longamp hot start taq 2x master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    LongAmp Hot Start Taq 2X Master Mix
    Description:
    LongAmp Hot Start Taq 2X Master Mix 500 rxns
    Catalog Number:
    m0533l
    Price:
    704
    Category:
    Long distance PCR Kits
    Size:
    500 rxns
    Buy from Supplier


    Structured Review

    New England Biolabs longamp hot start taq 2x master mix
    LongAmp Hot Start Taq 2X Master Mix
    LongAmp Hot Start Taq 2X Master Mix 500 rxns
    https://www.bioz.com/result/longamp hot start taq 2x master mix/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    longamp hot start taq 2x master mix - by Bioz Stars, 2021-03
    93/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Comparative Analysis of the Shared Sex-Determination Region (SDR) among Salmonid Fishes
    Article Snippet: Two nested PCR reactions were performed with sequence-specific forward primers and reverse primers complementary to the adaptor sequence ( ). .. For the first PCR, each reaction contained the following reagents: 1 µl EcoRI library, 1.25 µl forward (CKSDR_F12) and reverse (AP1) primers at 4 nM concentration, 3.25 µl nuclease free H2O, and 6.25 µl LongAmp Hot Start Taq 2 × Master Mix (NEB). ..

    Article Title: HSB-1/HSF-1 pathway modulates histone H4 in mitochondria to control mtDNA transcription and longevity
    Article Snippet: The assay is based on the principle that DNA lesions block or inhibit the progression of DNA polymerases during PCR amplification of a large genomic fragment. .. Briefly, a 9.3-kb fragment of the unc-2 gene was amplified from template DNA of UV-damaged worms using LongAmp Hot Start Taq 2X Master Mix (New England Biolabs), and PCR primers were listed in table S5. .. The PCR product was quantified using the Quant-iT PicoGreen Double-Stranded DNA Assay Kit (Thermo Fisher Scientific).

    Article Title: Klebsiella oxytoca enterotoxins tilimycin and tilivalline have distinct host DNA-damaging and microtubule-stabilizing activities
    Article Snippet: In total, 3.5 ng of gDNA was used for Long Amplicon PCR ( , ). .. PCR was performed in 25-µL reactions containing 1× LongAmp Hot Start Taq2× Master Mix (New England Biolabs), 0.1 µM primer, and nuclease-free water. ..

    Article Title: DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle
    Article Snippet: As described in Supplementary Fig. , the ladder amplicons were synthesized with Alu -targeted sgRNA at the ends using probes to introduce the recognition and primer sites. .. PCR solutions for ladder amplicons contained 400 nM of Ladder-Primer (the same primer is used as forward and reverse), 40 nM of Ladder-Probe, 1 ng of BRCA1 amplicon, and 1× of LongAmp Hot Start Taq 2× Master Mix (New England Biolabs, Woburn, MA) in 20-microl reaction volume. .. Amplification protocol for ladder amplicons was initial denaturation at 95 °C for 30 s, probe annealing, and extension at 50 °C for 5 min, 35 cycles: 94 °C for 30 s, 60 °C for 30 s, and 68 °C for 1 min followed by final extension at 68 °C for 5 min.

    Article Title: Homotypic Dengue Virus Reinfections in Nicaraguan Children
    Article Snippet: Sequencing primers were designed using Primer3 software and an alignment of all whole-genome sequences from Nicaraguan DENV isolates available in GenBank (National Center for Biotechnology Information [NCBI]; 399 sequences). .. Reverse transcription was performed using SuperScript III Reverse Transcriptase (Life Technologies); long-range PCR was performed using the NEB LongAmp Hot Start Taq 2x Master Mix (New England Biolabs) according to the manufacturer's protocol. ..

    Concentration Assay:

    Article Title: Comparative Analysis of the Shared Sex-Determination Region (SDR) among Salmonid Fishes
    Article Snippet: Two nested PCR reactions were performed with sequence-specific forward primers and reverse primers complementary to the adaptor sequence ( ). .. For the first PCR, each reaction contained the following reagents: 1 µl EcoRI library, 1.25 µl forward (CKSDR_F12) and reverse (AP1) primers at 4 nM concentration, 3.25 µl nuclease free H2O, and 6.25 µl LongAmp Hot Start Taq 2 × Master Mix (NEB). ..

    Amplification:

    Article Title: Complete RHD next-generation sequencing: establishment of reference RHD alleles
    Article Snippet: To optimize PCR conditions, different annealing temperatures and primer concentrations were tested to ensure specific amplification from the target gene. .. In a 50-μL reaction, 1× master mix of LongAmp Hot Start Taq 2× Master Mix (New England Biolabs) was used with 200 ng of gDNA template; 1 μM of the forward and reverse primers was used for all amplicons except for RHD amplicon 3, where 0.2 μM of the forward and reverse primers was used. .. The Veriti Thermal Cycler (Applied Biosystems) program was set as follows: denaturation at 95°C for 5 minutes, 30 cycles of 95°C for 30 seconds, annealing for 30 seconds, and extension at 65°C for 10 minutes.

    Article Title: HSB-1/HSF-1 pathway modulates histone H4 in mitochondria to control mtDNA transcription and longevity
    Article Snippet: The assay is based on the principle that DNA lesions block or inhibit the progression of DNA polymerases during PCR amplification of a large genomic fragment. .. Briefly, a 9.3-kb fragment of the unc-2 gene was amplified from template DNA of UV-damaged worms using LongAmp Hot Start Taq 2X Master Mix (New England Biolabs), and PCR primers were listed in table S5. .. The PCR product was quantified using the Quant-iT PicoGreen Double-Stranded DNA Assay Kit (Thermo Fisher Scientific).

    Article Title: Deep sequencing of SMPD1 gene revealed a heterozygous frameshift mutation (p.Ser192Alafs) in a Palestinian infant with Niemann–Pick disease type A: a case report
    Article Snippet: .. The entire SMPD1 gene including the exons and introns (4276 bp) was amplified using LongAmp™ Hot Start Taq 2X Master Mix (New England BioLabs) and the two primers SMPD1-P1F: AGAAGGGTAATCGGGTGTCC and SMPD1-P4R: AGCTCCAGGAAAGGAGAAGG (see Zhang et al . .. These primers were selected among four sets of primers that were previously used to amplify relatively short sequences followed by de novo assembly using Geneious bioinformatics software to obtain the full length of SMPD1 gene [ ].

    Article Title: DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle
    Article Snippet: As described in Supplementary Fig. , the ladder amplicons were synthesized with Alu -targeted sgRNA at the ends using probes to introduce the recognition and primer sites. .. PCR solutions for ladder amplicons contained 400 nM of Ladder-Primer (the same primer is used as forward and reverse), 40 nM of Ladder-Probe, 1 ng of BRCA1 amplicon, and 1× of LongAmp Hot Start Taq 2× Master Mix (New England Biolabs, Woburn, MA) in 20-microl reaction volume. .. Amplification protocol for ladder amplicons was initial denaturation at 95 °C for 30 s, probe annealing, and extension at 50 °C for 5 min, 35 cycles: 94 °C for 30 s, 60 °C for 30 s, and 68 °C for 1 min followed by final extension at 68 °C for 5 min.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs longamp hot start taq 2x master mix
    Longamp Hot Start Taq 2x Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp hot start taq 2x master mix/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    longamp hot start taq 2x master mix - by Bioz Stars, 2021-03
    93/100 stars
      Buy from Supplier

    Image Search Results