp, and it’s marked in bold. F). Optimization of tethering condition. Lane 1-5: 1µL BAM adapter with 0-4µL ELB buffer after 3min incubation at 37°C. The expected tethered BAM adapter was marked in bold. The products separated on gel were illustrated in cartoons (BAM adapter: gray; tether: pink-black).
    Figure Legend Snippet: Optimization of MinION library preparation. A). Optimization of ligation condition for TA ligation and 6-bp sticky-end ligation. Condition 1. The manufacturer’s suggested condition; 2. the condition reported before ( wei and williams 2016 ); 3-5. the conditions with addition of 6%, 9%, and 12% enhancer mix. Efficiencies of 6-bp ligation were estimated using a pair of adaptor MP1-6bp and ME-6bp carrying complementary 6-bp sticky ends. Efficiencies of TA ligation were estimated using a pair of adaptor MP1-T and ME-A carrying complementary 3′T and 3′A overhangs. B). Titration experiment of Native Barcode (NB) adapter. 6.5ng, 9.8ng, 13ng of NB adapters were added in to the 1-step ligation reaction which contains the same amount of dA-tailed DNA and MP1-6bp adapter. The expected final products with 2-end ligated to a barcode and MP1-6bp adapter were marked in bold. The products separated on gel were also illustrated in cartoons (MP1-6bp adapter: green; NB adapter: blue; dA-tailed DNA: purple). C). Optimization of end-repair/dA-tailling condition. Lane 1, the input 434bp control fragment; lane 2, manufacturer’s recommended protocol; lane 3. the optimized condition; lane 4. The optimized condition with supplementation of Bst 2.0 WarmStart Polymerase. The expected products with 2-end ligated to an adapter were marked in bold and the products separated on gel were also illustrated in cartoons (434bp dA-tailed DNA: purple; MP1-T adapter: dark green). D). Optimization of AMPure XP bead purification by changing the volume of bead. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to onefold, 0.65-fold, 0.sixfold, 0.55-fold AMPure XP bead purification. The expected products are bands > 500 bp, and it’s marked in bold E). Optimization of AMPure XP bead purification by adjusting the concentration of PEG in wash buffer. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to 0.62-fold AMPure XP bead purification using wash buffer containing 10%, 9%, 8.5% and 8% PEG. The expected products are bands > 500 bp, and it’s marked in bold. F). Optimization of tethering condition. Lane 1-5: 1µL BAM adapter with 0-4µL ELB buffer after 3min incubation at 37°C. The expected tethered BAM adapter was marked in bold. The products separated on gel were illustrated in cartoons (BAM adapter: gray; tether: pink-black).

    Techniques Used: Ligation, Titration, Purification, Concentration Assay, Incubation

    Related Articles

    Clone Assay:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: The DNA was then cloned into the CypherSeq vector to generate a library of random CaOV3 genomic fragments. .. During the cooling period, 16 μl reactions containing 120 units of Bst 2.0 WarmStart DNA Polymerase (New England BioLabs), 1× Bst 2.0 WarmStart DNA Polymerase master mix, 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 2 mM dTTP and 200 μg/ml BSA were prepared and heated to 63°C before 4 μl of the denatured DNA was added.

    Centrifugation:

    Article Title: Bacterial phylogeny structures soil resistomes across habitats
    Article Snippet: The thawed re-suspension was then pelleted by centrifugation at 13,000 rpm for two minutes and the resulting supernatant used as template for amplification of resistance-conferring DNA fragments by PCR with Taq DNA polymerase (NEB). .. A sample PCR reaction consisted of 2.5μl of template, 2.5μl of ThermoPol reaction buffer (NEB), 0.5μl of 10mM dNTPs (NEB), 0.5μl of Taq polymerase (5U/μl), 3μl of a custom-primer mix, and 16μl of nuclease-free H2 O to bring the final reaction volume to 25μl.

    Amplification:

    Article Title: A Novel Single-Nucleotide Polymorphism Loop Mediated Isothermal Amplification Assay for Detection of Artemisinin-Resistant Plasmodium falciparum Malaria
    Article Snippet: Paragraph title: Loop Mediated Isothermal Amplification Primer Designing ... LAMP conditions were optimized as follows: 20 mM Tris-HCl, 10 mM (NH4 )2 SO4 , 50 mM KCl, and 0.1% Tween 20 pH 8.8 (Isothermal Buffer, New England Biolabs, Whitby, ON), 8 mM MgSO4 , 0.8 M Betaine, and 8 units of Bst 2.0 WarmStart DNA polymerase (New England Biolabs, Whitby, ON).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK). .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: An additional reader was not utilized as differences were not encountered between the two readers. .. Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The sensitivity of the SFGR-LAMP assay was assessed using a reference plasmid as well as crude preparations from a single infected tick.

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK). .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Amplicons from F3/B3 LAMP primers were purified using a PCR purification kit (Qiagen) and sequenced in the Oklahoma State University core facility to confirm that the targeted region amplified by the LAMP assay matched with the expected 17kDa protein gene of R . rickettsii . .. Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The sensitivity of the SFGR-LAMP assay was assessed using a reference plasmid as well as crude preparations from a single infected tick.

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Amplicons from F3/B3 LAMP primers were purified using a PCR purification kit (Qiagen) and sequenced in the Oklahoma State University core facility to confirm that the targeted region amplified by the LAMP assay matched with the expected 17kDa protein gene of R . rickettsii . .. Each LAMP reaction totaled 25 μl consisting of 9 μl nuclease free water, 2.5 μl 10x Isothermal Amplification Buffer Pack (contains 20mM Tris-HCl, 10mM (NH4 )2 SO4 , 50mM KCl, 2mM MgSO4 , 0.1% Tween® 20) (New England Biolabs), 3.5 μl 10 mM each dNTPs (New England Biolabs), 1 μl 100 mM MgSO4 (New England Biolabs), 3.5 μl 5M Betaine (Affymetrix), and 2.5 μl 10x primer mix (2μM F3 primer, 2μM B3 primer, 16μM FIP, 16μM BIP, 8μM LoopF and 8μM LoopB), 1.0 μl Bst 2.0 WarmStart DNA Polymerase (8 units/μl) (New England Biolabs), 1.0 μl 3mM Hydroxynaphthol blue (HNB) (Sigma-Aldrich), and 1 μl of sample DNA. .. Mineral oil was added on top of each reaction tube (25 μl) to minimize contamination for a total of 50 μl per reaction.

    Article Title: Bacterial phylogeny structures soil resistomes across habitats
    Article Snippet: Paragraph title: Amplification of Antibiotic Resistant Metagenomic DNA Fragments ... A sample PCR reaction consisted of 2.5μl of template, 2.5μl of ThermoPol reaction buffer (NEB), 0.5μl of 10mM dNTPs (NEB), 0.5μl of Taq polymerase (5U/μl), 3μl of a custom-primer mix, and 16μl of nuclease-free H2 O to bring the final reaction volume to 25μl.

    Article Title: Epigenetic instability of imprinted genes in human cancers
    Article Snippet: The PCR products amplified from the first set of bisulfite-converted DNA were also sequenced with the following strategy. .. The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S).

