gc buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Phusion GC Buffer Pack
    Description:
    Phusion GC Buffer Pack 6 0 ml
    Catalog Number:
    B0519S
    Price:
    24
    Size:
    6 0 ml
    Category:
    Buffers
    Score:
    85
    Buy from Supplier
    Name:
    Phusion High Fidelity PCR Master Mix with GC Buffer
    Description:
    Phusion High Fidelity PCR Master Mix with GC Buffer 500 rxns 50 ul vol
    Catalog Number:
    M0532L
    Price:
    722
    Size:
    500 rxns
    Category:
    Thermostable DNA Polymerases
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs gc buffer
    Phusion High Fidelity PCR Master Mix with GC Buffer
    Phusion High Fidelity PCR Master Mix with GC Buffer 500 rxns 50 ul vol
    https://www.bioz.com/result/gc buffer/product/New England Biolabs
    Average 99 stars, based on 86 article reviews
    Price from $9.99 to $1999.99
    gc buffer - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE. .. The resulting PCR products were pooled and purified using the MinElute PCR Purification Kit (Qiagen).

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: E. coli ET12567/pUZ8002 was used as the host for intergeneric conjugations . pUWL201PWT, which is a derivative of pUWL201PW containing an oriT sequence that was cloned into its Pst I site, was used as the shuttle vector for gene complementations, biotransformation, and heterologous production of PtmU4 in Streptomyces . .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB).

    Article Title: Cell culture-adaptive mutations in hepatitis C virus promote viral production by enhancing viral replication and release
    Article Snippet: The pJFH1 plasmid was used as a template for subsequent PCR with Phushion High-Fidelity PCR Master Mix with GC buffer (New England Biolabs) according to the manufacturer’s instructions. .. The above fragments (mE2, mp7, mNS4B, mNS5A, mE2/NS5A, mp7/NS5A, mNS4B/NS5A, and mE2/p7/NS5A) were sub-cloned into pJFH1 using the appropriate unique restriction enzyme sites such as Bsi w I, Kpn I, Nsi I, Rsr II, or Bsr G I, to produce JFH1-mE2, JFH1-mp7, JFH1-mNS4B, JFH1-mNS5A, JFH1-mE2/ NS5A, JFH1-mp7/NS5A, JFH1-mNS4B/NS5A, JFH1-mE2/p7/ NS5A, and also mJFH1, which contained all the six mutations.

    Amplification:

    Article Title: Seasonal changes in diet and chemical defense in the Climbing Mantella frog (Mantella laevigata)
    Article Snippet: CO1 was amplified using the general arthropod primers LCO-1490 (5’- GGTCAACAAATCATAAAGATATTGG) and HCO-2198 (5’-TAAACTTCAGGGTGACCAAAAATCA) from Folmer et al. [ ]. .. For all reactions, we used 2 μL of each primer (10 μM) and 25 μL of 2X Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) in a total reaction volume of 50 μL.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: After performing a genomic DNA wipe-out, cDNA was generated from mRNA and polysome-associated RNA using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We used 20 ng pDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We used a dual barcoding strategy where a unique combination of forward and reverse index primers were assigned to each biological sample. .. We performed the PCRs with Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 13 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. The manufacturer reports an error rate of 9.5 × 10−7 for Phusion High-Fidelity PCR Master Mix in GC Buffer.

    Article Title: Flexibility In Vitro of Amino Acid 226 in the Receptor-Binding Site of an H9 Subtype Influenza A Virus and Its Effect In Vivo on Virus Replication, Tropism, and Transmission
    Article Snippet: The 50-μl PCR mixture contained 10 ng of each PCR product, 25 μl of the PCR master mix, 50 pmol/μl of each primer, and 1.5 μl of dimethyl sulfoxide. .. PCR amplification was done using a Phusion high-fidelity PCR master mix with GC buffer (New England Biolabs, Ipswich, MA) under the following cycling parameters: 98°C for 30 s; 98°C for 8 s, 56°C for 1 min, and 72°C for 3 min for 30 cycles; and 72°C for 10 min ( ). .. Independent virus rescue experiments were performed with the nnn226 H9PCR and equi226 H9PCR amplicon libraries, as previously described ( , ).

    Article Title: Identification of polymorphic SVA retrotransposons using a mobile element scanning method for SVA (ME-Scan-SVA)
    Article Snippet: However, for 7 loci (5 polymorphic, 2 de novo) no specific internal/external amplification was achieved. .. The PCRs were performed using One Taq hot start DNA polymerase with GC buffer (cat. no. M0481, New England Biolabs, Ipswich, MA, USA).

