q5 dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Q5 High Fidelity DNA Polymerase
    Description:
    Q5 High Fidelity DNA Polymerase 500 units
    Catalog Number:
    m0491l
    Price:
    441
    Size:
    500 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs q5 dna polymerase
    Q5 High Fidelity DNA Polymerase
    Q5 High Fidelity DNA Polymerase 500 units
    https://www.bioz.com/result/q5 dna polymerase/product/New England Biolabs
    Average 95 stars, based on 1033 article reviews
    Price from $9.99 to $1999.99
    q5 dna polymerase - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "CRISPR/Cas9 Editing of the Bacillus subtilis Genome"

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome

    Journal: Bio-protocol

    doi: 10.21769/BioProtoc.2272

    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.
    Figure Legend Snippet: PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Mutagenesis, Plasmid Preparation

    2) Product Images from "Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer"

    Article Title: Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer

    Journal: Molecular Oncology

    doi: 10.1002/1878-0261.12305

    Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.
    Figure Legend Snippet: Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Techniques Used: Mutagenesis, Amplification

    3) Product Images from "Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer"

    Article Title: Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer

    Journal: Molecular Oncology

    doi: 10.1002/1878-0261.12305

    Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.
    Figure Legend Snippet: Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Techniques Used: Mutagenesis, Amplification

    4) Product Images from "DNA synthesis from diphosphate substrates by DNA polymerases"

    Article Title: DNA synthesis from diphosphate substrates by DNA polymerases

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1712193115

    Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and Q5 DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).
    Figure Legend Snippet: Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and Q5 DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).

    Techniques Used: Polymerase Chain Reaction, Amplification

    5) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    6) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    7) Product Images from "TT(N)mGCCTC inhibits archaeal family B DNA polymerases"

    Article Title: TT(N)mGCCTC inhibits archaeal family B DNA polymerases

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-20127-4

    Olig2.5 inhibited archaeal family B DNA polymerases. An E. coli DH5α colony harbouring the 2.6 kb upstream sequence of Olig2 in pGL3-Basic vector was cultured and 1 μl of the culture was directly used as template for PCR. Olig2F and OligTSSR were used as primers to amplify the 2 kb fragment. Olig2.5 was added to see its inhibition to various DNAP. DNAP: DNA polymerase. LA: LA Taq DNAP. Q5: Q5 High-Fidelity DNAP. PS: PrimeSTAR HS DNAP. GXL: PrimeSTAR GXL DNAP. Phusion: Phusion High-Fidelity DNAP. Cobuddy: Cobuddy Super Fidelity DNAP. KOD: KOD DNAP.
    Figure Legend Snippet: Olig2.5 inhibited archaeal family B DNA polymerases. An E. coli DH5α colony harbouring the 2.6 kb upstream sequence of Olig2 in pGL3-Basic vector was cultured and 1 μl of the culture was directly used as template for PCR. Olig2F and OligTSSR were used as primers to amplify the 2 kb fragment. Olig2.5 was added to see its inhibition to various DNAP. DNAP: DNA polymerase. LA: LA Taq DNAP. Q5: Q5 High-Fidelity DNAP. PS: PrimeSTAR HS DNAP. GXL: PrimeSTAR GXL DNAP. Phusion: Phusion High-Fidelity DNAP. Cobuddy: Cobuddy Super Fidelity DNAP. KOD: KOD DNAP.

    Techniques Used: Sequencing, Plasmid Preparation, Cell Culture, Polymerase Chain Reaction, Inhibition

    8) Product Images from "Targeted recombination between homologous chromosomes for precise breeding in tomato"

    Article Title: Targeted recombination between homologous chromosomes for precise breeding in tomato

    Journal: Nature Communications

    doi: 10.1038/ncomms15605

    Tomato fruit colour DSB repair assay. ( a ) Crossing yellow flesh e 3756 35S:Cas9 and bicolor cc383 u6-26:Ps#1-sgRNA gives F 1 plants with a pale Bicolour fruit phenotype. F 1 plants expressing both Cas9 and gRNA were selected. The gRNA was designed for DSB induction (black lightning) in both alleles between the yellow flesh e 3756 and bicolor cc383 mutations (*). In case of error-prone NHEJ repair (blue line) of bicolor cc383 , fruit colour is yellow. In cases of non-crossover or crossover, fruit colour is expected to be red or bicolour or yellow with red spots in case of late event. Note that whole red fruits were not obtained. Rather, fruits with red spots in a yellow or bicolour background were found and are shown together with additional products of HR-induced repair in Supplementary Fig. 1 . ( b ) Fruit phenotype distribution in F 1 plants and control: Bicolour fruits are shown as orange boxes; Yellow fruits as yellow; Fruits with red sectors (putative somatic HR) are shown as red-stripped boxes. Each column represents a fruit population derived from cross of independent transgenic lines of Cas9 and a given u6-26:Ps#1-sgRNA line. The number of fruits analysed is shown on the column in black. ( c ) Sequences of the NHEJ DSB repair footprints and their relative frequency are shown. The CRISPR-Cas target sequence from the PSY1 is shown on the top. The PSY1 start codon is shown in red and the PAM in blue. The top pie represents an average of illumina Hiseq reads from 22 different F 1 plants of the cross of yellow flesh e 3756 35S:Cas9 × bicolor cc383 u6-26:Ps#1-sgRNA. The low pie represents an average of ilummina Hiseq reads from two plants of control F 1 population ( yellow flesh e 3756 × bicolor cc383 F 1 plants with no CRISPR-Cas). ( d ) Inverse PCR scheme for identification of recombinant DNA fragments (details in Supplementary Fig. 4 ). (1) DNA from separate leaves was digested with ApaI(A) and HindIII(H) and then blunted. (2) Each sample was self-ligated, and (3) amplified by two different primer sets (green and yellow). Blue- Bicolor ; red- Yellow flesh ; Dashed blue line- Bicolor deletion, *- Yellow flesh mutation. ( e ) Ratio of parental (P) versus recombinant (R) types (obtained from panel C) in individual plants. Plants 1–15- F 1 plants of the cross of yellow flesh e 3756 35S:Cas9 × bicolor cc383 u6-26:Ps#1-sgRNA; Plant 16- synthetic crossover control; Plants17–18-Yellow flesh × Bicolor (Cas9-) F 1 plants.
    Figure Legend Snippet: Tomato fruit colour DSB repair assay. ( a ) Crossing yellow flesh e 3756 35S:Cas9 and bicolor cc383 u6-26:Ps#1-sgRNA gives F 1 plants with a pale Bicolour fruit phenotype. F 1 plants expressing both Cas9 and gRNA were selected. The gRNA was designed for DSB induction (black lightning) in both alleles between the yellow flesh e 3756 and bicolor cc383 mutations (*). In case of error-prone NHEJ repair (blue line) of bicolor cc383 , fruit colour is yellow. In cases of non-crossover or crossover, fruit colour is expected to be red or bicolour or yellow with red spots in case of late event. Note that whole red fruits were not obtained. Rather, fruits with red spots in a yellow or bicolour background were found and are shown together with additional products of HR-induced repair in Supplementary Fig. 1 . ( b ) Fruit phenotype distribution in F 1 plants and control: Bicolour fruits are shown as orange boxes; Yellow fruits as yellow; Fruits with red sectors (putative somatic HR) are shown as red-stripped boxes. Each column represents a fruit population derived from cross of independent transgenic lines of Cas9 and a given u6-26:Ps#1-sgRNA line. The number of fruits analysed is shown on the column in black. ( c ) Sequences of the NHEJ DSB repair footprints and their relative frequency are shown. The CRISPR-Cas target sequence from the PSY1 is shown on the top. The PSY1 start codon is shown in red and the PAM in blue. The top pie represents an average of illumina Hiseq reads from 22 different F 1 plants of the cross of yellow flesh e 3756 35S:Cas9 × bicolor cc383 u6-26:Ps#1-sgRNA. The low pie represents an average of ilummina Hiseq reads from two plants of control F 1 population ( yellow flesh e 3756 × bicolor cc383 F 1 plants with no CRISPR-Cas). ( d ) Inverse PCR scheme for identification of recombinant DNA fragments (details in Supplementary Fig. 4 ). (1) DNA from separate leaves was digested with ApaI(A) and HindIII(H) and then blunted. (2) Each sample was self-ligated, and (3) amplified by two different primer sets (green and yellow). Blue- Bicolor ; red- Yellow flesh ; Dashed blue line- Bicolor deletion, *- Yellow flesh mutation. ( e ) Ratio of parental (P) versus recombinant (R) types (obtained from panel C) in individual plants. Plants 1–15- F 1 plants of the cross of yellow flesh e 3756 35S:Cas9 × bicolor cc383 u6-26:Ps#1-sgRNA; Plant 16- synthetic crossover control; Plants17–18-Yellow flesh × Bicolor (Cas9-) F 1 plants.