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: Paragraph title: Rolling circle amplification and affinity purification ... During the cooling period, 16 μl reactions containing 120 units of Bst 2.0 WarmStart DNA Polymerase (New England BioLabs), 1× Bst 2.0 WarmStart DNA Polymerase master mix, 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 2 mM dTTP and 200 μg/ml BSA were prepared and heated to 63°C before 4 μl of the denatured DNA was added.

    Positive Control:

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Each LAMP reaction totaled 25 μl consisting of 9 μl nuclease free water, 2.5 μl 10x Isothermal Amplification Buffer Pack (contains 20mM Tris-HCl, 10mM (NH4 )2 SO4 , 50mM KCl, 2mM MgSO4 , 0.1% Tween® 20) (New England Biolabs), 3.5 μl 10 mM each dNTPs (New England Biolabs), 1 μl 100 mM MgSO4 (New England Biolabs), 3.5 μl 5M Betaine (Affymetrix), and 2.5 μl 10x primer mix (2μM F3 primer, 2μM B3 primer, 16μM FIP, 16μM BIP, 8μM LoopF and 8μM LoopB), 1.0 μl Bst 2.0 WarmStart DNA Polymerase (8 units/μl) (New England Biolabs), 1.0 μl 3mM Hydroxynaphthol blue (HNB) (Sigma-Aldrich), and 1 μl of sample DNA. .. LAMP amplification reactions were at 65° C for one hour in a GeneMate Mini Dry Bath with heated lid (BioExpress) followed by five minutes at 95° C to stop the reaction.

    Synthesized:

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: Dynabeads® MyOne™ Streptavidin C1 (cat. no. 650.01; Thermo Fisher Scientific, Inc.) were used for further purification. .. The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min. .. Subsequently, the second-strand cDNA was amplified by PCR using the following program: 10 min at 94°C for initial denaturation, 35 cycles of 30 sec at 94°C for denaturation, 30 sec at 58°C for annealing, and 30 sec at 72°C for elongation.

    Construct:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: During the cooling period, 16 μl reactions containing 120 units of Bst 2.0 WarmStart DNA Polymerase (New England BioLabs), 1× Bst 2.0 WarmStart DNA Polymerase master mix, 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 2 mM dTTP and 200 μg/ml BSA were prepared and heated to 63°C before 4 μl of the denatured DNA was added. .. The RCA reactions were then maintained in a Bio-Rad MyCycler thermal cycler at 63°C for 96 h. Affinity purification of the biotin-labeled RCA products was performed using the Dynabeads kilobaseBINDER Kit (Life Technologies), following the manufacturer's instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Three of the LAMP primers (FIP, BIP and Loop B) overlap regions of the 17kDa protein gene qPCR primer set and TaqMan probe described by Jiang et al. [ ]. .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Three of the LAMP primers (FIP, BIP and Loop B) overlap regions of the 17kDa protein gene qPCR primer set and TaqMan probe described by Jiang et al. [ ]. .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Advanced uracil DNA glycosylase-supplemented real-time reverse transcription loop-mediated isothermal amplification (UDG-rRT-LAMP) method for universal and specific detection of Tembusu virus
    Article Snippet: The total reaction master mix volume was 18 μL consisting of 1.6 μM each of FIP and BIP primers, 0.2 μM each of F3 and B3 primers, 1.6 mM dNTPs (Invitrogen, Waltham, MA, USA), 1 M betaine (Sigma-Aldrich, St. Louis, MO, USA), 4 mM MgSO4 (New England Biolabs, MA, USA), 5 U of AMV reverse transcriptase (Promega), 100 mM dUTP (New England Biolabs), 0.2 U UDG (New England Biolabs), 1× ThermoPol reaction buffer, 8 U of Bst 2.0 warmStart® DNA polymerase (New England Biolabs), and 1× EvaGreen® fluorescent dye (Biotium, Hayward, CA, USA). .. After adding 2 μL of viral RNA, the reaction mixture was incubated at room temperature for 5 min to eliminate carryover contamination.

    Incubation:

    Article Title: Diagnosis of Brugian Filariasis by Loop-Mediated Isothermal Amplification
    Article Snippet: For the evaluation of the Hha I LAMP primer set with either Bst 2.0 DNA polymerase or Bst 2.0 WarmStart DNA polymerase (New England Biolabs), reactions were set up and performed as described above, except 50 mM KCl was used. .. For the evaluation of the Hha I LAMP primer set with either Bst 2.0 DNA polymerase or Bst 2.0 WarmStart DNA polymerase (New England Biolabs), reactions were set up and performed as described above, except 50 mM KCl was used.

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Each LAMP reaction totaled 25 μl consisting of 9 μl nuclease free water, 2.5 μl 10x Isothermal Amplification Buffer Pack (contains 20mM Tris-HCl, 10mM (NH4 )2 SO4 , 50mM KCl, 2mM MgSO4 , 0.1% Tween® 20) (New England Biolabs), 3.5 μl 10 mM each dNTPs (New England Biolabs), 1 μl 100 mM MgSO4 (New England Biolabs), 3.5 μl 5M Betaine (Affymetrix), and 2.5 μl 10x primer mix (2μM F3 primer, 2μM B3 primer, 16μM FIP, 16μM BIP, 8μM LoopF and 8μM LoopB), 1.0 μl Bst 2.0 WarmStart DNA Polymerase (8 units/μl) (New England Biolabs), 1.0 μl 3mM Hydroxynaphthol blue (HNB) (Sigma-Aldrich), and 1 μl of sample DNA. .. A positive control (R . rickettsii gDNA) and a non-template control (NTC, water) were included in each LAMP assay.

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: Addition of 0.9 µL 100 mM dATP before the second incubation did not affect the ligation efficiency if the module had already reached its maximum ∼80% efficiency; it did, however, increase the efficiency to ∼80% if the module had only reached ∼50% efficiency (data not shown). .. Addition of more Bst 2.0 WarmStart DNA Polymerase (NEB, Cat. M0538) did not improve the dA-tailing efficiency ( ).

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: The resulting fragment was mixed with the NEBNext Ultra II End Repair/dA-Tailing Module (NEB, Cat. E7546L) in a clean 8-well 0.2 mL PCR strip and incubated for 5min at 20° for end-repair reaction, and then 5 min at 65° for dA-tailing reaction. .. 3 conditions were tested to optimize end-repair/dA-tailing: 1) ∼0.5 pmol DNA (∼162.5 ng) in 60uL total reaction mixture; 2) ∼0.5 pmol DNA in 30 µL total reaction mixture with addition of 0.9 µL 100 mM dATP before the 65° incubation; 3) ∼0.5 pmol DNA control fragment in 30 µL reaction mixture with addition of 0.9 µL 100 mM dATP and 1µL Bst 2.0 WarmStart DNA polymerase (NEB, Cat. M0538S) before the 65° incubation. .. Each reaction mixture was then purified using a DNA Clean & Concentrator-5 column (Zymo, Cat. D4003 or D4013) following the manufacturer’s protocol as described above.

