phusion dna polymerase  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Phusion High Fidelity DNA Polymerase
    Phusion High Fidelity DNA Polymerase 500 units
    Catalog Number:
    500 units
    Thermostable DNA Polymerases
    Buy from Supplier

    Structured Review

    New England Biolabs phusion dna polymerase
    Phusion High Fidelity DNA Polymerase
    Phusion High Fidelity DNA Polymerase 500 units dna polymerase/product/New England Biolabs
    Average 99 stars, based on 825 article reviews
    Price from $9.99 to $1999.99
    phusion dna polymerase - by Bioz Stars, 2019-08
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer. .. Multiple alignment of the amino acid sequences of the TLR21s was performed using ClustalW2 ( ).

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. PCR products were purified with a PCR purification kit (Qiagen, Germany).

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: Paragraph title: Cloning and purification of LpxB ... The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively.

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: The discovery of ZUFSP as a K63-DUB, making DNA-mediated interactions with RPA and SSBP1, will be instrumental for addressing these important questions. .. ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs). .. For protein purification, all constructs were cloned in the pOPIN-S vector using the In-Fusion® HD cloning system (Takara Clontech).

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: E. coli TOP10 and E. coli XL-1 were used for cloning, following standard recombinant DNA techniques. .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: Paragraph title: Cloning of truncated Hp-TGM constructs ... Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.


    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer. .. Multiple alignment of the amino acid sequences of the TLR21s was performed using ClustalW2 ( ).

    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: See for details of the construct design. .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific). .. In vitro run-off transcription was performed with T7 RNA polymerase at 37°C for 1 to 3 h in reaction mixtures ranging from 50 μl to 5 ml and consisting of 30 mM Na-HEPES pH 8.0, 27 mM MgCl2 , 4 mM NTP mix, 10 mM TCEP, 2 mM spermidine and 0.01% Triton X-100.

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis.

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: PAβN (25 mg/ml in H2 O) was stored at −20°C and used at final concentrations between 5 and 40 µg/ml, as indicated. .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Genomic DNA of E. coli K-12 MG1655 served as a template for PCR amplification of the tolC locus (b3035 ), using primers (tolC_fwd and tolC_rev), additionally introducing flanks homologous to the linearized vector sequence.

    Article Title: One-step generation of conditional and reversible gene knockouts
    Article Snippet: The FLIP cassette including selection marker gene was then transferred to the vector pUC118 (3318, Clontech) using the restriction enzymes SacI (R0156S, NEB) and PstI (R0140S, NEB) and Mighty cloning (6027, Takara). .. Homologous arms around an intron insertion site were amplified by high fidelity Phusion DNA polymerase (M0530S, NEB). .. After PCR product purification, both homologous arms and FLIP cassette-containing vector were mixed with the type II restriction enzyme SapI and T4 DNA ligase (M0202T, NEB).

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: This promoter construct was extended by 2 kb by amplification (5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′) of a more distal 5′ promoter region and cloned into the pGL3 KpnI site and Creb3l1 promoter KpnI cut site. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA). .. DNA containing VP1 or fragments thereof was heat treated for 10 min at 75 °C prior to ligation reaction.

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: An rps3 PCR standard was amplified using primers Hcat_rps3_F (CGAGGGCTACATGGTCAAGA) and Hcat_rps3_R CCTTTGGCTCGATGATGGTG). .. Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ).

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1. .. The primers used were FLC_F (5′GAGTACGGCTAGGCAATAGC3′) and FLC_RW (5′GGCAAGTAGCTATATCTGTAAC3′) whereby FLC stands for “full‐length cDNA”.

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions. .. PCR products were gel purified (28706, Qiagen) and sgRNAs were transcribed using T7 MegaShortScript transcription kits (AM1354, Ambion) and purified using RNeasy Mini kits (74104, Qiagen) according to the manufacturers’ instructions. sgRNA quality was checked by running on a 2% agarose gel, quantified using a Nanodrop spectrophotometer and stored in aliquots at -80°C.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The PCR program comprised an initial denaturation (98 °C/30 s), followed by 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 45 s, with a final extension step of 72 °C for 7 min.