    Techniques Used: Expressing, Non-Homologous End Joining, Derivative Assay, Transgenic Assay, CRISPR, Sequencing, Inverse PCR, Recombinant, Amplification, Mutagenesis

    9) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    10) Product Images from "Hydrodynamic Delivery of FGF21 Gene Alleviates Obesity and Fatty Liver in Mice Fed a High-fat Diet"

    Article Title: Hydrodynamic Delivery of FGF21 Gene Alleviates Obesity and Fatty Liver in Mice Fed a High-fat Diet

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    doi: 10.1016/j.jconrel.2014.03.047

    Hydrodynamic tail veil injection of plasmid DNA containing FGF21 gene increased FGF21 mRNA levels in the liver, and generated a sustained protein level of FGF21 in the circulation
    Figure Legend Snippet: Hydrodynamic tail veil injection of plasmid DNA containing FGF21 gene increased FGF21 mRNA levels in the liver, and generated a sustained protein level of FGF21 in the circulation

    Techniques Used: Injection, Plasmid Preparation, Generated

    11) Product Images from "Molecular Epidemiology and Genome Dynamics of New Delhi Metallo-β-Lactamase-Producing Extraintestinal Pathogenic Escherichia coli Strains from India"

    Article Title: Molecular Epidemiology and Genome Dynamics of New Delhi Metallo-β-Lactamase-Producing Extraintestinal Pathogenic Escherichia coli Strains from India

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.01345-16

    Dendrogram based on the phylogenetic analysis of 39 MBL-producing carbapenem-resistant clinical E. coli strains using ERIC-PCR banding analysis by BioNumerics, version 7.5 (Applied Maths, Belgium). Dotted boxes indicate clusters into which the majority of NDM-1 profiles segregated. ND, not determined.
    Figure Legend Snippet: Dendrogram based on the phylogenetic analysis of 39 MBL-producing carbapenem-resistant clinical E. coli strains using ERIC-PCR banding analysis by BioNumerics, version 7.5 (Applied Maths, Belgium). Dotted boxes indicate clusters into which the majority of NDM-1 profiles segregated. ND, not determined.

    Techniques Used: Polymerase Chain Reaction

    12) Product Images from "A nutrient-regulated, dual localization phospholipase A2 in the symbiotic fungus Tuber borchii"

    Article Title: A nutrient-regulated, dual localization phospholipase A2 in the symbiotic fungus Tuber borchii

    Journal: The EMBO Journal

    doi: 10.1093/emboj/20.18.5079

    Fig. 1. TbSP1 identification. ( A ) Equal amounts of SLM-released protein were subjected to SDS–PAGE and stained with Coomassie Blue R-250. Days of in vitro culture (d) and the migration positions of molecular mass markers are indicated at the top and at the left, respectively. The migration position (p23) and the N-terminal sequence (p23/20) of the TbSP1 polypeptide are shown on the right. ( B ) Genomic DNA digested with Eco RI (lane 1), Bam HI (lane 2) or Hin dIII (lane 3) was probed with the TbSP1 cDNA. The migration positions of DNA size markers are indicated on the left. ( C ) Balanced amounts of total RNA extracted from synthetic solid (SSM) or liquid (SLM) mycelial cultures were gel fractionated and probed with the 32 P-labeled TbSP1 cDNA. The migration positions and the amounts of the 28S and 18S rRNAs, utilized as internal references, are shown on the right and in the lower panel, respectively.
    Figure Legend Snippet: Fig. 1. TbSP1 identification. ( A ) Equal amounts of SLM-released protein were subjected to SDS–PAGE and stained with Coomassie Blue R-250. Days of in vitro culture (d) and the migration positions of molecular mass markers are indicated at the top and at the left, respectively. The migration position (p23) and the N-terminal sequence (p23/20) of the TbSP1 polypeptide are shown on the right. ( B ) Genomic DNA digested with Eco RI (lane 1), Bam HI (lane 2) or Hin dIII (lane 3) was probed with the TbSP1 cDNA. The migration positions of DNA size markers are indicated on the left. ( C ) Balanced amounts of total RNA extracted from synthetic solid (SSM) or liquid (SLM) mycelial cultures were gel fractionated and probed with the 32 P-labeled TbSP1 cDNA. The migration positions and the amounts of the 28S and 18S rRNAs, utilized as internal references, are shown on the right and in the lower panel, respectively.

    Techniques Used: SDS Page, Staining, In Vitro, Migration, Sequencing, Labeling

    13) Product Images from "CRISPR/Cas9 Editing of the Bacillus subtilis Genome"

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome

    Journal: Bio-protocol

    doi: 10.21769/BioProtoc.2272

    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.
    Figure Legend Snippet: PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Mutagenesis, Plasmid Preparation

    14) Product Images from "Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer"

    Article Title: Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer

    Journal: Molecular Oncology

    doi: 10.1002/1878-0261.12305

    Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.
    Figure Legend Snippet: Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Techniques Used: Mutagenesis, Amplification

    15) Product Images from "Quartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads"

    Article Title: Quartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads

    Journal: Genome Biology

    doi: 10.1186/s13059-018-1407-3

    Overview of Quartz-Seq2 experimental processes. a Quartz-Seq2 consists of five steps. (1) Each single cell in a droplet is sorted into lysis buffer in each well of a 384-well PCR plate using flow cytometry analysis data. (2) Poly-adenylated RNA in each well is reverse-transcribed into first-strand cDNA with reverse transcription primer, which has a unique cell barcode ( CB ). We prepare 384 or 1536 kinds of cell barcode with a unique sequence based on the Sequence–Levenshtein distance (SeqLv). The edit distance of SeqLv is 5. The RT primer also has a UMI sequence for reduction of PCR bias (MB) and a poly(dT) sequence for binding to poly(A) RNA. (3) Cell barcode-labeled cDNAs from all 384 wells are promptly collected by centrifugation using assembled collectors. (4) Collected first-strand cDNAs are purified and concentrated for subsequent whole-transcript amplification. In the poly(A) tailing step, purified cDNA is extended with a poly(A) tail by terminal deoxynucleotidyl transferase ( TdT ). Subsequently, second-strand cDNA is synthesized with a tagging primer, which has a poly(dT) sequence. The resulting second-strand cDNA has a PCR primer sequence ( M ) at both ends of it. The cDNA is amplifiable in a subsequent PCR amplification. (5) For conversion from amplified cDNA to sequence library DNA, we fragment the amplified cDNA using the ultrasonicator Covaris. Such fragmented cDNA is ligated with a truncated Y-shaped sequence adaptor, which has an Illumina flow-cell binding sequence ( P7 ) and a pool barcode sequence ( PB ). The PB makes it possible to mix different sets of cell barcode-labeled cDNA. Ligated cDNA, which has CB and MB sequences, is enriched by PCR amplification. The resulting sequence library DNA contains P7 and P5 flow-cell binding sequences at respective ends of the DNA. We sequence the cell barcode site and the UMI site at Read1, the pool barcode site at Index1, and the transcript sequence at Read2. b The relationship between initial fastq reads and the number of single cells for sequence analysis in NextSeq500 runs. Typically, one sequence run with NextSeq 500/550 High Output v2 Kit reads out 400–450 M fastq reads. The x-axis represents the input cell number for one sequence run. The y-axis represents the initial data size (fastq reads) on average per cell. The red outline represents the typical range of shallow input read depth for a single cell. c We define the formula for calculating the UMI conversion efficiency. Each parameter is defined as follows: UMI sc is the number of UMI counts, assigned to a single-cell sample, fastq sc is the number of fastq reads derived from each single-cell sample, fastq non-sc is the number of fastq reads derived from non-single-cell samples, which include experimental byproducts such as WTA adaptors, WTA byproducts, and non-STAMPs. Initial fastq reads are composed of fastq sc and fastq non-sc
    Figure Legend Snippet: Overview of Quartz-Seq2 experimental processes. a Quartz-Seq2 consists of five steps. (1) Each single cell in a droplet is sorted into lysis buffer in each well of a 384-well PCR plate using flow cytometry analysis data. (2) Poly-adenylated RNA in each well is reverse-transcribed into first-strand cDNA with reverse transcription primer, which has a unique cell barcode ( CB ). We prepare 384 or 1536 kinds of cell barcode with a unique sequence based on the Sequence–Levenshtein distance (SeqLv). The edit distance of SeqLv is 5. The RT primer also has a UMI sequence for reduction of PCR bias (MB) and a poly(dT) sequence for binding to poly(A) RNA. (3) Cell barcode-labeled cDNAs from all 384 wells are promptly collected by centrifugation using assembled collectors. (4) Collected first-strand cDNAs are purified and concentrated for subsequent whole-transcript amplification. In the poly(A) tailing step, purified cDNA is extended with a poly(A) tail by terminal deoxynucleotidyl transferase ( TdT ). Subsequently, second-strand cDNA is synthesized with a tagging primer, which has a poly(dT) sequence. The resulting second-strand cDNA has a PCR primer sequence ( M ) at both ends of it. The cDNA is amplifiable in a subsequent PCR amplification. (5) For conversion from amplified cDNA to sequence library DNA, we fragment the amplified cDNA using the ultrasonicator Covaris. Such fragmented cDNA is ligated with a truncated Y-shaped sequence adaptor, which has an Illumina flow-cell binding sequence ( P7 ) and a pool barcode sequence ( PB ). The PB makes it possible to mix different sets of cell barcode-labeled cDNA. Ligated cDNA, which has CB and MB sequences, is enriched by PCR amplification. The resulting sequence library DNA contains P7 and P5 flow-cell binding sequences at respective ends of the DNA. We sequence the cell barcode site and the UMI site at Read1, the pool barcode site at Index1, and the transcript sequence at Read2. b The relationship between initial fastq reads and the number of single cells for sequence analysis in NextSeq500 runs. Typically, one sequence run with NextSeq 500/550 High Output v2 Kit reads out 400–450 M fastq reads. The x-axis represents the input cell number for one sequence run. The y-axis represents the initial data size (fastq reads) on average per cell. The red outline represents the typical range of shallow input read depth for a single cell. c We define the formula for calculating the UMI conversion efficiency. Each parameter is defined as follows: UMI sc is the number of UMI counts, assigned to a single-cell sample, fastq sc is the number of fastq reads derived from each single-cell sample, fastq non-sc is the number of fastq reads derived from non-single-cell samples, which include experimental byproducts such as WTA adaptors, WTA byproducts, and non-STAMPs. Initial fastq reads are composed of fastq sc and fastq non-sc