    Article Title: Advanced uracil DNA glycosylase-supplemented real-time reverse transcription loop-mediated isothermal amplification (UDG-rRT-LAMP) method for universal and specific detection of Tembusu virus
    Article Snippet: The total reaction master mix volume was 18 μL consisting of 1.6 μM each of FIP and BIP primers, 0.2 μM each of F3 and B3 primers, 1.6 mM dNTPs (Invitrogen, Waltham, MA, USA), 1 M betaine (Sigma-Aldrich, St. Louis, MO, USA), 4 mM MgSO4 (New England Biolabs, MA, USA), 5 U of AMV reverse transcriptase (Promega), 100 mM dUTP (New England Biolabs), 0.2 U UDG (New England Biolabs), 1× ThermoPol reaction buffer, 8 U of Bst 2.0 warmStart® DNA polymerase (New England Biolabs), and 1× EvaGreen® fluorescent dye (Biotium, Hayward, CA, USA). .. After adding 2 μL of viral RNA, the reaction mixture was incubated at room temperature for 5 min to eliminate carryover contamination.

    Stripping Membranes:

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: The resulting fragment was mixed with the NEBNext Ultra II End Repair/dA-Tailing Module (NEB, Cat. E7546L) in a clean 8-well 0.2 mL PCR strip and incubated for 5min at 20° for end-repair reaction, and then 5 min at 65° for dA-tailing reaction. .. 3 conditions were tested to optimize end-repair/dA-tailing: 1) ∼0.5 pmol DNA (∼162.5 ng) in 60uL total reaction mixture; 2) ∼0.5 pmol DNA in 30 µL total reaction mixture with addition of 0.9 µL 100 mM dATP before the 65° incubation; 3) ∼0.5 pmol DNA control fragment in 30 µL reaction mixture with addition of 0.9 µL 100 mM dATP and 1µL Bst 2.0 WarmStart DNA polymerase (NEB, Cat. M0538S) before the 65° incubation.

    Expressing:

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min. .. Subsequently, the second-strand cDNA was amplified by PCR using the following program: 10 min at 94°C for initial denaturation, 35 cycles of 30 sec at 94°C for denaturation, 30 sec at 58°C for annealing, and 30 sec at 72°C for elongation.

    Modification:

    Article Title: A Novel Single-Nucleotide Polymorphism Loop Mediated Isothermal Amplification Assay for Detection of Artemisinin-Resistant Plasmodium falciparum Malaria
    Article Snippet: Although F3, B3, and F1P remain constant in all primer sets, the 3′ end of the B1P and 3′ end of the LPB primer were modified. .. LAMP conditions were optimized as follows: 20 mM Tris-HCl, 10 mM (NH4 )2 SO4 , 50 mM KCl, and 0.1% Tween 20 pH 8.8 (Isothermal Buffer, New England Biolabs, Whitby, ON), 8 mM MgSO4 , 0.8 M Betaine, and 8 units of Bst 2.0 WarmStart DNA polymerase (New England Biolabs, Whitby, ON).

    Flow Cytometry:

    Article Title: SiC-Seq: Single-cell genome sequencing at ultra high-throughput with microfluidic droplet barcoding
    Article Snippet: The re-encapsulated microgels are incubated in a 1.5 mL tube on a heating block at 50°C for one hour. .. Tagmented microgel droplets, barcode droplets, and 500 μL of PCR solution containing 1X Invitrogen Platinum Multiplex PCR Master Mix (Thermo Fisher Scientific, catalog no. 4464268), 400 nM primers FL127 (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC, contains P5 adapter sequence) and FL129 (CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG), 50X dilution of NT buffer from the Nextera XT Kit (0.2% SDS) (Illumina, catalog no. FC-131-1024), 1% (w/v) Tween 20, 1% (w/v) PEG-6000, 2.5 U/μL Bst 2.0 WarmStart DNA Polymerase (NEB, catalog no. M0538S) are each loaded into a 1 mL syringe and injected into the sequential merger device as shown in . .. HFE-7500 fluorinated oil with 2% (w/w) 008-Fluorosurfactant is used as the continuous phase of the emulsion.

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min. .. Subsequently, the second-strand cDNA was amplified by PCR using the following program: 10 min at 94°C for initial denaturation, 35 cycles of 30 sec at 94°C for denaturation, 30 sec at 58°C for annealing, and 30 sec at 72°C for elongation.

    Ligation:

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: Addition of 0.9 µL 100 mM dATP before the second incubation did not affect the ligation efficiency if the module had already reached its maximum ∼80% efficiency; it did, however, increase the efficiency to ∼80% if the module had only reached ∼50% efficiency (data not shown). .. Addition of more Bst 2.0 WarmStart DNA Polymerase (NEB, Cat. M0538) did not improve the dA-tailing efficiency ( ).

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: 3 conditions were tested to optimize end-repair/dA-tailing: 1) ∼0.5 pmol DNA (∼162.5 ng) in 60uL total reaction mixture; 2) ∼0.5 pmol DNA in 30 µL total reaction mixture with addition of 0.9 µL 100 mM dATP before the 65° incubation; 3) ∼0.5 pmol DNA control fragment in 30 µL reaction mixture with addition of 0.9 µL 100 mM dATP and 1µL Bst 2.0 WarmStart DNA polymerase (NEB, Cat. M0538S) before the 65° incubation. .. 3 conditions were tested to optimize end-repair/dA-tailing: 1) ∼0.5 pmol DNA (∼162.5 ng) in 60uL total reaction mixture; 2) ∼0.5 pmol DNA in 30 µL total reaction mixture with addition of 0.9 µL 100 mM dATP before the 65° incubation; 3) ∼0.5 pmol DNA control fragment in 30 µL reaction mixture with addition of 0.9 µL 100 mM dATP and 1µL Bst 2.0 WarmStart DNA polymerase (NEB, Cat. M0538S) before the 65° incubation.

    Generated:

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: This fragment was generated by PCR using M13 forward and reverse primers to amplify a 434 bp fragment from a pCR-Blunt vector (Invitrogen, Cat. K2700-20) using Q5 High-Fidelity DNA Polymerase (NEB, Cat. M0491S) ( Table S1 ) as reported previously ( ). .. 3 conditions were tested to optimize end-repair/dA-tailing: 1) ∼0.5 pmol DNA (∼162.5 ng) in 60uL total reaction mixture; 2) ∼0.5 pmol DNA in 30 µL total reaction mixture with addition of 0.9 µL 100 mM dATP before the 65° incubation; 3) ∼0.5 pmol DNA control fragment in 30 µL reaction mixture with addition of 0.9 µL 100 mM dATP and 1µL Bst 2.0 WarmStart DNA polymerase (NEB, Cat. M0538S) before the 65° incubation.

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min. .. Following purification, the pooled libraries were loaded in a lane of an 8-lane flow cell and sequenced with the HumanHT-12 v4 Expression BeadChip arrays (Illumina, Inc., Sand Diego, CA, USA) on a HiSeq 2500 Illumina sequencer (Illumina, Inc.).

    other:

    Article Title: Diagnosis of Brugian Filariasis by Loop-Mediated Isothermal Amplification
    Article Snippet: Reaction times were slightly slower using Bst 2.0 WarmStart DNA polymerase regardless of the presence of loop primers ( ).