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: This structure should aid in the rational and computational development of new antibiotics targeting LpxB to combat the increasing problem of antibiotic resistance. .. The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. The lpxB coding sequence was inserted into pE-SUMO expression vector (LifeSensors) to attach an N-terminally His-tagged SUMO to the N-terminus of LpxB.

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Briefly, PP were harvested and kept in RNAlater (Sigma‐Aldrich) until processing. .. PP were homogenized using a TissueLyser II (20 Hz, 2 min; Qiagen), and RNA was extracted using RNeasy Mini Kit (Qiagen). cDNA synthesis was performed with iScript Select cDNA Synthesis Kit (Bio‐Rad) using a mix of three primers to enrich in IgA transcripts (Lindner et al , ), and IgA heavy chain was amplified with Phusion High‐Fidelity DNA Polymerase (New England Biolabs). .. IgA amplicons were cloned using TOPO TA Cloning Kit for Sequencing (Invitrogen), and DNA sequencing was performed by Eurofins MWG Operon (Germany).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: Primer pairs were used to systematically truncate one or more domains either from the N-terminus or C-terminus with the resultant nomenclature being TGMΔ1 = TGM with domain 1 truncated; TGM Δ1,2 = TGM with domains 1 and 2 truncated, etc. .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold. .. PCRs were electrophoresed through a 1.2% agarose gel and a single band of each predicted size of insert was gel extracted, cloned into a pSECTag2A vector (Invitrogen) and transformed into JM109 bacterial cells, selecting with Ampicillin (100 µg/ml).

    Stable Transfection:

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs). .. Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies).


    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: Template DNA for Homo sapiens mitochondrial pre-tRNA substrates were synthesized (Integrated DNA Technologies). .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.


    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific). .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific).

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: A series of smaller rat Creb3l1 luciferase reporter constructs were made by restriction enzyme digestion (BamHI, BstEII, SacI, StuI) at sites present in the Creb3l1 promoter, blunted (with exception of StuI) with T4 DNA polymerase and excised from pGL3 with XhoI. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV1 mutants lacking VP1 genes or portions thereof were constructed via LIPCR using EAI283 as template ( ). .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA).

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Custom CRISPR short guide RNAs (sgRNAs) targeting exon 1 oflamc3 were designed using CRISPR Design tool ( to span an endonuclease target site and constructed using the oligonucleotides shown in generated by ZiFiT Targeter ( ). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: Paragraph title: Constructs and cloning ... ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs).

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. E. coli BL21(DE3) (Novagen) was used as the E. coli host for protein expression.

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: Paragraph title: Cloning of truncated Hp-TGM constructs ... Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    Concentration Assay:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States).

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ). .. The 185 bp PCR product was purified by gel extraction (Thermo Scientific GeneJET Gel Extraction kit) and eluted using elution buffer.

    Real-time Polymerase Chain Reaction:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States).

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: Paragraph title: Hyphochytrium catenoides genome qPCR size estimation ... Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ).


    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: Paragraph title: Luciferase Assay ... Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).


    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: Paragraph title: Heterologous expression in Pichia pastoris ... The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB).

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. The PCR products were digested with EcoR I/Pst I and cloned into the pSST91 or the pGAD424 as in-frame fusion to the LexA or GAL4 coding sequence.

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    Transformation Assay:

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ).