    Techniques Used: Lysis, Polymerase Chain Reaction, Flow Cytometry, Cytometry, Sequencing, Binding Assay, Labeling, Centrifugation, Purification, Amplification, Synthesized, Derivative Assay

    16) Product Images from "Long non-coding RNA urothelial carcinoma associated 1 induces cell replication by inhibiting BRG1 in 5637 cells"

    Article Title: Long non-coding RNA urothelial carcinoma associated 1 induces cell replication by inhibiting BRG1 in 5637 cells

    Journal: Oncology Reports

    doi: 10.3892/or.2014.3309

    UCA1 blocks recruitment of BRG1 to chromatin. (A) UCA1 does not affect the ATPase activity of BRG1. The kinetics of BRG1-induced ATP hydrolysis were analyzed in the presence or absence of UCA1. (B) ChIP analysis of BRG1 binding to the p21 promoter in 5637-iUCA1. 5637-NC cells were used as the control. Genomic DNA was fixed and immunoprecipitated using anti-BRG1 antibody, with IgG as a negative control. Real-time PCR was performed using a primer set specific to the BRG1-binding site of p21 promoter. Data were normalized to input and are expressed as the means ± SD of three independent experiments. * P
    Figure Legend Snippet: UCA1 blocks recruitment of BRG1 to chromatin. (A) UCA1 does not affect the ATPase activity of BRG1. The kinetics of BRG1-induced ATP hydrolysis were analyzed in the presence or absence of UCA1. (B) ChIP analysis of BRG1 binding to the p21 promoter in 5637-iUCA1. 5637-NC cells were used as the control. Genomic DNA was fixed and immunoprecipitated using anti-BRG1 antibody, with IgG as a negative control. Real-time PCR was performed using a primer set specific to the BRG1-binding site of p21 promoter. Data were normalized to input and are expressed as the means ± SD of three independent experiments. * P

    Techniques Used: Activity Assay, Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Negative Control, Real-time Polymerase Chain Reaction

    17) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    18) Product Images from "Mutations in the Non-Structural Protein-Coding Sequence of Protoparvovirus H-1PV Enhance the Fitness of the Virus and Show Key Benefits Regarding the Transduction Efficiency of Derived Vectors"

    Article Title: Mutations in the Non-Structural Protein-Coding Sequence of Protoparvovirus H-1PV Enhance the Fitness of the Virus and Show Key Benefits Regarding the Transduction Efficiency of Derived Vectors

    Journal: Viruses

    doi: 10.3390/v10040150

    Accumulation of viral DNA replicative forms in infected or transfected NB-324k cells with the mutants. ( A ) Accumulation of DNA replicative forms in NB-324k cells infected with wt H-1PV and derived mutants. NB-324K cells (1.6 × 10 6 ) were infected (MOI, 1 PFU/cell) with wt H-1PV, H1-PM-I, -II, -III, and –DM and further incubated in the presence of neutralizing antibodies. At 20 h post-infection, cells were harvested and viral DNA replicative forms were purified from cell lysates, separated by agarose gel electrophoresis, and subjected to Southern blotting. The bands corresponding to single-stranded, monomeric, and dimeric replicative forms of viral DNA are indicated as ssDNA, mRF, and dRF, respectively ( A ); ( B ) DNA replicative forms in NB-324k cells transfected with the plasmids pH1 (wt) or mutant derivatives. NB-324k cells (1 × 10 6 cells) were transfected with 6 µg of pH1, pH1-PM-I, pH1-PM-II, pH1-PM-III, and pH1-DM and further incubated with neutralizing antibodies. Cells were harvested at indicated times post-transfection and viral DNA replicative forms purified from cell lysates were DpnI digested and analyzed by Southern blotting.
    Figure Legend Snippet: Accumulation of viral DNA replicative forms in infected or transfected NB-324k cells with the mutants. ( A ) Accumulation of DNA replicative forms in NB-324k cells infected with wt H-1PV and derived mutants. NB-324K cells (1.6 × 10 6 ) were infected (MOI, 1 PFU/cell) with wt H-1PV, H1-PM-I, -II, -III, and –DM and further incubated in the presence of neutralizing antibodies. At 20 h post-infection, cells were harvested and viral DNA replicative forms were purified from cell lysates, separated by agarose gel electrophoresis, and subjected to Southern blotting. The bands corresponding to single-stranded, monomeric, and dimeric replicative forms of viral DNA are indicated as ssDNA, mRF, and dRF, respectively ( A ); ( B ) DNA replicative forms in NB-324k cells transfected with the plasmids pH1 (wt) or mutant derivatives. NB-324k cells (1 × 10 6 cells) were transfected with 6 µg of pH1, pH1-PM-I, pH1-PM-II, pH1-PM-III, and pH1-DM and further incubated with neutralizing antibodies. Cells were harvested at indicated times post-transfection and viral DNA replicative forms purified from cell lysates were DpnI digested and analyzed by Southern blotting.

    Techniques Used: Infection, Transfection, Derivative Assay, Incubation, Purification, Agarose Gel Electrophoresis, Southern Blot, Mutagenesis

    19) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    20) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    21) Product Images from "Guanine-rich sequences inhibit proofreading DNA polymerases"

    Article Title: Guanine-rich sequences inhibit proofreading DNA polymerases

    Journal: Scientific Reports

    doi: 10.1038/srep28769

    Engineered proofreading DNA polymerases have good performance. ( A ) Testing various DNA polymerases for the amplification of a 1 kb fragment with 70% GC-content. ( B ) Testing different DNA polymerases for the amplification of an 18 kb fragment from λ DNA. ( C ) Amplification of the ORF of insulin-like growth factor I receptor (Igf1r) from mouse cDNA. The 3′ untranslated region of Igf1r is longer than 7 kb. ( D ) Amplification of the entire LCas9 plasmid. The 10.9 kb LCas9 plasmid contains a high GC-rich region. Pfu: Pfu DNA polymerase. LATaq: LA Taq Version 2.0. TransHF: TransTaq DNA polymerase High Fidelity. Phusion: Phusion High-Fidelity DNA polymerase. Q5: Q5 High-Fidelity DNA polymerase. Cobuddy: Cobuddy Super Fidelity DNA polymerase. PSGXL: PrimeSTAR GXL DNA polymerase. PfuFly: TransStart FastPfu Fly DNA polymerase. Enh: 0–10 μl of GC enhancer was added into the 25 μl PCR reagent.
    Figure Legend Snippet: Engineered proofreading DNA polymerases have good performance. ( A ) Testing various DNA polymerases for the amplification of a 1 kb fragment with 70% GC-content. ( B ) Testing different DNA polymerases for the amplification of an 18 kb fragment from λ DNA. ( C ) Amplification of the ORF of insulin-like growth factor I receptor (Igf1r) from mouse cDNA. The 3′ untranslated region of Igf1r is longer than 7 kb. ( D ) Amplification of the entire LCas9 plasmid. The 10.9 kb LCas9 plasmid contains a high GC-rich region. Pfu: Pfu DNA polymerase. LATaq: LA Taq Version 2.0. TransHF: TransTaq DNA polymerase High Fidelity. Phusion: Phusion High-Fidelity DNA polymerase. Q5: Q5 High-Fidelity DNA polymerase. Cobuddy: Cobuddy Super Fidelity DNA polymerase. PSGXL: PrimeSTAR GXL DNA polymerase. PfuFly: TransStart FastPfu Fly DNA polymerase. Enh: 0–10 μl of GC enhancer was added into the 25 μl PCR reagent.

    Techniques Used: Amplification, Plasmid Preparation, Polymerase Chain Reaction

    22) Product Images from "Development of a novel selection/counter-selection system for chromosomal gene integrations and deletions in lactic acid bacteria"

    Article Title: Development of a novel selection/counter-selection system for chromosomal gene integrations and deletions in lactic acid bacteria

    Journal: BMC Molecular Biology

    doi: 10.1186/s12867-019-0127-x

    Gene inactivation and integration via homologous recombination into the genome of L. plantarum 423 at the aap adhesion gene locus to create L. plantarum 423 aap ::FRT erm and L. plantarum 423 aap ::frt_um (um-unmarked). a Homologous recombination between the wild-type (WT) L. plantarum 423 chromosome and the aap::FRT erm cassette and selection of unmarked aap double-crossover mutants. Boxed regions show the upstream and downstream regions of homology (~ 0.9 kb) on the WT L. plantarum 423 chromosome and plasmid pNZKIaap::FRTerm knock-in (KI) vector. Cells harboring the aap KI vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by PCR using the primer combinations indicated in purple. b PCR amplification of WT L. plantarum 423 and aap insertion mutants using the primer pair indicated in panel A. Additionally, the Em resistance marker was recycled via excision by FLP recombinase. (m) Lambda DNA digested with Pst I (NEB). Amplicons from one WT, two aap ::FRT erm insertion mutant and two aap ::unmarked colonies are shown. c MRS agar plates showing the effectiveness of the repA asRNA induction of FLP recombinase-bearing plasmid loss in the absence of nisin (no nisin induction) and in the presence of nisin (nisin induction). Colonies that have lost the repA -bearing plasmid were isolated via replica plating
    Figure Legend Snippet: Gene inactivation and integration via homologous recombination into the genome of L. plantarum 423 at the aap adhesion gene locus to create L. plantarum 423 aap ::FRT erm and L. plantarum 423 aap ::frt_um (um-unmarked). a Homologous recombination between the wild-type (WT) L. plantarum 423 chromosome and the aap::FRT erm cassette and selection of unmarked aap double-crossover mutants. Boxed regions show the upstream and downstream regions of homology (~ 0.9 kb) on the WT L. plantarum 423 chromosome and plasmid pNZKIaap::FRTerm knock-in (KI) vector. Cells harboring the aap KI vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by PCR using the primer combinations indicated in purple. b PCR amplification of WT L. plantarum 423 and aap insertion mutants using the primer pair indicated in panel A. Additionally, the Em resistance marker was recycled via excision by FLP recombinase. (m) Lambda DNA digested with Pst I (NEB). Amplicons from one WT, two aap ::FRT erm insertion mutant and two aap ::unmarked colonies are shown. c MRS agar plates showing the effectiveness of the repA asRNA induction of FLP recombinase-bearing plasmid loss in the absence of nisin (no nisin induction) and in the presence of nisin (nisin induction). Colonies that have lost the repA -bearing plasmid were isolated via replica plating

