q5u high fidelity dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    Q5U Hot Start High Fidelity DNA Polymerase
    Description:

    Catalog Number:
    M0515
    Price:
    660
    Category:
    DNA Polymerases
    Applications:
    DNA Analysis
    Size:
    500 units
    Buy from Supplier


    Structured Review

    New England Biolabs q5u high fidelity dna polymerase
    Q5U Hot Start High Fidelity DNA Polymerase

    https://www.bioz.com/result/q5u high fidelity dna polymerase/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    q5u high fidelity dna polymerase - by Bioz Stars, 2021-07
    94/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: A versatile oblique plane microscope for large-scale and high-resolution imaging of subcellular dynamics
    Article Snippet: .. Addgene #98816) was amplified by PCR (M0515, Q5 Hot start, New England Biolabs) to introduce 5’ EcoRI and 3’ XbaI restriction enzyme sites flanking either ends of 3XNLS mScarlet-I sequence ( ; ). .. The entry vector pENTR1A-GFP-N2 (FR1) (a gift from Dr. Eric Campeau and Dr. Paul Kaufman, Addgene #19364) along with the purified PCR fragment was digested with EcoRI and XbaI then ligated together with T4 DNA ligase (M0202, New England Biolabs). pENTR1a-3XNLS-mScarlet-I was then recombined using Gateway LR Clonase II (11791, Invitrogen, Thermo Fisher Scientific) as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau and Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility).

    Article Title: Preparation of E. coli RNA polymerase transcription elongation complexes for systematic RNA assays
    Article Snippet: All DNA templates that required translesion synthesis were assessed by both denaturing and non-denaturing PAGE quality control analyses, which are shown in . .. PCR Amplification DNA templates with dU bases were prepared using Q5U® High-Fidelity DNA Polymerase (NEB) in reactions that contained 1X Q5U® Buffer (NEB), 0.2 mM dNTPs (Invitrogen), 0.25 μM forward primer, 0.25 μM reverse primer, 20 pM template oligonucleotide, and 0.02 U/μl Q5U® . ..

    Polymerase Chain Reaction:

    Article Title: A versatile oblique plane microscope for large-scale and high-resolution imaging of subcellular dynamics
    Article Snippet: .. Addgene #98816) was amplified by PCR (M0515, Q5 Hot start, New England Biolabs) to introduce 5’ EcoRI and 3’ XbaI restriction enzyme sites flanking either ends of 3XNLS mScarlet-I sequence ( ; ). .. The entry vector pENTR1A-GFP-N2 (FR1) (a gift from Dr. Eric Campeau and Dr. Paul Kaufman, Addgene #19364) along with the purified PCR fragment was digested with EcoRI and XbaI then ligated together with T4 DNA ligase (M0202, New England Biolabs). pENTR1a-3XNLS-mScarlet-I was then recombined using Gateway LR Clonase II (11791, Invitrogen, Thermo Fisher Scientific) as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau and Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility).

    Article Title: Preparation of E. coli RNA polymerase transcription elongation complexes by selective photoelution from magnetic beads
    Article Snippet: All DNA templates that required translesion synthesis were assessed by both denaturing and nondenaturing PAGE quality control analyses, which are shown in B and . .. PCR amplificationDNA templates with dU bases were prepared using Q5U High-Fidelity DNA Polymerase (NEB) in reactions that contained 1X Q5U Buffer (NEB), 0.2 mM dNTPs (Invitrogen), 0.25 μM forward primer, 0.25 μM reverse primer, 20 pM template DNA, and 0.02 U/μl Q5U. ..

    Article Title: Preparation of E. coli RNA polymerase transcription elongation complexes for systematic RNA assays
    Article Snippet: All DNA templates that required translesion synthesis were assessed by both denaturing and non-denaturing PAGE quality control analyses, which are shown in . .. PCR Amplification DNA templates with dU bases were prepared using Q5U® High-Fidelity DNA Polymerase (NEB) in reactions that contained 1X Q5U® Buffer (NEB), 0.2 mM dNTPs (Invitrogen), 0.25 μM forward primer, 0.25 μM reverse primer, 20 pM template oligonucleotide, and 0.02 U/μl Q5U® . ..

    Article Title: Linked machine learning classifiers improve species classification of fungi when using error-prone long-reads on extended metabarcodes
    Article Snippet: We used the NS3 (GCAAGTCTGGTGCCAGCAGCC) and LR6 (CGCCAGTTCTGCTTACC) primers [ ] to generate the fungal ribosomal DNA fragment of all samples, and the EF1-983F (GCYCCYGGHCAYCGTGAYTTYAT) and EF1-2218R (ATGACACCRACRGCRACRGTYTG) primers [ ] were used to sequence a secondary region, the fungal elongation factor 1 alpha region, although this region was not used for assessing the machine learning method. .. We used the New England Biolabs Q5 High-Fidelity DNA polymerase (NEB #M0515) for the PCR reaction following the manufacturer’s protocol. .. Around 10 – 30 nanograms of DNA were used in each PCR reaction.

    Introduce:

    Article Title: A versatile oblique plane microscope for large-scale and high-resolution imaging of subcellular dynamics
    Article Snippet: .. Addgene #98816) was amplified by PCR (M0515, Q5 Hot start, New England Biolabs) to introduce 5’ EcoRI and 3’ XbaI restriction enzyme sites flanking either ends of 3XNLS mScarlet-I sequence ( ; ). .. The entry vector pENTR1A-GFP-N2 (FR1) (a gift from Dr. Eric Campeau and Dr. Paul Kaufman, Addgene #19364) along with the purified PCR fragment was digested with EcoRI and XbaI then ligated together with T4 DNA ligase (M0202, New England Biolabs). pENTR1a-3XNLS-mScarlet-I was then recombined using Gateway LR Clonase II (11791, Invitrogen, Thermo Fisher Scientific) as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau and Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility).

    Sequencing:

    Article Title: A versatile oblique plane microscope for large-scale and high-resolution imaging of subcellular dynamics
    Article Snippet: .. Addgene #98816) was amplified by PCR (M0515, Q5 Hot start, New England Biolabs) to introduce 5’ EcoRI and 3’ XbaI restriction enzyme sites flanking either ends of 3XNLS mScarlet-I sequence ( ; ). .. The entry vector pENTR1A-GFP-N2 (FR1) (a gift from Dr. Eric Campeau and Dr. Paul Kaufman, Addgene #19364) along with the purified PCR fragment was digested with EcoRI and XbaI then ligated together with T4 DNA ligase (M0202, New England Biolabs). pENTR1a-3XNLS-mScarlet-I was then recombined using Gateway LR Clonase II (11791, Invitrogen, Thermo Fisher Scientific) as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau and Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility).

    other:

    Article Title: Preparation of E. coli RNA polymerase transcription elongation complexes by selective photoelution from magnetic beads
    Article Snippet: Proteins Q5U High-Fidelity DNA Polymerase, Q5 High-Fidelity DNA Polymerase, Vent (exo-) DNA polymerase, Sulfolobus DNA Polymerase IV, E . coli RNA Polymerase holoenzyme, Thermolabile Proteinase K, Thermolabile USER II Enzyme, Thermolabile Exonuclease I, and RNase If were purchased from New England Biolabs (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs q5u high fidelity dna polymerase
    Q5u High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5u high fidelity dna polymerase/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    q5u high fidelity dna polymerase - by Bioz Stars, 2021-07
    94/100 stars
      Buy from Supplier

    Image Search Results