    Article Title: A reliable and rapid method for molecular detection of malarial parasites using microwave irradiation and loop mediated isothermal amplification
    Article Snippet: Bst 2.0 WarmStart™ DNA Polymerase (New England BioLabs GmbH, Frankfurt am Main, Germany) was used.

    Polymerase Chain Reaction:

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK). .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The LAMP assay detected rickettsial DNA from the plasmid preparation down to the concentration of 0.00001 ng/μl ( ).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK). .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The LAMP assay detected rickettsial DNA from the plasmid preparation down to the concentration of 0.00001 ng/μl ( ).

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: The resulting fragment was mixed with the NEBNext Ultra II End Repair/dA-Tailing Module (NEB, Cat. E7546L) in a clean 8-well 0.2 mL PCR strip and incubated for 5min at 20° for end-repair reaction, and then 5 min at 65° for dA-tailing reaction. .. 3 conditions were tested to optimize end-repair/dA-tailing: 1) ∼0.5 pmol DNA (∼162.5 ng) in 60uL total reaction mixture; 2) ∼0.5 pmol DNA in 30 µL total reaction mixture with addition of 0.9 µL 100 mM dATP before the 65° incubation; 3) ∼0.5 pmol DNA control fragment in 30 µL reaction mixture with addition of 0.9 µL 100 mM dATP and 1µL Bst 2.0 WarmStart DNA polymerase (NEB, Cat. M0538S) before the 65° incubation.

    Article Title: SiC-Seq: Single-cell genome sequencing at ultra high-throughput with microfluidic droplet barcoding
    Article Snippet: The re-encapsulated microgels are incubated in a 1.5 mL tube on a heating block at 50°C for one hour. .. Tagmented microgel droplets, barcode droplets, and 500 μL of PCR solution containing 1X Invitrogen Platinum Multiplex PCR Master Mix (Thermo Fisher Scientific, catalog no. 4464268), 400 nM primers FL127 (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC, contains P5 adapter sequence) and FL129 (CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG), 50X dilution of NT buffer from the Nextera XT Kit (0.2% SDS) (Illumina, catalog no. FC-131-1024), 1% (w/v) Tween 20, 1% (w/v) PEG-6000, 2.5 U/μL Bst 2.0 WarmStart DNA Polymerase (NEB, catalog no. M0538S) are each loaded into a 1 mL syringe and injected into the sequential merger device as shown in . .. HFE-7500 fluorinated oil with 2% (w/w) 008-Fluorosurfactant is used as the continuous phase of the emulsion.

    Article Title: Bacterial phylogeny structures soil resistomes across habitats
    Article Snippet: The thawed re-suspension was then pelleted by centrifugation at 13,000 rpm for two minutes and the resulting supernatant used as template for amplification of resistance-conferring DNA fragments by PCR with Taq DNA polymerase (NEB). .. A sample PCR reaction consisted of 2.5μl of template, 2.5μl of ThermoPol reaction buffer (NEB), 0.5μl of 10mM dNTPs (NEB), 0.5μl of Taq polymerase (5U/μl), 3μl of a custom-primer mix, and 16μl of nuclease-free H2 O to bring the final reaction volume to 25μl. .. The custom primer mix consisted of three forward and three reverse primers, each targeting the sequence immediately flanking the HincII site in the pZE21 MCS1 vector, and staggered by one base-pair.

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: First-strand reverse transcription (RT) primer: biotin, 5′-CAAGCAGAAGACGGCATACGAGTVN-3′ was conducted using a SuperScript III First-Strand Synthesis system (Thermo Fisher Scientific, Inc.) ( ) was used to synthesize the first-strand cDNA according to the manufacturer's protocols, followed by purification of cDNA with a NucleoSpin gel and polymerase chain reaction (PCR) Clean-up kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany) to remove free RT primer. .. The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min.

    Article Title: Epigenetic instability of imprinted genes in human cancers
    Article Snippet: The PCR products amplified from the first set of bisulfite-converted DNA were also sequenced with the following strategy. .. The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S). .. The pool of ligated PCR products was subsequently separated with agarose gel electrophoresis and used for isolating the DNA fragments size-ranging from 200 to 400 bp in length.

    Article Title: Poly(A) polymerase-based poly(A) length assay
    Article Snippet: Paragraph title: 2.3. PCR ... 10× ThermoPol Reaction Buffer (supplied with Taq DNA polymerase, NEB): 200 mM Tris-HCl, 100 mM (NH4 )2 SO4 , 100 mM KCl, 20 mM MgSO4 , 1% Triton X-100, pH 8.8 at 25°C.

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: During the cooling period, 16 μl reactions containing 120 units of Bst 2.0 WarmStart DNA Polymerase (New England BioLabs), 1× Bst 2.0 WarmStart DNA Polymerase master mix, 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 2 mM dTTP and 200 μg/ml BSA were prepared and heated to 63°C before 4 μl of the denatured DNA was added. .. Prior to quantification, RCA samples were sheared into 1 kb fragments with the Covaris S220 to separate concatemerized copies. p53-containing and total CypherSeq constructs were measured via ddPCR as described above with the p53ex5 (Supplementary Table SI7) and Quantisize (Supplementary Table SI5) ddPCR assays, respectively.

    Injection:

    Article Title: SiC-Seq: Single-cell genome sequencing at ultra high-throughput with microfluidic droplet barcoding
    Article Snippet: The re-encapsulated microgels are incubated in a 1.5 mL tube on a heating block at 50°C for one hour. .. Tagmented microgel droplets, barcode droplets, and 500 μL of PCR solution containing 1X Invitrogen Platinum Multiplex PCR Master Mix (Thermo Fisher Scientific, catalog no. 4464268), 400 nM primers FL127 (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC, contains P5 adapter sequence) and FL129 (CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG), 50X dilution of NT buffer from the Nextera XT Kit (0.2% SDS) (Illumina, catalog no. FC-131-1024), 1% (w/v) Tween 20, 1% (w/v) PEG-6000, 2.5 U/μL Bst 2.0 WarmStart DNA Polymerase (NEB, catalog no. M0538S) are each loaded into a 1 mL syringe and injected into the sequential merger device as shown in . .. HFE-7500 fluorinated oil with 2% (w/w) 008-Fluorosurfactant is used as the continuous phase of the emulsion.

    Combined Bisulfite Restriction Analysis Assay:

    Article Title: Epigenetic instability of imprinted genes in human cancers
    Article Snippet: Paragraph title: DNA methylation analyses by COBRA and individual sequencing ... The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S).

    RNA Sequencing Assay:

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: Paragraph title: RNA-seq ... The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min.