    Techniques Used: Homologous Recombination, Selection, Plasmid Preparation, Knock-In, Expressing, Polymerase Chain Reaction, Amplification, Marker, Lambda DNA Preparation, Mutagenesis, Isolation

    Gene deletion and integration via homologous recombination into the genome of E. mundtii ST4SA at the munA bacteriocin gene locus to create E. mundtii ST4SA munA :: cat - ffluc. a Homologous recombination between the wild-type (WT) E. mundtii ST4SA munA -carrying megaplasmid and the munA::catffluc cassette. Boxed regions show the upstream (~ 0.9 kb) and downstream regions (~ 0.6) of homology on the megaplasmid and the pNZKOmunACatFfluc knockout (KO) vector. Cells harboring the munA KO vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing erm and mazF genes. Double crossover mutants were selected and screened by PCR using the indicated primer combinations. b PCR amplification of WT and munA deletion and insertion mutants using the primer pair indicated in panel ( a ). Primer pairs are shown in purple. (m) Lambda DNA digested with Pst I (NEB). Amplicons from four munA mutant and two WT colonies, respectively, are shown
    Figure Legend Snippet: Gene deletion and integration via homologous recombination into the genome of E. mundtii ST4SA at the munA bacteriocin gene locus to create E. mundtii ST4SA munA :: cat - ffluc. a Homologous recombination between the wild-type (WT) E. mundtii ST4SA munA -carrying megaplasmid and the munA::catffluc cassette. Boxed regions show the upstream (~ 0.9 kb) and downstream regions (~ 0.6) of homology on the megaplasmid and the pNZKOmunACatFfluc knockout (KO) vector. Cells harboring the munA KO vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing erm and mazF genes. Double crossover mutants were selected and screened by PCR using the indicated primer combinations. b PCR amplification of WT and munA deletion and insertion mutants using the primer pair indicated in panel ( a ). Primer pairs are shown in purple. (m) Lambda DNA digested with Pst I (NEB). Amplicons from four munA mutant and two WT colonies, respectively, are shown

    Techniques Used: Homologous Recombination, Knock-Out, Plasmid Preparation, Expressing, Polymerase Chain Reaction, Amplification, Lambda DNA Preparation, Mutagenesis

    Gene deletion and integration via homologous recombination into the genome of E. mundtii ST4SA at the srtA locus to create E. mundtii ST4SA srtA ::FRT erm , and E. mundtii ST4SA sortase A aggregation substance (AS) cell clumping assay. a Schematic representing the wild-type (WT) E. mundtii ST4SA srtA gene locus and the recombinant srtA deletion and FRT- erm integration site. Boxed regions show the upstream and downstream regions of homology (~ 1 kb) on the WT chromosome and the recombinant srtA ::FRT erm locus. Cells harboring the srtA knockout vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by PCR using the primer combinations shown in purple. b PCR amplification of WT and srtA deletion and insertion mutants using the primer pair indicated in panel A. (m) Lambda DNA digested with Pst I (NEB). Amplicons from one WT and two srtA ::FRT erm insertion mutant colonies are shown. c MRS broth with the WT strain containing SrtA AS. d MRS broth containing the E. mundtii ST4SA srtA ::FRT erm deletion mutant strain lacking SrtA AS. e MRS broth with E. mundtii ST4SA srtC ::FRT erm deletion mutant strain containing SrtA AS
    Figure Legend Snippet: Gene deletion and integration via homologous recombination into the genome of E. mundtii ST4SA at the srtA locus to create E. mundtii ST4SA srtA ::FRT erm , and E. mundtii ST4SA sortase A aggregation substance (AS) cell clumping assay. a Schematic representing the wild-type (WT) E. mundtii ST4SA srtA gene locus and the recombinant srtA deletion and FRT- erm integration site. Boxed regions show the upstream and downstream regions of homology (~ 1 kb) on the WT chromosome and the recombinant srtA ::FRT erm locus. Cells harboring the srtA knockout vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by PCR using the primer combinations shown in purple. b PCR amplification of WT and srtA deletion and insertion mutants using the primer pair indicated in panel A. (m) Lambda DNA digested with Pst I (NEB). Amplicons from one WT and two srtA ::FRT erm insertion mutant colonies are shown. c MRS broth with the WT strain containing SrtA AS. d MRS broth containing the E. mundtii ST4SA srtA ::FRT erm deletion mutant strain lacking SrtA AS. e MRS broth with E. mundtii ST4SA srtC ::FRT erm deletion mutant strain containing SrtA AS

    Techniques Used: Homologous Recombination, Recombinant, Knock-Out, Plasmid Preparation, Expressing, Polymerase Chain Reaction, Amplification, Lambda DNA Preparation, Mutagenesis

    23) Product Images from "TT(N)mGCCTC inhibits archaeal family B DNA polymerases"

    Article Title: TT(N)mGCCTC inhibits archaeal family B DNA polymerases

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-20127-4

    Olig2.5 inhibited archaeal family B DNA polymerases. An E. coli DH5α colony harbouring the 2.6 kb upstream sequence of Olig2 in pGL3-Basic vector was cultured and 1 μl of the culture was directly used as template for PCR. Olig2F and OligTSSR were used as primers to amplify the 2 kb fragment. Olig2.5 was added to see its inhibition to various DNAP. DNAP: DNA polymerase. LA: LA Taq DNAP. Q5: Q5 High-Fidelity DNAP. PS: PrimeSTAR HS DNAP. GXL: PrimeSTAR GXL DNAP. Phusion: Phusion High-Fidelity DNAP. Cobuddy: Cobuddy Super Fidelity DNAP. KOD: KOD DNAP.
    Figure Legend Snippet: Olig2.5 inhibited archaeal family B DNA polymerases. An E. coli DH5α colony harbouring the 2.6 kb upstream sequence of Olig2 in pGL3-Basic vector was cultured and 1 μl of the culture was directly used as template for PCR. Olig2F and OligTSSR were used as primers to amplify the 2 kb fragment. Olig2.5 was added to see its inhibition to various DNAP. DNAP: DNA polymerase. LA: LA Taq DNAP. Q5: Q5 High-Fidelity DNAP. PS: PrimeSTAR HS DNAP. GXL: PrimeSTAR GXL DNAP. Phusion: Phusion High-Fidelity DNAP. Cobuddy: Cobuddy Super Fidelity DNAP. KOD: KOD DNAP.

    Techniques Used: Sequencing, Plasmid Preparation, Cell Culture, Polymerase Chain Reaction, Inhibition

    24) Product Images from "Long non-coding RNA urothelial carcinoma associated 1 induces cell replication by inhibiting BRG1 in 5637 cells"

    Article Title: Long non-coding RNA urothelial carcinoma associated 1 induces cell replication by inhibiting BRG1 in 5637 cells

    Journal: Oncology Reports

    doi: 10.3892/or.2014.3309

    UCA1 blocks recruitment of BRG1 to chromatin. (A) UCA1 does not affect the ATPase activity of BRG1. The kinetics of BRG1-induced ATP hydrolysis were analyzed in the presence or absence of UCA1. (B) ChIP analysis of BRG1 binding to the p21 promoter in 5637-iUCA1. 5637-NC cells were used as the control. Genomic DNA was fixed and immunoprecipitated using anti-BRG1 antibody, with IgG as a negative control. Real-time PCR was performed using a primer set specific to the BRG1-binding site of p21 promoter. Data were normalized to input and are expressed as the means ± SD of three independent experiments. * P
    Figure Legend Snippet: UCA1 blocks recruitment of BRG1 to chromatin. (A) UCA1 does not affect the ATPase activity of BRG1. The kinetics of BRG1-induced ATP hydrolysis were analyzed in the presence or absence of UCA1. (B) ChIP analysis of BRG1 binding to the p21 promoter in 5637-iUCA1. 5637-NC cells were used as the control. Genomic DNA was fixed and immunoprecipitated using anti-BRG1 antibody, with IgG as a negative control. Real-time PCR was performed using a primer set specific to the BRG1-binding site of p21 promoter. Data were normalized to input and are expressed as the means ± SD of three independent experiments. * P

    Techniques Used: Activity Assay, Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Negative Control, Real-time Polymerase Chain Reaction

    25) Product Images from "CRISPR/Cas9 Editing of the Bacillus subtilis Genome"

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome

    Journal: Bio-protocol

    doi: 10.21769/BioProtoc.2272

    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.
    Figure Legend Snippet: PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Mutagenesis, Plasmid Preparation

    Related Articles

    Clone Assay:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones. ..