    Article Title: The characteristics analysis of intestinal microecology on cerebral infarction patients and its correlation with apolipoprotein E
    Article Snippet: The samples were diluted to 1 ng/μL with sterile water. .. The genomic DNA was diluted and used as a template and specific primers with a barcode were used for PCR amplification using Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) and efficient and high-fidelity enzymes. .. The 16S and V4 primers (515F and 806R) were used to evaluate bacterial diversity, 18S and V4 primers (528F and 706R) were used to determine the diversity of eukaryotic microorganisms, and ITS1 primers (ITS5-1737F and ITS2-2043R) were used to examine fungal diversity and the 16S V3-V4/16S V4-V5 region, archaeal 16S V4 region, and 18S V9 and ITS2 regions.

    Article Title: Analysis of intestinal microbial communities of cerebral infarction and ischemia patients based on high throughput sequencing technology and glucose and lipid metabolism
    Article Snippet: Paragraph title: Polymerase chain reaction (PCR) amplification and Illumina sequencing ... The sequences were forward, 5′-GTGCCAGCMGCCGCGGTAA-3′ and reverse, 5′-GGACTACHVGGGTWTCTAAT-3′, and the reaction was performed using Phusion High-Fidelity PCR master mix with GC buffer (New England Biolabs, Inc., Ipswich, MA, USA).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Contaminating gDNA was eliminated from isolated RNA using the Turbo DNA-free kit (ThermoFisher Scientific) and cDNA was generated using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min). .. We used 50 ng gDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Illumina sequencing adaptors and unique barcode combinations were appended to the HDR-enriched DNA by PCR. .. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 12 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We purified, quantified and sequencing the resulting amplicon libraries as described above.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: To achieve maximum coverage of single and double nucleotide variants, 91% of the complementary base and 3% of each non-complementary base were incorporate at each position in the MRE libraries. .. Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE. .. The resulting PCR products were pooled and purified using the MinElute PCR Purification Kit (Qiagen).

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: Finally, the raw volume of the correctly processed peak was divided by the sum of the raw volume of all peaks to estimate the processing efficiency. .. The region surrounding the PDL1 cut site from our guide was first amplified from the extracted gDNA using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primers (forward: TGCTTTTGAATCCTGCACAA, reverse: CCATTGCTAGCCCTTAATCC) in a 30 μl total reaction with 1 μl gDNA. .. Following amplification, products were purified using Agencourt AMPure XP beads as per the manufacturer’s instructions with 1.8× sample volumes of beads and a 25 μl final elution volume.

    Article Title: Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model
    Article Snippet: DNA was used as template to amplify the 16S V3-V4 region using specific primers with Barcode. .. The efficient hi-fi PCR enzyme and the Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs) were added to insure the amplification efficiency and accuracy. .. The production of PCR was verified by electrophoresis in 1.5% agarose gel, and then recycled by gel extraction kit (qiagen).

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: The 50 µl PCR reaction mixture contained 10 ng of each PCR product, 25 µl of Master PCR mix, 1.5 µl 100% DMSO, and 50 pmol/µl of each primer. .. PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA). .. Alternative HA PCR products without t1 signal sequence or lacking both pol1 and t1 elements were generated to serve as controls for PCR-based reverse genetics ( and ).

    Mass Spectrometry:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We nucleofected 1 × 105 HEK-293T cells with the sgRNA expression plasmid (500 ng) and the pooled HDR donors (0.2 μL, 100 μM stock) using the Neon transfection system (ThermoFisher Scientific) in a 10 μL tip (1150 V, 20 ms, 2 pulses). .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min).

    Molecular Cloning:

    Article Title: The MalR type regulator AcrC is a transcriptional repressor of acarbose biosynthetic genes in Actinoplanes sp. SE50/110
    Article Snippet: Actinoplanes sp. SE50/110 was grown on soy flour medium agar (SFM; 20 g L−1 soy flour, 20 g L−1 mannitol, 20 g L−1 agar, pH 8, tap water) and in NBS medium for molecular cloning procedures as well as strain maintenance. .. For all PCRs, Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, Ipswich, MA, USA) was used.

    Quantitative RT-PCR:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We performed the PCRs with Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 13 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We performed the PCRs with Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 13 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    cDNA Library Assay:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Paragraph title: pDNA and cDNA library prep and high-throughput sequencing ... To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Incubation:

    Article Title: Seasonal changes in diet and chemical defense in the Climbing Mantella frog (Mantella laevigata)
    Article Snippet: The arthropods were placed in T1 buffer (from the NucleoSpin Tissue kit), crushed with a pestle, and incubated in Proteinase K solution at 56 ˚C overnight. .. For all reactions, we used 2 μL of each primer (10 μM) and 25 μL of 2X Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) in a total reaction volume of 50 μL.