    Fluorescence:

    Article Title: Advanced uracil DNA glycosylase-supplemented real-time reverse transcription loop-mediated isothermal amplification (UDG-rRT-LAMP) method for universal and specific detection of Tembusu virus
    Article Snippet: The total reaction master mix volume was 18 μL consisting of 1.6 μM each of FIP and BIP primers, 0.2 μM each of F3 and B3 primers, 1.6 mM dNTPs (Invitrogen, Waltham, MA, USA), 1 M betaine (Sigma-Aldrich, St. Louis, MO, USA), 4 mM MgSO4 (New England Biolabs, MA, USA), 5 U of AMV reverse transcriptase (Promega), 100 mM dUTP (New England Biolabs), 0.2 U UDG (New England Biolabs), 1× ThermoPol reaction buffer, 8 U of Bst 2.0 warmStart® DNA polymerase (New England Biolabs), and 1× EvaGreen® fluorescent dye (Biotium, Hayward, CA, USA). .. After adding 2 μL of viral RNA, the reaction mixture was incubated at room temperature for 5 min to eliminate carryover contamination.

    Methylation:

    Article Title: Epigenetic instability of imprinted genes in human cancers
    Article Snippet: The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S). .. The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S).

    Mutagenesis:

    Article Title: A Novel Single-Nucleotide Polymorphism Loop Mediated Isothermal Amplification Assay for Detection of Artemisinin-Resistant Plasmodium falciparum Malaria
    Article Snippet: The addition of mismatched nucleotides in these 2 primers were predicted to preferentially amplify mutant over wild type because more mismatches were present when compared with the wild-type sequence. .. LAMP conditions were optimized as follows: 20 mM Tris-HCl, 10 mM (NH4 )2 SO4 , 50 mM KCl, and 0.1% Tween 20 pH 8.8 (Isothermal Buffer, New England Biolabs, Whitby, ON), 8 mM MgSO4 , 0.8 M Betaine, and 8 units of Bst 2.0 WarmStart DNA polymerase (New England Biolabs, Whitby, ON).

    Isolation:

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: Total RNA was isolated from MCF-7 and MCF-7/MDR cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. .. The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min.

    Article Title: Epigenetic instability of imprinted genes in human cancers
    Article Snippet: The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S). .. The pool of ligated PCR products was subsequently separated with agarose gel electrophoresis and used for isolating the DNA fragments size-ranging from 200 to 400 bp in length.

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: Genomic DNA from CaOV3 cells was sheared into 150 bp fragments with a Covaris S220 focused ultrasonicator, followed by gel isolation and end repair with a Quick Blunting Kit (NEB). .. During the cooling period, 16 μl reactions containing 120 units of Bst 2.0 WarmStart DNA Polymerase (New England BioLabs), 1× Bst 2.0 WarmStart DNA Polymerase master mix, 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 2 mM dTTP and 200 μg/ml BSA were prepared and heated to 63°C before 4 μl of the denatured DNA was added.

    Size-exclusion Chromatography:

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: Dynabeads® MyOne™ Streptavidin C1 (cat. no. 650.01; Thermo Fisher Scientific, Inc.) were used for further purification. .. The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min. .. Subsequently, the second-strand cDNA was amplified by PCR using the following program: 10 min at 94°C for initial denaturation, 35 cycles of 30 sec at 94°C for denaturation, 30 sec at 58°C for annealing, and 30 sec at 72°C for elongation.

    Purification:

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK). .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK). .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Bacterial phylogeny structures soil resistomes across habitats
    Article Snippet: A sample PCR reaction consisted of 2.5μl of template, 2.5μl of ThermoPol reaction buffer (NEB), 0.5μl of 10mM dNTPs (NEB), 0.5μl of Taq polymerase (5U/μl), 3μl of a custom-primer mix, and 16μl of nuclease-free H2 O to bring the final reaction volume to 25μl. .. PCR reactions were then amplified using the following thermocycler conditions: 94°C for 10 minutes, 25 cycles of 94°C for 5 minutes + 55°C for 45 seconds + 72°C for 5.5 minutes, and 72°C for 10 minutes.

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: Dynabeads® MyOne™ Streptavidin C1 (cat. no. 650.01; Thermo Fisher Scientific, Inc.) were used for further purification. .. The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min.

    Sequencing:

    Article Title: A Novel Single-Nucleotide Polymorphism Loop Mediated Isothermal Amplification Assay for Detection of Artemisinin-Resistant Plasmodium falciparum Malaria
    Article Snippet: The addition of mismatched nucleotides in these 2 primers were predicted to preferentially amplify mutant over wild type because more mismatches were present when compared with the wild-type sequence. .. LAMP conditions were optimized as follows: 20 mM Tris-HCl, 10 mM (NH4 )2 SO4 , 50 mM KCl, and 0.1% Tween 20 pH 8.8 (Isothermal Buffer, New England Biolabs, Whitby, ON), 8 mM MgSO4 , 0.8 M Betaine, and 8 units of Bst 2.0 WarmStart DNA polymerase (New England Biolabs, Whitby, ON).

    Article Title: SiC-Seq: Single-cell genome sequencing at ultra high-throughput with microfluidic droplet barcoding
    Article Snippet: The re-encapsulated microgels are incubated in a 1.5 mL tube on a heating block at 50°C for one hour. .. Tagmented microgel droplets, barcode droplets, and 500 μL of PCR solution containing 1X Invitrogen Platinum Multiplex PCR Master Mix (Thermo Fisher Scientific, catalog no. 4464268), 400 nM primers FL127 (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC, contains P5 adapter sequence) and FL129 (CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG), 50X dilution of NT buffer from the Nextera XT Kit (0.2% SDS) (Illumina, catalog no. FC-131-1024), 1% (w/v) Tween 20, 1% (w/v) PEG-6000, 2.5 U/μL Bst 2.0 WarmStart DNA Polymerase (NEB, catalog no. M0538S) are each loaded into a 1 mL syringe and injected into the sequential merger device as shown in . .. HFE-7500 fluorinated oil with 2% (w/w) 008-Fluorosurfactant is used as the continuous phase of the emulsion.

    Article Title: Bacterial phylogeny structures soil resistomes across habitats
    Article Snippet: A sample PCR reaction consisted of 2.5μl of template, 2.5μl of ThermoPol reaction buffer (NEB), 0.5μl of 10mM dNTPs (NEB), 0.5μl of Taq polymerase (5U/μl), 3μl of a custom-primer mix, and 16μl of nuclease-free H2 O to bring the final reaction volume to 25μl. .. The custom primer mix consisted of three forward and three reverse primers, each targeting the sequence immediately flanking the HincII site in the pZE21 MCS1 vector, and staggered by one base-pair.

    Article Title: Epigenetic instability of imprinted genes in human cancers
    Article Snippet: Paragraph title: DNA methylation analyses by COBRA and individual sequencing ... The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S).

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: During the cooling period, 16 μl reactions containing 120 units of Bst 2.0 WarmStart DNA Polymerase (New England BioLabs), 1× Bst 2.0 WarmStart DNA Polymerase master mix, 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 2 mM dTTP and 200 μg/ml BSA were prepared and heated to 63°C before 4 μl of the denatured DNA was added. .. Prior to quantification, RCA samples were sheared into 1 kb fragments with the Covaris S220 to separate concatemerized copies. p53-containing and total CypherSeq constructs were measured via ddPCR as described above with the p53ex5 (Supplementary Table SI7) and Quantisize (Supplementary Table SI5) ddPCR assays, respectively.