    Article Title: Characterizing the effect of expression of an acetyl-CoA synthetase insensitive to acetylation on co-utilization of glucose and acetate in batch and continuous cultures of E. coli W
    Article Snippet: The acs gene coding for acetyl-CoA synthetase was PCR amplified from genomic DNA of E. coli W using Q5 High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) and primers FS2_acs_fw and FS3_acs_rev (Table ). .. To introduce the L641P mutation into acs and to add the fusion sites (FS) required for GoldenMOCS cloning, two PCR reactions amplified acs until position 641 using primers acs_fw and ACS_L641P_rev.

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: The amplification product was digested with EcoRI and SalI and cloned in these same sites of plasmid pGEX-6P-1 (GE Healthcare) and pWS93 ( ADH1 promoter, 2-micron, URA3 marker) . .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3.

    Article Title: N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence
    Article Snippet: To generate deletion mutants, 1 kb fragments of the 5’ and 3’ flanks of the gene of interest (goi ) ORF were generated by PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) or Q5 High-Fidelity DNA polymerase (New England Biolabs) and U . maydis FB1 genomic DNA, using the primers goi KO5-1 and goi KO5-2 (containing a Sfi I restriction site) to amplify the 5’ flank and goi KO3-1 (containing a Sfi I restriction site) and goi KO3-2 to amplify the 3’ flank ( ). .. Constructs were cloned into pGEM-T easy (Promega) or pJET1.2/blunt (ThermoFisher Scientific) plasmids and amplified by PCR using the primers goi KO5-1/goi KO3-2, prior to their transformation in U . maydis .

    Amplification:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: .. A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center. .. Mapping ChRO-seq and leChRO-seq sequencing reads.

    Article Title: Reversible Conformational Conversion of α-Synuclein into Toxic Assemblies by Glucosylceramide
    Article Snippet: .. Genomic regions of iPSCs were amplified using Q5 High Fidelity DNA polymerase (New England Biolabs) by the following PCR protocol: 98°C for 30 s, 35 cycles of (98°C for 30 s, 70°C for 30 s, 72°C for 2 minutes) and 72°C for 10 minutes. ..

    Article Title: Characterizing the effect of expression of an acetyl-CoA synthetase insensitive to acetylation on co-utilization of glucose and acetate in batch and continuous cultures of E. coli W
    Article Snippet: .. The acs gene coding for acetyl-CoA synthetase was PCR amplified from genomic DNA of E. coli W using Q5 High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) and primers FS2_acs_fw and FS3_acs_rev (Table ). ..

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: The amplification product was digested with EcoRI and SalI and cloned in these same sites of plasmid pGEX-6P-1 (GE Healthcare) and pWS93 ( ADH1 promoter, 2-micron, URA3 marker) . .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3.

    Article Title: Probing the quality control mechanism of the Escherichia coli twin-arginine translocase with folding variants of a de novo–designed heme protein
    Article Snippet: .. The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). .. All plasmids were sequence verified by automated DNA sequencing (GATC Biotech).

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: .. The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions. .. FAM-, NED-, VIC-fluorescence-labelled versions of the universal primer were synthetized by Thermo Fisher Scientific.

    Article Title: N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence
    Article Snippet: To generate deletion mutants, 1 kb fragments of the 5’ and 3’ flanks of the gene of interest (goi ) ORF were generated by PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) or Q5 High-Fidelity DNA polymerase (New England Biolabs) and U . maydis FB1 genomic DNA, using the primers goi KO5-1 and goi KO5-2 (containing a Sfi I restriction site) to amplify the 5’ flank and goi KO3-1 (containing a Sfi I restriction site) and goi KO3-2 to amplify the 3’ flank ( ). .. Constructs were cloned into pGEM-T easy (Promega) or pJET1.2/blunt (ThermoFisher Scientific) plasmids and amplified by PCR using the primers goi KO5-1/goi KO3-2, prior to their transformation in U . maydis .

    Article Title: Modulation of CrbS-Dependent Activation of the Acetate Switch in Vibrio cholerae
    Article Snippet: .. To test whether CrbR regulates acs transcription by binding directly to the promoter of acs (Pacs ), regions of the acs promoter were amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into pRS415, and the CrbR gene was amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into the pACYC184 vector, according to methods described previously ( ). .. The plasmids were cotransformed in E. coli TOP10 cells (NEB).

    Positive Control:

    Article Title: Examination and Reconstruction of Three Ancient Endogenous Parvovirus Capsid Protein Gene Remnants Found in Rodent Genomes
    Article Snippet: Primers that recognized the EVE sequence were used to perform PCR (5′-AATGTATTGGTCGTATGCTTCGTCGTG-3′ and 5′-CCCAACTTGGTCCGAAATC-3′), with a total of 100 μg of DNA and 35 cycles of PCR with Q5 High Fidelity DNA polymerase (NEB). .. Primers that recognized a conserved region in retinol binding protein 3 (IRBP) were used as a positive control for PCR (5′-TCTCAGCTTCTGGAGGTC-3′ and 5′-CTGCTGGCCCAGATACAGAG-3′).

    Synthesized:

    Article Title: Engineer chimeric Cas9 to expand PAM recognition based on evolutionary information
    Article Snippet: Restriction endonuclease, polynucleotide kinase (PNK), T4 DNA ligase, and Q5 High-Fidelity DNA Polymerase were purchased from New England Biolabs. .. Oligonucleotides were synthesized by Ruibiotech.

    Construct:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: Generation of the Insm1 floxed allele for conditional ablation The Insm1 targeting construct was generated using a genomic BAC clone, 439G2, from the mouse 129/SvEv genomic BAC library, RPCI-22. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: Plasmid pGEX-AtHal3 expressing the wild type AtHal3 ORF was constructed by amplification of the AtHal3a cDNA from plasmid pRS699-AtHal3a with oligonucleotides AtHal3_EcoRI_5 and AtHal3_SalI_3. .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3.

    Article Title: Probing the quality control mechanism of the Escherichia coli twin-arginine translocase with folding variants of a de novo–designed heme protein
    Article Snippet: .. The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). .. All plasmids were sequence verified by automated DNA sequencing (GATC Biotech).

    Article Title: N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence
    Article Snippet: To generate deletion mutants, 1 kb fragments of the 5’ and 3’ flanks of the gene of interest (goi ) ORF were generated by PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) or Q5 High-Fidelity DNA polymerase (New England Biolabs) and U . maydis FB1 genomic DNA, using the primers goi KO5-1 and goi KO5-2 (containing a Sfi I restriction site) to amplify the 5’ flank and goi KO3-1 (containing a Sfi I restriction site) and goi KO3-2 to amplify the 3’ flank ( ). .. Constructs were cloned into pGEM-T easy (Promega) or pJET1.2/blunt (ThermoFisher Scientific) plasmids and amplified by PCR using the primers goi KO5-1/goi KO3-2, prior to their transformation in U . maydis .

    Incubation:

    Article Title: Modulation of CrbS-Dependent Activation of the Acetate Switch in Vibrio cholerae
    Article Snippet: To test whether CrbR regulates acs transcription by binding directly to the promoter of acs (Pacs ), regions of the acs promoter were amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into pRS415, and the CrbR gene was amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into the pACYC184 vector, according to methods described previously ( ). .. In preparation for these assays, E. coli was first streaked for single colonies onto LB medium with the appropriate antibiotics (chloramphenicol at 5 μg/ml and/or ampicillin at 100 μg/ml) and incubated at 37°C overnight for inoculation into cultures grown overnight.

    Activity Assay:

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: E . coli strain BW369, which carries a single-point temperature-sensitive mutation in the coaBC gene ( dfp -707ts ) that abolishes PPCDC activity at 37 °C has been previously described – . .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3.

    Article Title: Modulation of CrbS-Dependent Activation of the Acetate Switch in Vibrio cholerae
    Article Snippet: Paragraph title: CrbR activity assay in E. coli . ... To test whether CrbR regulates acs transcription by binding directly to the promoter of acs (Pacs ), regions of the acs promoter were amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into pRS415, and the CrbR gene was amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into the pACYC184 vector, according to methods described previously ( ).

    Infection:

    Article Title: Noda-Like RNA Viruses Infecting Caenorhabditis Nematodes: Sympatry, Diversity, and Reassortment
    Article Snippet: RNAs of a subset of infected Caenorhabditis wild isolates were extracted using TRIzol-chloroform. .. Reverse transcription was followed by PCR amplifications using the Q5 high-fidelity DNA polymerase (New England Biolabs) with primers amplifying two overlapping fragments per RNA segment.

    Expressing:

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: Plasmid pGEX-AtHal3 expressing the wild type AtHal3 ORF was constructed by amplification of the AtHal3a cDNA from plasmid pRS699-AtHal3a with oligonucleotides AtHal3_EcoRI_5 and AtHal3_SalI_3. .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3.

    Article Title: Probing the quality control mechanism of the Escherichia coli twin-arginine translocase with folding variants of a de novo–designed heme protein
    Article Snippet: Synthetic genes encoding maquette protein variants codon optimized for expression in E. coli were purchased from DNA2.0 (now ATUM) or Integrated DNA Technologies. .. The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs).