    Article Title: One-step generation of conditional and reversible gene knockouts
    Article Snippet: Homologous arms around an intron insertion site were amplified by high fidelity Phusion DNA polymerase (M0530S, NEB). .. After PCR product purification, both homologous arms and FLIP cassette-containing vector were mixed with the type II restriction enzyme SapI and T4 DNA ligase (M0202T, NEB).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. Alternatively for co-expression and purification of two mutants of LpxB, lpxB genes were inserted into pRSF-Duet-1 (Novagen) at the EcoRI (TaKaRa) and HindIII (NEB) sites of MCS1 and at the NdeI (NEB) and KpnI (NEB) sites of MCS2, thus encoding one N-terminally His-tagged protein and one untagged protein.

    Over Expression:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. E. coli BL21(DE3) (Novagen) was used as the E. coli host for protein expression.


    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold. .. PCRs were electrophoresed through a 1.2% agarose gel and a single band of each predicted size of insert was gel extracted, cloned into a pSECTag2A vector (Invitrogen) and transformed into JM109 bacterial cells, selecting with Ampicillin (100 µg/ml).

    DNA Ligation:

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs). .. The complementary DNA products from second-round PCRs were annealed without purification (see Supplementary Table for annealing conditions).

    Southern Blot:

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: Segregants of the T1 generation negative in PCR were propagated to T2 and checked by Southern blot analysis. .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.


    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA). .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA).

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: Paragraph title: PCR and ligation ... Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs).

    Cell Culture:

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ).

    Hemagglutination Assay:

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.


    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. The first round of PCRs were performed using primers (-NBRE2 set 1 5′-TGCAAGCAAACAAGGCAGGTTTACTTTGGGCCCACCACCACCCGGGGCCTG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′ and set 2 5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-CCCAAAGTAAACCTGCCTTGTTTGCTTGCA-3′; -NBRE3 5′-TGCATCCCAGCAAGAGCCTCACTCTTCGCCCAGGTCCCGGACAGACAGAGG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′ and set 2 5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-GGCGAAGAGTGAGGCTCTTGCTGGGATGCA-3′).

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Custom CRISPR short guide RNAs (sgRNAs) targeting exon 1 oflamc3 were designed using CRISPR Design tool ( to span an endonuclease target site and constructed using the oligonucleotides shown in generated by ZiFiT Targeter ( ). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs). .. For protein purification, all constructs were cloned in the pOPIN-S vector using the In-Fusion® HD cloning system (Takara Clontech).


    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.


    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ).

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: This structure should aid in the rational and computational development of new antibiotics targeting LpxB to combat the increasing problem of antibiotic resistance. .. The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. The lpxB coding sequence was inserted into pE-SUMO expression vector (LifeSensors) to attach an N-terminally His-tagged SUMO to the N-terminus of LpxB.

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The bait plasmid pSST91 contains the LexA protein coding sequence under the control of the yeast ADH1 promoter. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ).

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Paragraph title: IgA sequencing and faecal Ig detection ... PP were homogenized using a TissueLyser II (20 Hz, 2 min; Qiagen), and RNA was extracted using RNeasy Mini Kit (Qiagen). cDNA synthesis was performed with iScript Select cDNA Synthesis Kit (Bio‐Rad) using a mix of three primers to enrich in IgA transcripts (Lindner et al , ), and IgA heavy chain was amplified with Phusion High‐Fidelity DNA Polymerase (New England Biolabs).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.


    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions. .. Cas9 mRNA was purified by lithium chloride precipitation and stored in aliquots at -80°C.


    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. The PCR products were digested with EcoR I/Pst I and cloned into the pSST91 or the pGAD424 as in-frame fusion to the LexA or GAL4 coding sequence.

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: E. coli TOP10 and E. coli XL-1 were used for cloning, following standard recombinant DNA techniques. .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB).

    Cellular Antioxidant Activity Assay:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. Barcodes were introduced by a second PCR with platform-specific barcode-bearing primers.

    DNA Sequencing:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB).

    DNA Extraction:

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: The supernatant was removed and genomic DNA was extracted from the remaining cells using a PowerSoil DNA isolation kit (MO BIO Laboratories). .. Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ).