    Affinity Purification:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: Paragraph title: Rolling circle amplification and affinity purification ... During the cooling period, 16 μl reactions containing 120 units of Bst 2.0 WarmStart DNA Polymerase (New England BioLabs), 1× Bst 2.0 WarmStart DNA Polymerase master mix, 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 2 mM dTTP and 200 μg/ml BSA were prepared and heated to 63°C before 4 μl of the denatured DNA was added.

    Plasmid Preparation:

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The sensitivity of the SFGR-LAMP assay was assessed using a reference plasmid as well as crude preparations from a single infected tick.

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The sensitivity of the SFGR-LAMP assay was assessed using a reference plasmid as well as crude preparations from a single infected tick.

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
    Article Snippet: This fragment was generated by PCR using M13 forward and reverse primers to amplify a 434 bp fragment from a pCR-Blunt vector (Invitrogen, Cat. K2700-20) using Q5 High-Fidelity DNA Polymerase (NEB, Cat. M0491S) ( Table S1 ) as reported previously ( ). .. 3 conditions were tested to optimize end-repair/dA-tailing: 1) ∼0.5 pmol DNA (∼162.5 ng) in 60uL total reaction mixture; 2) ∼0.5 pmol DNA in 30 µL total reaction mixture with addition of 0.9 µL 100 mM dATP before the 65° incubation; 3) ∼0.5 pmol DNA control fragment in 30 µL reaction mixture with addition of 0.9 µL 100 mM dATP and 1µL Bst 2.0 WarmStart DNA polymerase (NEB, Cat. M0538S) before the 65° incubation.

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: The DNA was then cloned into the CypherSeq vector to generate a library of random CaOV3 genomic fragments. .. During the cooling period, 16 μl reactions containing 120 units of Bst 2.0 WarmStart DNA Polymerase (New England BioLabs), 1× Bst 2.0 WarmStart DNA Polymerase master mix, 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 2 mM dTTP and 200 μg/ml BSA were prepared and heated to 63°C before 4 μl of the denatured DNA was added.

    Software:

    Article Title: Diagnosis of Brugian Filariasis by Loop-Mediated Isothermal Amplification
    Article Snippet: For the evaluation of the Hha I LAMP primer set with either Bst 2.0 DNA polymerase or Bst 2.0 WarmStart DNA polymerase (New England Biolabs), reactions were set up and performed as described above, except 50 mM KCl was used. .. For the evaluation of the Hha I LAMP primer set with either Bst 2.0 DNA polymerase or Bst 2.0 WarmStart DNA polymerase (New England Biolabs), reactions were set up and performed as described above, except 50 mM KCl was used.

    Article Title: Advanced uracil DNA glycosylase-supplemented real-time reverse transcription loop-mediated isothermal amplification (UDG-rRT-LAMP) method for universal and specific detection of Tembusu virus
    Article Snippet: The total reaction master mix volume was 18 μL consisting of 1.6 μM each of FIP and BIP primers, 0.2 μM each of F3 and B3 primers, 1.6 mM dNTPs (Invitrogen, Waltham, MA, USA), 1 M betaine (Sigma-Aldrich, St. Louis, MO, USA), 4 mM MgSO4 (New England Biolabs, MA, USA), 5 U of AMV reverse transcriptase (Promega), 100 mM dUTP (New England Biolabs), 0.2 U UDG (New England Biolabs), 1× ThermoPol reaction buffer, 8 U of Bst 2.0 warmStart® DNA polymerase (New England Biolabs), and 1× EvaGreen® fluorescent dye (Biotium, Hayward, CA, USA). .. Following incubation, the reaction was performed using the 7500 Real-time PCR System (Applied Biosystems, Foster City, CA, USA) for rRT-LAMP or with a water bath for RT-LAMP at 63 °C for 1 h. The thermal cycling profile for rRT-LAMP proceeded as follows: 60 cycles of 62.5 °C for 5 s and 63.5 °C for 55 s. Fluorescence signals for each sample were collected at the end of the 63.5 °C step.

    Multiplex Assay:

    Article Title: SiC-Seq: Single-cell genome sequencing at ultra high-throughput with microfluidic droplet barcoding
    Article Snippet: The re-encapsulated microgels are incubated in a 1.5 mL tube on a heating block at 50°C for one hour. .. Tagmented microgel droplets, barcode droplets, and 500 μL of PCR solution containing 1X Invitrogen Platinum Multiplex PCR Master Mix (Thermo Fisher Scientific, catalog no. 4464268), 400 nM primers FL127 (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC, contains P5 adapter sequence) and FL129 (CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG), 50X dilution of NT buffer from the Nextera XT Kit (0.2% SDS) (Illumina, catalog no. FC-131-1024), 1% (w/v) Tween 20, 1% (w/v) PEG-6000, 2.5 U/μL Bst 2.0 WarmStart DNA Polymerase (NEB, catalog no. M0538S) are each loaded into a 1 mL syringe and injected into the sequential merger device as shown in . .. HFE-7500 fluorinated oil with 2% (w/w) 008-Fluorosurfactant is used as the continuous phase of the emulsion.

    Article Title: Identification of genes and pathways associated with MDR in MCF-7/MDR breast cancer cells by RNA-seq analysis
    Article Snippet: The second-strand cDNA was synthesized using dNTP mix and Taq DNA polymerase with ThermoPol reaction Buffer (cat. no. M0237L; New England BioLabs, Inc., Ipswich, MA, USA) following the program: 25°C for 60 min, 68°C for 30 sec, and 75°C for 5 min. .. Following purification, the pooled libraries were loaded in a lane of an 8-lane flow cell and sequenced with the HumanHT-12 v4 Expression BeadChip arrays (Illumina, Inc., Sand Diego, CA, USA) on a HiSeq 2500 Illumina sequencer (Illumina, Inc.).

    Agarose Gel Electrophoresis:

    Article Title: Advanced uracil DNA glycosylase-supplemented real-time reverse transcription loop-mediated isothermal amplification (UDG-rRT-LAMP) method for universal and specific detection of Tembusu virus
    Article Snippet: The total reaction master mix volume was 18 μL consisting of 1.6 μM each of FIP and BIP primers, 0.2 μM each of F3 and B3 primers, 1.6 mM dNTPs (Invitrogen, Waltham, MA, USA), 1 M betaine (Sigma-Aldrich, St. Louis, MO, USA), 4 mM MgSO4 (New England Biolabs, MA, USA), 5 U of AMV reverse transcriptase (Promega), 100 mM dUTP (New England Biolabs), 0.2 U UDG (New England Biolabs), 1× ThermoPol reaction buffer, 8 U of Bst 2.0 warmStart® DNA polymerase (New England Biolabs), and 1× EvaGreen® fluorescent dye (Biotium, Hayward, CA, USA). .. The time threshold (Tt) values and standard curve were analyzed using the SDS software program (version 1.4) and visualized using OriginPro 8.5 software (OriginLab, Northampton, MA, USA).