    Article Title: Efficient Incorporation of Unnatural Amino Acids into Proteins with a Robust Cell-Free System
    Article Snippet: .. Preparation of p PaFRS The nucleotide sequence of p PaFRS refers to pPRMjRS-1 [ ] Plasmid pEVOL-pAzF [ ] (pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid #31186; http://n2t.net/addgene:31186 ; RRID: Addgene_31186)) Plasmid pET24a (Novagen, Shanghai, China; Cat. no.: 69749-3) Primers P1f, P1r, P2f, P2r, P3f and P3r (See ) Q5® High-Fidelity DNA Polymerases (New England Biolabs, Beijing, China; Cat. no.: M0491) E. coli strain expressing the p PaFRS gene: BL21(DE3) competent cells (Biomed; Cat. no.: BC201) Kanamycin (Solarbio; Cat. no.: K8020) Tryptone (OXIOD; Cat. no.: LP0042) Yeast extract (OXIOD; Cat. no.: LP0021) BactoTM agar (Becton. .. Dickinson; Cat. no.: 7291815) NaCl (Sinopharm Chemical Reagent; Cat. no.: 10019318) Isopropyl-b-D-thiogalactoside (Solarbio; Cat. no.: I8070) EzFast Ni HP) columns (5 mL) (BestChrom, Shanghai, China; Cat. no.: EA005) Ethanol (TONG GUANG FINE CHEMICALS; Cat. no.: 32061) Imidazole (Sigma-Aldrich; Cat. no.: I2399) Quick Start Bradford Protein Assay Kit (Bio-Rad, Hercules, CA, USA; Cat. No.: 5000201) PBS buffer (Solarbio; Cat. no.: P1010)

    Article Title: Modulation of CrbS-Dependent Activation of the Acetate Switch in Vibrio cholerae
    Article Snippet: To test whether CrbR regulates acs transcription by binding directly to the promoter of acs (Pacs ), regions of the acs promoter were amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into pRS415, and the CrbR gene was amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into the pACYC184 vector, according to methods described previously ( ). .. CrbR-dependent expression of the acs promoter was demonstrated with β-galactosidase assays.

    Touchdown PCR:

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: .. The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions. .. FAM-, NED-, VIC-fluorescence-labelled versions of the universal primer were synthetized by Thermo Fisher Scientific.

    Modification:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The recombined clone, IA1-pL253 was further modified using recombineering to add a LoxP recombination site immediately downstream of the 5’UTR but before the Kozak sequence. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Transformation Assay:

    Article Title: N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence
    Article Snippet: To generate deletion mutants, 1 kb fragments of the 5’ and 3’ flanks of the gene of interest (goi ) ORF were generated by PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) or Q5 High-Fidelity DNA polymerase (New England Biolabs) and U . maydis FB1 genomic DNA, using the primers goi KO5-1 and goi KO5-2 (containing a Sfi I restriction site) to amplify the 5’ flank and goi KO3-1 (containing a Sfi I restriction site) and goi KO3-2 to amplify the 3’ flank ( ). .. Constructs were cloned into pGEM-T easy (Promega) or pJET1.2/blunt (ThermoFisher Scientific) plasmids and amplified by PCR using the primers goi KO5-1/goi KO3-2, prior to their transformation in U . maydis .

    Electroporation:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Ligation:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: RNA was removed from beads by Trizol and followed by the 3’ adapter ligation (NEB # M0204L). .. A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center.

    Introduce:

    Article Title: Characterizing the effect of expression of an acetyl-CoA synthetase insensitive to acetylation on co-utilization of glucose and acetate in batch and continuous cultures of E. coli W
    Article Snippet: The acs gene coding for acetyl-CoA synthetase was PCR amplified from genomic DNA of E. coli W using Q5 High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) and primers FS2_acs_fw and FS3_acs_rev (Table ). .. To introduce the L641P mutation into acs and to add the fusion sites (FS) required for GoldenMOCS cloning, two PCR reactions amplified acs until position 641 using primers acs_fw and ACS_L641P_rev.

    Generated:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: Generation of the Insm1 floxed allele for conditional ablation The Insm1 targeting construct was generated using a genomic BAC clone, 439G2, from the mouse 129/SvEv genomic BAC library, RPCI-22. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3. .. In a first reaction, using pGEX-ScHal3 as template, two overlapping fragments were generated using the pairs of oligonuclotides 5HAL3_EcoRI/ScHal3 L403N 3′ and ScHal3 L403N 5′/3HAL3_XhoI.

    Article Title: Probing the quality control mechanism of the Escherichia coli twin-arginine translocase with folding variants of a de novo–designed heme protein
    Article Snippet: Point mutations were generated using the QuikChange II Site-directed Mutagenesis Kit (Agilent). .. The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs).

    Article Title: N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence
    Article Snippet: .. To generate deletion mutants, 1 kb fragments of the 5’ and 3’ flanks of the gene of interest (goi ) ORF were generated by PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) or Q5 High-Fidelity DNA polymerase (New England Biolabs) and U . maydis FB1 genomic DNA, using the primers goi KO5-1 and goi KO5-2 (containing a Sfi I restriction site) to amplify the 5’ flank and goi KO3-1 (containing a Sfi I restriction site) and goi KO3-2 to amplify the 3’ flank ( ). ..

    other:

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: The 50-µL reaction mix comprised 1 µL template cDNA, 5 × Q5 reaction buffer, 10 mM dNTPs, 10 µM forward primer, 10 µM reverse primer, Q5 high-fidelity DNA polymerase 0.02 U/µL, and 5 × Q5 high GC enhancer.

    DNA Sequencing:

    Article Title: Probing the quality control mechanism of the Escherichia coli twin-arginine translocase with folding variants of a de novo–designed heme protein
    Article Snippet: The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). .. The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones. ..

    Article Title: Reversible Conformational Conversion of α-Synuclein into Toxic Assemblies by Glucosylceramide
    Article Snippet: .. Genomic regions of iPSCs were amplified using Q5 High Fidelity DNA polymerase (New England Biolabs) by the following PCR protocol: 98°C for 30 s, 35 cycles of (98°C for 30 s, 70°C for 30 s, 72°C for 2 minutes) and 72°C for 10 minutes. ..

    Article Title: Characterizing the effect of expression of an acetyl-CoA synthetase insensitive to acetylation on co-utilization of glucose and acetate in batch and continuous cultures of E. coli W
    Article Snippet: .. The acs gene coding for acetyl-CoA synthetase was PCR amplified from genomic DNA of E. coli W using Q5 High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) and primers FS2_acs_fw and FS3_acs_rev (Table ). ..

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3. .. In contrast, pGEX-ScHal3L403N was made by 2-step PCR.

    Article Title: Noda-Like RNA Viruses Infecting Caenorhabditis Nematodes: Sympatry, Diversity, and Reassortment
    Article Snippet: .. Reverse transcription was followed by PCR amplifications using the Q5 high-fidelity DNA polymerase (New England Biolabs) with primers amplifying two overlapping fragments per RNA segment. ..

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: .. The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions. .. FAM-, NED-, VIC-fluorescence-labelled versions of the universal primer were synthetized by Thermo Fisher Scientific.

    Article Title: N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence
    Article Snippet: .. To generate deletion mutants, 1 kb fragments of the 5’ and 3’ flanks of the gene of interest (goi ) ORF were generated by PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) or Q5 High-Fidelity DNA polymerase (New England Biolabs) and U . maydis FB1 genomic DNA, using the primers goi KO5-1 and goi KO5-2 (containing a Sfi I restriction site) to amplify the 5’ flank and goi KO3-1 (containing a Sfi I restriction site) and goi KO3-2 to amplify the 3’ flank ( ). ..

    Article Title: Examination and Reconstruction of Three Ancient Endogenous Parvovirus Capsid Protein Gene Remnants Found in Rodent Genomes
    Article Snippet: .. Primers that recognized the EVE sequence were used to perform PCR (5′-AATGTATTGGTCGTATGCTTCGTCGTG-3′ and 5′-CCCAACTTGGTCCGAAATC-3′), with a total of 100 μg of DNA and 35 cycles of PCR with Q5 High Fidelity DNA polymerase (NEB). .. Primers that recognized a conserved region in retinol binding protein 3 (IRBP) were used as a positive control for PCR (5′-TCTCAGCTTCTGGAGGTC-3′ and 5′-CTGCTGGCCCAGATACAGAG-3′).

    Recombinant:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones. ..

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: Restriction reactions, DNA ligations, and other standard recombinant DNA techniques, including bacterial and yeast transformations were performed using standard methods. .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3.

    Cleavage Assay:

    Article Title: Reversible Conformational Conversion of α-Synuclein into Toxic Assemblies by Glucosylceramide
    Article Snippet: Genomic regions of iPSCs were amplified using Q5 High Fidelity DNA polymerase (New England Biolabs) by the following PCR protocol: 98°C for 30 s, 35 cycles of (98°C for 30 s, 70°C for 30 s, 72°C for 2 minutes) and 72°C for 10 minutes. .. For the T7EI cleavage assay, the PCR amplicons were denatured and hybridized in a thermal cycler: 95°C for 10 minutes, 95-85°C (ramp rate −2°C/sec), and 85-25°C (ramp rate −0.2°C/sec).

    DNA Extraction:

    Article Title: Examination and Reconstruction of Three Ancient Endogenous Parvovirus Capsid Protein Gene Remnants Found in Rodent Genomes
    Article Snippet: DNA was extracted from tissues using a Tissue DNA extraction kit (Omega Bio-tek). .. Primers that recognized the EVE sequence were used to perform PCR (5′-AATGTATTGGTCGTATGCTTCGTCGTG-3′ and 5′-CCCAACTTGGTCCGAAATC-3′), with a total of 100 μg of DNA and 35 cycles of PCR with Q5 High Fidelity DNA polymerase (NEB).