    Molecular Cloning:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: Paragraph title: Molecular cloning of ggTLR21 cDNA ... A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer.

    In Vivo:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. E. coli BL21(DE3) (Novagen) was used as the E. coli host for protein expression.


    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. The site-directed deletions (-NBRE2 and -NBRE3) were ligated into Kpn1 digested 4.9 kb Creb3l1 promoter pGL3 construct.


    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis. .. To generate the HA-TREM2-GFP construct, we PCR amplified HA-TREM2 for insertion upstream of the EGFP coding sequence in pEGFP-N1.

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.


    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA).

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: Total RNA isolated from rice anther was converted into cDNA using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB).


    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: Total RNAs were purified from grouper splenocytes using TRIzol, and first-strand cDNA libraries were then prepared using the SuperScript® III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA), as previously described . .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer.

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Genomic DNA of E. coli K-12 MG1655 served as a template for PCR amplification of the tolC locus (b3035 ), using primers (tolC_fwd and tolC_rev), additionally introducing flanks homologous to the linearized vector sequence.

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA). .. DNA containing VP1 or fragments thereof was heat treated for 10 min at 75 °C prior to ligation reaction.

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ). .. The 185 bp PCR product was purified by gel extraction (Thermo Scientific GeneJET Gel Extraction kit) and eluted using elution buffer.

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: The DR274 plasmid (a gift from Keith Young – Addgene plasmid #42250) was linearised by BsaI (R0535, NEB) digestion according to manufacturer’s instructions and gel purified (28706, Qiagen). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs). .. Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: Paragraph title: Cloning and purification of LpxB ... The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively.

    Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference
    Article Snippet: The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Phusion DNA polymerase (New England Biolabs, Ipswich, MA) using the plasmid, pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA (a gift of Dr. F. Zhang; Addgene plasmid #61594), as template and primers 5′- ATATAACCGGT A TGAAGCGGAACTACATCCTGGGCCT and 5′-ATATTCGGCCG TTA G CCCTTTTTGATGATCTGAGGGT. .. The underlined sequences correspond to Age I and Eag I sites, respectively, and the bolded nucleotide indicates the beginning of the gene specific sequence.

    Polymerase Chain Reaction:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer. .. Multiple alignment of the amino acid sequences of the TLR21s was performed using ClustalW2 ( ).

    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: See for details of the construct design. .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific). .. In vitro run-off transcription was performed with T7 RNA polymerase at 37°C for 1 to 3 h in reaction mixtures ranging from 50 μl to 5 ml and consisting of 30 mM Na-HEPES pH 8.0, 27 mM MgCl2 , 4 mM NTP mix, 10 mM TCEP, 2 mM spermidine and 0.01% Triton X-100.

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis.

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. Products were purified using the AMPure purification kit (Agencourt, Beverly, MA, United States) and after beads purification, the targeted band was checked on a 1.8% agarose gel.

    Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli
    Article Snippet: PAβN (25 mg/ml in H2 O) was stored at −20°C and used at final concentrations between 5 and 40 µg/ml, as indicated. .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Phusion polymerase (NEB) using primers (pIB166_fwd and pIB166_rev), thereby eliminating P23 ( ). .. Genomic DNA of E. coli K-12 MG1655 served as a template for PCR amplification of the tolC locus (b3035 ), using primers (tolC_fwd and tolC_rev), additionally introducing flanks homologous to the linearized vector sequence.

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. The first round of PCRs were performed using primers (-NBRE2 set 1 5′-TGCAAGCAAACAAGGCAGGTTTACTTTGGGCCCACCACCACCCGGGGCCTG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′ and set 2 5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-CCCAAAGTAAACCTGCCTTGTTTGCTTGCA-3′; -NBRE3 5′-TGCATCCCAGCAAGAGCCTCACTCTTCGCCCAGGTCCCGGACAGACAGAGG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′ and set 2 5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-GGCGAAGAGTGAGGCTCTTGCTGGGATGCA-3′).