    Next-Generation Sequencing:

    Article Title: Epigenetic instability of imprinted genes in human cancers
    Article Snippet: The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S). .. The library of isolated DNA fragments was amplified with the following two primers: 5′-CCACTACGCCTCCGCTTTCCTCT-3′ and 5′-CCATCTCATCCCTGCGTGTCTCC-3′ corresponding to the two adaptors.

    DNA Methylation Assay:

    Article Title: Epigenetic instability of imprinted genes in human cancers
    Article Snippet: Paragraph title: DNA methylation analyses by COBRA and individual sequencing ... The 144 PCR products (8 tissues × 16 genomic regions) were grouped together, end-repaired and ligated with two duplex adaptors, Ion Torrent P1 and A adaptors, with the following kit supplemented with T4 ligase and Bst 2.0 WarmStart DNA polymerase (NEBNext End Repair Module, New England Biolabs, Cat. No. E6050S).

    Concentration Assay:

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The sensitivity of the SFGR-LAMP assay was assessed using a reference plasmid as well as crude preparations from a single infected tick.

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The sensitivity of the SFGR-LAMP assay was assessed using a reference plasmid as well as crude preparations from a single infected tick.

    Lamp Assay:

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Six primers were designed for LAMP assay ( ) and were designed based on the 17kDa protein gene, the same region that has been used for end-point and qPCR primers to screen SFG rickettsia species in field-collected ticks [ , ]. .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The sensitivity of the SFGR-LAMP assay was assessed using a reference plasmid as well as crude preparations from a single infected tick.

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Six primers were designed for LAMP assay ( ) and were designed based on the 17kDa protein gene, the same region that has been used for end-point and qPCR primers to screen SFG rickettsia species in field-collected ticks [ , ]. .. Two commercially available LAMP chemistries were used: the Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (ISO-004) (Optigene, UK).

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Successful LAMP amplification was achieved with either of the LAMP chemistries used, Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, USA) and the GspSSD2.0 Isothermal Master Mix (Optigene, UK) (Figs and ) using primers listed in and genomic DNA from a variety of SFG rickettsia species as well as crude DNA preparations of pooled field-collected ticks and pooled fleas from domestic dogs and cats. .. The sensitivity of the SFGR-LAMP assay was assessed using a reference plasmid as well as crude preparations from a single infected tick.

    Article Title: Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia
    Article Snippet: Each LAMP reaction totaled 25 μl consisting of 9 μl nuclease free water, 2.5 μl 10x Isothermal Amplification Buffer Pack (contains 20mM Tris-HCl, 10mM (NH4 )2 SO4 , 50mM KCl, 2mM MgSO4 , 0.1% Tween® 20) (New England Biolabs), 3.5 μl 10 mM each dNTPs (New England Biolabs), 1 μl 100 mM MgSO4 (New England Biolabs), 3.5 μl 5M Betaine (Affymetrix), and 2.5 μl 10x primer mix (2μM F3 primer, 2μM B3 primer, 16μM FIP, 16μM BIP, 8μM LoopF and 8μM LoopB), 1.0 μl Bst 2.0 WarmStart DNA Polymerase (8 units/μl) (New England Biolabs), 1.0 μl 3mM Hydroxynaphthol blue (HNB) (Sigma-Aldrich), and 1 μl of sample DNA. .. LAMP amplification reactions were at 65° C for one hour in a GeneMate Mini Dry Bath with heated lid (BioExpress) followed by five minutes at 95° C to stop the reaction.

    Lysis:

    Article Title: Bacterial phylogeny structures soil resistomes across habitats
    Article Snippet: Cells were subsequently pelleted a second time and re-suspended in 30μl nuclease-free H2 O. Re-suspensions were then frozen at −20°C for one hour and thawed to promote cell lysis. .. A sample PCR reaction consisted of 2.5μl of template, 2.5μl of ThermoPol reaction buffer (NEB), 0.5μl of 10mM dNTPs (NEB), 0.5μl of Taq polymerase (5U/μl), 3μl of a custom-primer mix, and 16μl of nuclease-free H2 O to bring the final reaction volume to 25μl.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bst 2 0 warmstart dna polymerase
    Optimization of MinION library preparation. A). Optimization of ligation condition for TA ligation and 6-bp sticky-end ligation. Condition 1. The manufacturer’s suggested condition; 2. the condition reported before ( wei and williams 2016 ); 3-5. the conditions with addition of 6%, 9%, and 12% enhancer mix. Efficiencies of 6-bp ligation were estimated using a pair of adaptor MP1-6bp and ME-6bp carrying complementary 6-bp sticky ends. Efficiencies of TA ligation were estimated using a pair of adaptor MP1-T and ME-A carrying complementary 3′T and 3′A overhangs. B). Titration experiment of Native Barcode (NB) adapter. 6.5ng, 9.8ng, 13ng of NB adapters were added in to the 1-step ligation reaction which contains the same amount of dA-tailed <t>DNA</t> and MP1-6bp adapter. The expected final products with 2-end ligated to a barcode and MP1-6bp adapter were marked in bold. The products separated on gel were also illustrated in cartoons (MP1-6bp adapter: green; NB adapter: blue; dA-tailed DNA: purple). C). Optimization of end-repair/dA-tailling condition. Lane 1, the input 434bp control fragment; lane 2, manufacturer’s recommended protocol; lane 3. the optimized condition; lane 4. The optimized condition with supplementation of Bst 2.0 <t>WarmStart</t> Polymerase. The expected products with 2-end ligated to an adapter were marked in bold and the products separated on gel were also illustrated in cartoons (434bp dA-tailed DNA: purple; MP1-T adapter: dark green). D). Optimization of AMPure XP bead purification by changing the volume of bead. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to onefold, 0.65-fold, 0.sixfold, 0.55-fold AMPure XP bead purification. The expected products are bands > 500 bp, and it’s marked in bold E). Optimization of AMPure XP bead purification by adjusting the concentration of PEG in wash buffer. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to 0.62-fold AMPure XP bead purification using wash buffer containing 10%, 9%, 8.5% and 8% PEG. The expected products are bands > 500 bp, and it’s marked in bold. F). Optimization of tethering condition. Lane 1-5: 1µL BAM adapter with 0-4µL ELB buffer after 3min incubation at 37°C. The expected tethered BAM adapter was marked in bold. The products separated on gel were illustrated in cartoons (BAM adapter: gray; tether: pink-black).
    Bst 2 0 Warmstart Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bst 2 0 warmstart dna polymerase/product/New England Biolabs
    Average 99 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    bst 2 0 warmstart dna polymerase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs thermopol reaction buffer
    Optimization of MinION library preparation. A). Optimization of ligation condition for TA ligation and 6-bp sticky-end ligation. Condition 1. The manufacturer’s suggested condition; 2. the condition reported before ( wei and williams 2016 ); 3-5. the conditions with addition of 6%, 9%, and 12% enhancer mix. Efficiencies of 6-bp ligation were estimated using a pair of adaptor MP1-6bp and ME-6bp carrying complementary 6-bp sticky ends. Efficiencies of TA ligation were estimated using a pair of adaptor MP1-T and ME-A carrying complementary 3′T and 3′A overhangs. B). Titration experiment of Native Barcode (NB) adapter. 6.5ng, 9.8ng, 13ng of NB adapters were added in to the 1-step ligation reaction which contains the same amount of dA-tailed <t>DNA</t> and MP1-6bp adapter. The expected final products with 2-end ligated to a barcode and MP1-6bp adapter were marked in bold. The products separated on gel were also illustrated in cartoons (MP1-6bp adapter: green; NB adapter: blue; dA-tailed DNA: purple). C). Optimization of end-repair/dA-tailling condition. Lane 1, the input 434bp control fragment; lane 2, manufacturer’s recommended protocol; lane 3. the optimized condition; lane 4. The optimized condition with supplementation of Bst 2.0 <t>WarmStart</t> Polymerase. The expected products with 2-end ligated to an adapter were marked in bold and the products separated on gel were also illustrated in cartoons (434bp dA-tailed DNA: purple; MP1-T adapter: dark green). D). Optimization of AMPure XP bead purification by changing the volume of bead. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to onefold, 0.65-fold, 0.sixfold, 0.55-fold AMPure XP bead purification. The expected products are bands > 500 bp, and it’s marked in bold E). Optimization of AMPure XP bead purification by adjusting the concentration of PEG in wash buffer. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to 0.62-fold AMPure XP bead purification using wash buffer containing 10%, 9%, 8.5% and 8% PEG. The expected products are bands > 500 bp, and it’s marked in bold. F). Optimization of tethering condition. Lane 1-5: 1µL BAM adapter with 0-4µL ELB buffer after 3min incubation at 37°C. The expected tethered BAM adapter was marked in bold. The products separated on gel were illustrated in cartoons (BAM adapter: gray; tether: pink-black).
    Thermopol Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermopol reaction buffer/product/New England Biolabs
    Average 99 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    thermopol reaction buffer - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Optimization of MinION library preparation. A). Optimization of ligation condition for TA ligation and 6-bp sticky-end ligation. Condition 1. The manufacturer’s suggested condition; 2. the condition reported before ( wei and williams 2016 ); 3-5. the conditions with addition of 6%, 9%, and 12% enhancer mix. Efficiencies of 6-bp ligation were estimated using a pair of adaptor MP1-6bp and ME-6bp carrying complementary 6-bp sticky ends. Efficiencies of TA ligation were estimated using a pair of adaptor MP1-T and ME-A carrying complementary 3′T and 3′A overhangs. B). Titration experiment of Native Barcode (NB) adapter. 6.5ng, 9.8ng, 13ng of NB adapters were added in to the 1-step ligation reaction which contains the same amount of dA-tailed DNA and MP1-6bp adapter. The expected final products with 2-end ligated to a barcode and MP1-6bp adapter were marked in bold. The products separated on gel were also illustrated in cartoons (MP1-6bp adapter: green; NB adapter: blue; dA-tailed DNA: purple). C). Optimization of end-repair/dA-tailling condition. Lane 1, the input 434bp control fragment; lane 2, manufacturer’s recommended protocol; lane 3. the optimized condition; lane 4. The optimized condition with supplementation of Bst 2.0 WarmStart Polymerase. The expected products with 2-end ligated to an adapter were marked in bold and the products separated on gel were also illustrated in cartoons (434bp dA-tailed DNA: purple; MP1-T adapter: dark green). D). Optimization of AMPure XP bead purification by changing the volume of bead. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to onefold, 0.65-fold, 0.sixfold, 0.55-fold AMPure XP bead purification. The expected products are bands > 500 bp, and it’s marked in bold E). Optimization of AMPure XP bead purification by adjusting the concentration of PEG in wash buffer. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to 0.62-fold AMPure XP bead purification using wash buffer containing 10%, 9%, 8.5% and 8% PEG. The expected products are bands > 500 bp, and it’s marked in bold. F). Optimization of tethering condition. Lane 1-5: 1µL BAM adapter with 0-4µL ELB buffer after 3min incubation at 37°C. The expected tethered BAM adapter was marked in bold. The products separated on gel were illustrated in cartoons (BAM adapter: gray; tether: pink-black).

    Journal: G3: Genes|Genomes|Genetics

    Article Title: Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    doi: 10.1534/g3.118.200087

    Figure Lengend Snippet: Optimization of MinION library preparation. A). Optimization of ligation condition for TA ligation and 6-bp sticky-end ligation. Condition 1. The manufacturer’s suggested condition; 2. the condition reported before ( wei and williams 2016 ); 3-5. the conditions with addition of 6%, 9%, and 12% enhancer mix. Efficiencies of 6-bp ligation were estimated using a pair of adaptor MP1-6bp and ME-6bp carrying complementary 6-bp sticky ends. Efficiencies of TA ligation were estimated using a pair of adaptor MP1-T and ME-A carrying complementary 3′T and 3′A overhangs. B). Titration experiment of Native Barcode (NB) adapter. 6.5ng, 9.8ng, 13ng of NB adapters were added in to the 1-step ligation reaction which contains the same amount of dA-tailed DNA and MP1-6bp adapter. The expected final products with 2-end ligated to a barcode and MP1-6bp adapter were marked in bold. The products separated on gel were also illustrated in cartoons (MP1-6bp adapter: green; NB adapter: blue; dA-tailed DNA: purple). C). Optimization of end-repair/dA-tailling condition. Lane 1, the input 434bp control fragment; lane 2, manufacturer’s recommended protocol; lane 3. the optimized condition; lane 4. The optimized condition with supplementation of Bst 2.0 WarmStart Polymerase. The expected products with 2-end ligated to an adapter were marked in bold and the products separated on gel were also illustrated in cartoons (434bp dA-tailed DNA: purple; MP1-T adapter: dark green). D). Optimization of AMPure XP bead purification by changing the volume of bead. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to onefold, 0.65-fold, 0.sixfold, 0.55-fold AMPure XP bead purification. The expected products are bands > 500 bp, and it’s marked in bold E). Optimization of AMPure XP bead purification by adjusting the concentration of PEG in wash buffer. 100 ng 50bp ladder and 2 pmole 204bp control fragment were used as input, and subjected to 0.62-fold AMPure XP bead purification using wash buffer containing 10%, 9%, 8.5% and 8% PEG. The expected products are bands > 500 bp, and it’s marked in bold. F). Optimization of tethering condition. Lane 1-5: 1µL BAM adapter with 0-4µL ELB buffer after 3min incubation at 37°C. The expected tethered BAM adapter was marked in bold. The products separated on gel were illustrated in cartoons (BAM adapter: gray; tether: pink-black).

    Article Snippet: Addition of more Bst 2.0 WarmStart DNA Polymerase (NEB, Cat. M0538) did not improve the dA-tailing efficiency ( ).

    Techniques: Ligation, Titration, Purification, Concentration Assay, Incubation