    BAC Assay:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: Generation of the Insm1 floxed allele for conditional ablation The Insm1 targeting construct was generated using a genomic BAC clone, 439G2, from the mouse 129/SvEv genomic BAC library, RPCI-22. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Mutagenesis:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Characterizing the effect of expression of an acetyl-CoA synthetase insensitive to acetylation on co-utilization of glucose and acetate in batch and continuous cultures of E. coli W
    Article Snippet: The acs gene coding for acetyl-CoA synthetase was PCR amplified from genomic DNA of E. coli W using Q5 High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) and primers FS2_acs_fw and FS3_acs_rev (Table ). .. To introduce the L641P mutation into acs and to add the fusion sites (FS) required for GoldenMOCS cloning, two PCR reactions amplified acs until position 641 using primers acs_fw and ACS_L641P_rev.

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3. .. Plasmid pGEX-AtHal3G115N L117E was made similarly from pGEX-AtHal3L117E using oligonucleotides AtHal3_G115N_L117E_5 and AtHal3_G115N_L117E_3. pGEX-ScHal3L405E was also made by the QuickChange method from pGEX-ScHal3 and oligonucleotides ScHal3_L405E_5 and ScHal3_L405E_3.

    Article Title: Probing the quality control mechanism of the Escherichia coli twin-arginine translocase with folding variants of a de novo–designed heme protein
    Article Snippet: Point mutations were generated using the QuikChange II Site-directed Mutagenesis Kit (Agilent). .. The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs).

    Isolation:

    Article Title: The odd one out: Arabidopsis reticulon 20 does not bend ER membranes but has a role in lipid regulation
    Article Snippet: RNA was isolated using TRIzol® (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. The resulting cDNA was probed with primers for full-length products of RTN20 and RTN6, respectively using Q5® High-Fidelity DNA Polymerase (New England Biolabs).

    Article Title: N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence
    Article Snippet: To generate deletion mutants, 1 kb fragments of the 5’ and 3’ flanks of the gene of interest (goi ) ORF were generated by PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) or Q5 High-Fidelity DNA polymerase (New England Biolabs) and U . maydis FB1 genomic DNA, using the primers goi KO5-1 and goi KO5-2 (containing a Sfi I restriction site) to amplify the 5’ flank and goi KO3-1 (containing a Sfi I restriction site) and goi KO3-2 to amplify the 3’ flank ( ). .. To generate SG200 2xRFPΔpdi1 used for filament quantification into the maize plant, pGEM-TΔpdi1 :cbx plasmid was digested with Sfi I to excise the carboxin resistance cassette and ligated to a hygromicin resistance cassette isolated from pMF1h [ ] with Sfi I/Bsa I double digestion, leading to pGEM-TΔpdi1 :hyg .

    Labeling:

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions. .. The amplified fragments from the subgenome A, B and D homoeologs of the gene X group (or of the gene Y group) were respectively labeled with the FAM, NED and VIC fluorescent dyes in a second PCR reaction using 0.5 µM of a labeled universal primer together with the appropriate homoeolog-specific reverse primer and 1 µL of first reaction PCR product.

    Purification:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: The 5’ end was phosphorylated using PNK (NEB # M0201L) followed by a purification with Trizol (Life Technologies # 15596–026). .. A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center.

    Sequencing:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: Paragraph title: Chromatin Run-On and sequencing (ChRO-seq) library preparation. ... A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center.

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Characterizing the effect of expression of an acetyl-CoA synthetase insensitive to acetylation on co-utilization of glucose and acetate in batch and continuous cultures of E. coli W
    Article Snippet: The acs gene coding for acetyl-CoA synthetase was PCR amplified from genomic DNA of E. coli W using Q5 High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) and primers FS2_acs_fw and FS3_acs_rev (Table ). .. In a second PCR reaction, FS sites and the rest of the coding sequence was added using primers FS2_acs_fw and FS3_acs_L641P_rev.

    Article Title: Probing the quality control mechanism of the Escherichia coli twin-arginine translocase with folding variants of a de novo–designed heme protein
    Article Snippet: The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). .. The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs).

    Article Title: Noda-Like RNA Viruses Infecting Caenorhabditis Nematodes: Sympatry, Diversity, and Reassortment
    Article Snippet: Paragraph title: Sequencing of viral variant genomes. ... Reverse transcription was followed by PCR amplifications using the Q5 high-fidelity DNA polymerase (New England Biolabs) with primers amplifying two overlapping fragments per RNA segment.

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: The universal primer sequence CAGTCGGGCGTCATCACAC was added at the 5′ end of each forward primer sequence. .. The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions.

    Article Title: Efficient Incorporation of Unnatural Amino Acids into Proteins with a Robust Cell-Free System
    Article Snippet: .. Preparation of p PaFRS The nucleotide sequence of p PaFRS refers to pPRMjRS-1 [ ] Plasmid pEVOL-pAzF [ ] (pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid #31186; http://n2t.net/addgene:31186 ; RRID: Addgene_31186)) Plasmid pET24a (Novagen, Shanghai, China; Cat. no.: 69749-3) Primers P1f, P1r, P2f, P2r, P3f and P3r (See ) Q5® High-Fidelity DNA Polymerases (New England Biolabs, Beijing, China; Cat. no.: M0491) E. coli strain expressing the p PaFRS gene: BL21(DE3) competent cells (Biomed; Cat. no.: BC201) Kanamycin (Solarbio; Cat. no.: K8020) Tryptone (OXIOD; Cat. no.: LP0042) Yeast extract (OXIOD; Cat. no.: LP0021) BactoTM agar (Becton. .. Dickinson; Cat. no.: 7291815) NaCl (Sinopharm Chemical Reagent; Cat. no.: 10019318) Isopropyl-b-D-thiogalactoside (Solarbio; Cat. no.: I8070) EzFast Ni HP) columns (5 mL) (BestChrom, Shanghai, China; Cat. no.: EA005) Ethanol (TONG GUANG FINE CHEMICALS; Cat. no.: 32061) Imidazole (Sigma-Aldrich; Cat. no.: I2399) Quick Start Bradford Protein Assay Kit (Bio-Rad, Hercules, CA, USA; Cat. No.: 5000201) PBS buffer (Solarbio; Cat. no.: P1010)

    Article Title: Examination and Reconstruction of Three Ancient Endogenous Parvovirus Capsid Protein Gene Remnants Found in Rodent Genomes
    Article Snippet: .. Primers that recognized the EVE sequence were used to perform PCR (5′-AATGTATTGGTCGTATGCTTCGTCGTG-3′ and 5′-CCCAACTTGGTCCGAAATC-3′), with a total of 100 μg of DNA and 35 cycles of PCR with Q5 High Fidelity DNA polymerase (NEB). .. Primers that recognized a conserved region in retinol binding protein 3 (IRBP) were used as a positive control for PCR (5′-TCTCAGCTTCTGGAGGTC-3′ and 5′-CTGCTGGCCCAGATACAGAG-3′).

    Bradford Protein Assay:

    Article Title: Efficient Incorporation of Unnatural Amino Acids into Proteins with a Robust Cell-Free System
    Article Snippet: Preparation of p PaFRS The nucleotide sequence of p PaFRS refers to pPRMjRS-1 [ ] Plasmid pEVOL-pAzF [ ] (pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid #31186; http://n2t.net/addgene:31186 ; RRID: Addgene_31186)) Plasmid pET24a (Novagen, Shanghai, China; Cat. no.: 69749-3) Primers P1f, P1r, P2f, P2r, P3f and P3r (See ) Q5® High-Fidelity DNA Polymerases (New England Biolabs, Beijing, China; Cat. no.: M0491) E. coli strain expressing the p PaFRS gene: BL21(DE3) competent cells (Biomed; Cat. no.: BC201) Kanamycin (Solarbio; Cat. no.: K8020) Tryptone (OXIOD; Cat. no.: LP0042) Yeast extract (OXIOD; Cat. no.: LP0021) BactoTM agar (Becton. .. Dickinson; Cat. no.: 7291815) NaCl (Sinopharm Chemical Reagent; Cat. no.: 10019318) Isopropyl-b-D-thiogalactoside (Solarbio; Cat. no.: I8070) EzFast Ni HP) columns (5 mL) (BestChrom, Shanghai, China; Cat. no.: EA005) Ethanol (TONG GUANG FINE CHEMICALS; Cat. no.: 32061) Imidazole (Sigma-Aldrich; Cat. no.: I2399) Quick Start Bradford Protein Assay Kit (Bio-Rad, Hercules, CA, USA; Cat. No.: 5000201) PBS buffer (Solarbio; Cat. no.: P1010)

    Plasmid Preparation:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: Characterizing the effect of expression of an acetyl-CoA synthetase insensitive to acetylation on co-utilization of glucose and acetate in batch and continuous cultures of E. coli W
    Article Snippet: Paragraph title: Plasmid and strain construction ... The acs gene coding for acetyl-CoA synthetase was PCR amplified from genomic DNA of E. coli W using Q5 High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) and primers FS2_acs_fw and FS3_acs_rev (Table ).