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA). .. DNA containing VP1 or fragments thereof was heat treated for 10 min at 75 °C prior to ligation reaction.

    Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides
    Article Snippet: An rps3 PCR standard was amplified using primers Hcat_rps3_F (CGAGGGCTACATGGTCAAGA) and Hcat_rps3_R CCTTTGGCTCGATGATGGTG). .. Each 25 µl reaction consisted of 0.5 U Phusion polymerase (New England Biolabs), 1× HF buffer, 400 µM dNTPs, 2 µM each primer and 1 µl H. catenoides genomic DNA (11.6 ng µl−1 ).

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1. .. The primers used were FLC_F (5′GAGTACGGCTAGGCAATAGC3′) and FLC_RW (5′GGCAAGTAGCTATATCTGTAAC3′) whereby FLC stands for “full‐length cDNA”.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: Total RNA isolated from rice anther was converted into cDNA using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The PCR program comprised an initial denaturation (98 °C/30 s), followed by 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 45 s, with a final extension step of 72 °C for 7 min.

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: The primer sequences used in this study were listed in Supplementary Table . .. Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs). .. The PCR conditions are listed in Supplementary Table and Supplementary Table .

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. The PCR products were digested with EcoR I/Pst I and cloned into the pSST91 or the pGAD424 as in-frame fusion to the LexA or GAL4 coding sequence.

    Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference
    Article Snippet: Caveats and potential improvements to the system are discussed in the hope that the broader field of Chlamydia researchers might develop further applications of this approach. .. The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Phusion DNA polymerase (New England Biolabs, Ipswich, MA) using the plasmid, pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA (a gift of Dr. F. Zhang; Addgene plasmid #61594), as template and primers 5′- ATATAACCGGT A TGAAGCGGAACTACATCCTGGGCCT and 5′-ATATTCGGCCG TTA G CCCTTTTTGATGATCTGAGGGT. .. The underlined sequences correspond to Age I and Eag I sites, respectively, and the bolded nucleotide indicates the beginning of the gene specific sequence.

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: DNA restriction enzymes were used as recommended by the manufacturer (New England Biolabs, NEB). .. PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. The gene-specific primers are listed in .

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.


    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    cDNA Library Assay:

    Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses
    Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), following the conditions recommended by the manufacturer. .. Multiple alignment of the amino acid sequences of the TLR21s was performed using ClustalW2 ( ).

    Activated Clotting Time Assay:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Plasmid Preparation:

    Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment
    Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Phusion high-fidelity DNA polymerase system (NEB, Ipswich, MA) for site-directed mutagenesis.

    Article Title: One-step generation of conditional and reversible gene knockouts
    Article Snippet: Paragraph title: Addition of homologous arms to the FLIP cassette – FLIP targeting vector generation ... Homologous arms around an intron insertion site were amplified by high fidelity Phusion DNA polymerase (M0530S, NEB).

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: For luciferase assays, Creb3l1 promoter fragments were cloned into luciferase reporter construct pGL3 basic vector (Promega, Madison, WI, USA). .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA).

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: Southern blot was performed by digesting 10 μg of genomic DNA with EcoR I and using a 32 P‐labelled probe covering the HPT gene of the p6U vector as described previously (Risk et al ., ). .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.

    Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo
    Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Phusion High Fidelity polymerase (M0530, NEB) using the following primers: Fw: 5′-GCTCGATCCGCTCGCACC -3′; Rv: 5′-AAAAGCACCGACTCGGTGCC-3′; according to the manufacturer’s instructions.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB).

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ). .. The PCR products were digested with EcoR I/Pst I and cloned into the pSST91 or the pGAD424 as in-frame fusion to the LexA or GAL4 coding sequence.

    Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference
    Article Snippet: Caveats and potential improvements to the system are discussed in the hope that the broader field of Chlamydia researchers might develop further applications of this approach. .. The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Phusion DNA polymerase (New England Biolabs, Ipswich, MA) using the plasmid, pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA (a gift of Dr. F. Zhang; Addgene plasmid #61594), as template and primers 5′- ATATAACCGGT A TGAAGCGGAACTACATCCTGGGCCT and 5′-ATATTCGGCCG TTA G CCCTTTTTGATGATCTGAGGGT. .. The underlined sequences correspond to Age I and Eag I sites, respectively, and the bolded nucleotide indicates the beginning of the gene specific sequence.

    Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants
    Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs). .. ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Phusion DNA Polymerase (New England Biolabs).

    Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus
    Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Taq polymerase Phusion Hi Fidelity Taq polymerase (New England Biolabs (NEB), USA) under the following conditions: Initial denaturation at 98 °C for 30 s followed by 35 cycles of denaturing at 98 °C for 30 s; annealing at 55–65 °C for 30 s; extension at 72 °C for 30–90 s (depending on truncation size) with a final extension of 72 °C for 10 min and 12 °C hold.

    RNA Extraction:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: Paragraph title: RNA Extraction and 16S rRNA Library Preparation ... The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States).

    Agarose Gel Electrophoresis:

    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States). .. PCR was performed in a 2720 thermal cycler (Applied Biosystems, Waltham, MA, United States) with 25 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 45 s and then a final extension for 7 min at 72°C.

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The PCR program comprised an initial denaturation (98 °C/30 s), followed by 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 45 s, with a final extension step of 72 °C for 7 min.

    Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA
    Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs). .. Unless otherwise stated, 50 μl PCR reactions were performed using Phusion® high-fidelity DNA polymerase (New England Biolabs).

    In Vitro:

    Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1
    Article Snippet: Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). .. The site-directed deletions (-NBRE2 and -NBRE3) were ligated into Kpn1 digested 4.9 kb Creb3l1 promoter pGL3 construct.

    Transgenic Assay:

    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: Paragraph title: Detection of transgenic barley and determination of transgene copy number and full‐length cDNA amplification ... The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.


    Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing
    Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Phusion high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, United States).


    Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria
    Article Snippet: The tRNA constructs were either directly produced by run-off transcription or were joined 5′ of the GlmS ribozyme. .. The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific).

    Activation Assay:

    Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation
    Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, high-fidelity Phusion DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and appropriate primers ( ).

    Alkaline Lysis:

    Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change
    Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA), purified with PCR Purification Kit (Thermo-Fisher, Waltham, MA, USA) and phosphorylated with T4 polynucleotide kinase according to manufacturer’s protocols (Thermo-Fisher, Waltham, MA, USA).


    Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects
    Article Snippet: Total genomic DNA was extracted from leaves using the CTAB method (Stein et al ., ), and presence of Ta ‐Lr34res was assessed using the marker csffr1 (Lagudah et al ., ). .. The 4319 bp amplicon was amplified using the Phusion® High‐Fidelity DNA Polymerase (New Englands BioLabs, Ipswich (MA), USA) and a Touch‐down PCR protocol (1.

    Gel Extraction:

    Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice
    Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Phusion DNA polymerase (New England Biolabs, NEB). .. The PCR program comprised an initial denaturation (98 °C/30 s), followed by 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 45 s, with a final extension step of 72 °C for 7 min.

    Homologous Recombination:

    Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis
    Article Snippet: PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB). .. E. coli BL21(DE3) (Novagen) was used as the E. coli host for protein expression.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    Phusion High Fidelity PCR Master Mix with GC Buffer 500 rxns 50 ul vol
      Buy from Supplier

    New England Biolabs phusion dna polymerase
    Phusion Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 825 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more dna polymerase/product/New England Biolabs
    Average 99 stars, based on 825 article reviews
    Price from $9.99 to $1999.99
    phusion dna polymerase - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    Image Search Results