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3. .. Plasmid pGEX-AtHal3G115N L117E was made similarly from pGEX-AtHal3L117E using oligonucleotides AtHal3_G115N_L117E_5 and AtHal3_G115N_L117E_3. pGEX-ScHal3L405E was also made by the QuickChange method from pGEX-ScHal3 and oligonucleotides ScHal3_L405E_5 and ScHal3_L405E_3.

    Article Title: N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence
    Article Snippet: To generate deletion mutants, 1 kb fragments of the 5’ and 3’ flanks of the gene of interest (goi ) ORF were generated by PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) or Q5 High-Fidelity DNA polymerase (New England Biolabs) and U . maydis FB1 genomic DNA, using the primers goi KO5-1 and goi KO5-2 (containing a Sfi I restriction site) to amplify the 5’ flank and goi KO3-1 (containing a Sfi I restriction site) and goi KO3-2 to amplify the 3’ flank ( ). .. To generate SG200 2xRFPΔpdi1 used for filament quantification into the maize plant, pGEM-TΔpdi1 :cbx plasmid was digested with Sfi I to excise the carboxin resistance cassette and ligated to a hygromicin resistance cassette isolated from pMF1h [ ] with Sfi I/Bsa I double digestion, leading to pGEM-TΔpdi1 :hyg .

    Article Title: Efficient Incorporation of Unnatural Amino Acids into Proteins with a Robust Cell-Free System
    Article Snippet: .. Preparation of p PaFRS The nucleotide sequence of p PaFRS refers to pPRMjRS-1 [ ] Plasmid pEVOL-pAzF [ ] (pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid #31186; http://n2t.net/addgene:31186 ; RRID: Addgene_31186)) Plasmid pET24a (Novagen, Shanghai, China; Cat. no.: 69749-3) Primers P1f, P1r, P2f, P2r, P3f and P3r (See ) Q5® High-Fidelity DNA Polymerases (New England Biolabs, Beijing, China; Cat. no.: M0491) E. coli strain expressing the p PaFRS gene: BL21(DE3) competent cells (Biomed; Cat. no.: BC201) Kanamycin (Solarbio; Cat. no.: K8020) Tryptone (OXIOD; Cat. no.: LP0042) Yeast extract (OXIOD; Cat. no.: LP0021) BactoTM agar (Becton. .. Dickinson; Cat. no.: 7291815) NaCl (Sinopharm Chemical Reagent; Cat. no.: 10019318) Isopropyl-b-D-thiogalactoside (Solarbio; Cat. no.: I8070) EzFast Ni HP) columns (5 mL) (BestChrom, Shanghai, China; Cat. no.: EA005) Ethanol (TONG GUANG FINE CHEMICALS; Cat. no.: 32061) Imidazole (Sigma-Aldrich; Cat. no.: I2399) Quick Start Bradford Protein Assay Kit (Bio-Rad, Hercules, CA, USA; Cat. No.: 5000201) PBS buffer (Solarbio; Cat. no.: P1010)

    Article Title: Modulation of CrbS-Dependent Activation of the Acetate Switch in Vibrio cholerae
    Article Snippet: .. To test whether CrbR regulates acs transcription by binding directly to the promoter of acs (Pacs ), regions of the acs promoter were amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into pRS415, and the CrbR gene was amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into the pACYC184 vector, according to methods described previously ( ). .. The plasmids were cotransformed in E. coli TOP10 cells (NEB).

    Binding Assay:

    Article Title: Chromatin run-on and sequencing maps the transcriptional regulatory landscape of glioblastoma multiforme
    Article Snippet: .. A third bead binding was then followed by a reverse transcription reaction to generate cDNA (Life Technologies # 18080–044). cDNA was then amplified (NEB # M0491L) to generate the ChRO-seq libraries which were prepared based on manufacturer’s’ protocol (Illumina) and sequenced using Illumina NextSeq500 at the Cornell University Biotechnology Resource Center. .. Mapping ChRO-seq and leChRO-seq sequencing reads.

    Article Title: Modulation of CrbS-Dependent Activation of the Acetate Switch in Vibrio cholerae
    Article Snippet: .. To test whether CrbR regulates acs transcription by binding directly to the promoter of acs (Pacs ), regions of the acs promoter were amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into pRS415, and the CrbR gene was amplified with Q5 high-fidelity DNA polymerase (NEB) and ligated into the pACYC184 vector, according to methods described previously ( ). .. The plasmids were cotransformed in E. coli TOP10 cells (NEB).

    Article Title: Examination and Reconstruction of Three Ancient Endogenous Parvovirus Capsid Protein Gene Remnants Found in Rodent Genomes
    Article Snippet: Primers that recognized the EVE sequence were used to perform PCR (5′-AATGTATTGGTCGTATGCTTCGTCGTG-3′ and 5′-CCCAACTTGGTCCGAAATC-3′), with a total of 100 μg of DNA and 35 cycles of PCR with Q5 High Fidelity DNA polymerase (NEB). .. Primers that recognized a conserved region in retinol binding protein 3 (IRBP) were used as a positive control for PCR (5′-TCTCAGCTTCTGGAGGTC-3′ and 5′-CTGCTGGCCCAGATACAGAG-3′).

    Transgenic Assay:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: The completed targeting vector was sequence verified and sent to the Northwestern Transgenic and Targeted Mutagenesis Laboratory (Chicago, IL) for electroporation into SvEv 129 mouse embryonic stem cells. .. Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones.

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: Paragraph title: Genotyping of transgenic wheat to identify editing events in TaNFXL1 homoeologous genes ... The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions.

    E. coli Genomic Assay:

    Article Title: Probing the quality control mechanism of the Escherichia coli twin-arginine translocase with folding variants of a de novo–designed heme protein
    Article Snippet: .. The TorA Tat signal peptide was amplified from E. coli genomic DNA and joined in-frame to maquette constructs by overlap extension-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). .. All plasmids were sequence verified by automated DNA sequencing (GATC Biotech).

    Marker:

    Article Title: Mutations at the hydrophobic core affect Hal3 trimer stability, reducing its Ppz1 inhibitory capacity but not its PPCDC moonlighting function
    Article Snippet: The amplification product was digested with EcoRI and SalI and cloned in these same sites of plasmid pGEX-6P-1 (GE Healthcare) and pWS93 ( ADH1 promoter, 2-micron, URA3 marker) . .. Plasmid pGEX-AtHal3L117E was created using the pGEX-AtHal3 plasmid as template by the QuickChange Site-Directed Mutagenesis Kit (Stratagene), with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and oligonucleotides AtHal3_L117E_5, and AtHal3_L117E_3.

    Variant Assay:

    Article Title: Noda-Like RNA Viruses Infecting Caenorhabditis Nematodes: Sympatry, Diversity, and Reassortment
    Article Snippet: Paragraph title: Sequencing of viral variant genomes. ... Reverse transcription was followed by PCR amplifications using the Q5 high-fidelity DNA polymerase (New England Biolabs) with primers amplifying two overlapping fragments per RNA segment.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs q5 dna polymerase
    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for <t>Q5</t> DNA polymerase; the other three control amplicons are no larger than 3.4 kb.
    Q5 Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 718 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 dna polymerase/product/New England Biolabs
    Average 95 stars, based on 718 article reviews
    Price from $9.99 to $1999.99
    q5 dna polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Journal: Bio-protocol

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome

    doi: 10.21769/BioProtoc.2272

    Figure Lengend Snippet: PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Article Snippet: The PCR program used to linearize pPB41 is: PCR amplify CRISPR/Cas9 using plasmid generated in step B1 ( ) Amplify plasmid generated in step B1 (pPB43 in the example) via PCR using Q5 DNA polymerase (NEB) and primers oPEB232 and oPEB234.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Mutagenesis, Plasmid Preparation

    Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Journal: Molecular Oncology

    Article Title: Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer

    doi: 10.1002/1878-0261.12305

    Figure Lengend Snippet: Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Article Snippet: To increase the sensitivity of the analysis, the remaining 75 μL serum DNA was subjected to 12 cycles of PCR pre‐amplification with Q5 High‐Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA) using a multiplex PIK3CA primer mix.

    Techniques: Mutagenesis, Amplification

    Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and Q5 DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: DNA synthesis from diphosphate substrates by DNA polymerases

    doi: 10.1073/pnas.1712193115

    Figure Lengend Snippet: Deoxynucleoside diphosphate utilization by DNA polymerases. ( A ) A standard PCR with a monophosphate substrate is inhibited, whereas the presence of all four di- or triphosphate nucleotides supports DNA amplification. Thermophilic polymerases Taq, Vent (exo−), and Pfu , as well as B , Deep Vent, and Q5 DNA polymerases, also utilize the diphosphorylated substrates. ( C and D ) Primer-extension reactions on short templates sampled at indicated time points. All reactions were performed with 100 µM dNDPs at 60 °C, except the Bsu reactions, which were performed at 37 °C. Extended sequences are shown alongside of gels and were distinct in C and D . Primer band is indicated with “–P.” Pausing appears mainly before incorporation of dA and dC and is variable among the polymerases. ( E ).

    Article Snippet: Taq DNA polymerase, Phusion High-Fidelity DNA polymerase, DeepVent DNA polymerase, Vent DNA polymerase, Q5 DNA High-Fidelity polymerase, Bst polymerase, Bsu DNA polymerase (large fragment), and ThermoPol Reaction Buffer [1×: 20 mM Tris⋅HCl, 10 mM (NH4 )2 SO4 , 10 mM KCl, 2 mM MgSO4 , 0.1% Triton–X–100, pH 8.8 at 25 °C] were purchased from New England Biolabs.

    Techniques: Polymerase Chain Reaction, Amplification