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: Six microliters of the resulting RNA was then reverse transcribed using the QuantiTect® Reverse Transcription (RT) kit (Qiagen) as per the manufacturer’s instructions with the specific primer “cRT-CTS2_nest_R” (Supplemental Table ) and with a 30 rather than a 15-min incubation at 42 °C. .. A nested PCR was then performed using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primer concentrations (“cRT-sgRNA_nest_F” + “cRT-CTS2_nest_R” for first PCR, “cRT-sgRNA1_v2_F” + “cRT-CTS2_R” for second PCR, Supplemental Table ) starting from 1 μl of the cDNA.

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: The region surrounding the PDL1 cut site from our guide was first amplified from the extracted gDNA using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primers (forward: TGCTTTTGAATCCTGCACAA, reverse: CCATTGCTAGCCCTTAATCC) in a 30 μl total reaction with 1 μl gDNA. .. The region surrounding the PDL1 cut site from our guide was first amplified from the extracted gDNA using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primers (forward: TGCTTTTGAATCCTGCACAA, reverse: CCATTGCTAGCCCTTAATCC) in a 30 μl total reaction with 1 μl gDNA.

    Gel Extraction:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. For cDNA from RNA recovered from polysome fractions we used KAPA HiFi HotStart ReadyMix (Fisher Scientific) and the following cycling conditions: initial denaturation (98 °C for 30 s), 21 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). cDNA from 100 ng of polysome-associated RNA was used as input for each PCR.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: These initial PCR products were gel-purified using the QIAquick Gel Extraction Kit (Qiagen). .. We performed the PCRs with Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 13 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min). .. The PCRs were purified using the MinElute PCR Purification Kit (Qiagen).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: To enrich for CRISPR/Cas9-edited gDNA/cDNA, we digested WT DNA from these PCR products with SacI-HF (NEB) and gel-purified the remaining CRISPR/Cas9-modified, undigested PCR product (QIAquick Gel Extraction Kit, Qiagen). .. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 12 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: DNA gel extraction and plasmid preparation kits were purchased from Omega Bio-Tek. .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB).

    High Throughput Screening Assay:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: After performing a genomic DNA wipe-out, cDNA was generated from mRNA and polysome-associated RNA using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We used 20 ng pDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Paragraph title: pDNA and cDNA library prep and high-throughput sequencing ... We performed the PCRs with Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 13 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Contaminating gDNA was eliminated from isolated RNA using the Turbo DNA-free kit (ThermoFisher Scientific) and cDNA was generated using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min). .. We used 50 ng gDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min). .. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 12 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Expressing:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We nucleofected 1 × 105 HEK-293T cells with the sgRNA expression plasmid (500 ng) and the pooled HDR donors (0.2 μL, 100 μM stock) using the Neon transfection system (ThermoFisher Scientific) in a 10 μL tip (1150 V, 20 ms, 2 pulses). .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE. .. We performed a large-scale restriction cloning reaction to ligate the degenerate MRE PCR product into a reporter plasmid.

    Derivative Assay:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE. .. We performed a large-scale restriction cloning reaction to ligate the degenerate MRE PCR product into a reporter plasmid.

    Gel Purification:

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA). .. Alternative HA PCR products without t1 signal sequence or lacking both pol1 and t1 elements were generated to serve as controls for PCR-based reverse genetics ( and ).

    Transfection:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We used the All Prep DNA/RNA Mini kit (Qiagen) to simultaneously extract plasmid DNA (pDNA) and mRNA from HEK-293T cells transfected with the degenerate MRE reporter library. .. To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We nucleofected 1 × 105 HEK-293T cells with the sgRNA expression plasmid (500 ng) and the pooled HDR donors (0.2 μL, 100 μM stock) using the Neon transfection system (ThermoFisher Scientific) in a 10 μL tip (1150 V, 20 ms, 2 pulses). .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min).

    Gas Chromatography:

    Article Title: Seasonal changes in diet and chemical defense in the Climbing Mantella frog (Mantella laevigata)
    Article Snippet: CO1 was amplified using the general arthropod primers LCO-1490 (5’- GGTCAACAAATCATAAAGATATTGG) and HCO-2198 (5’-TAAACTTCAGGGTGACCAAAAATCA) from Folmer et al. [ ]. .. For all reactions, we used 2 μL of each primer (10 μM) and 25 μL of 2X Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) in a total reaction volume of 50 μL. .. We used a touchdown PCR program to amplify CO1 as follows: 95°C for 5 min; 5 cycles of 95°C for 30 s, 45°C for 30 s with -1°C per cycle, 72°C for 1 min; and 40 rounds of 95°C for 30 s, 40°C for 30 s, and 72°C for 1 min; ending with a single incubation of 72°C for 5 min. PCR reactions were stored at -20°C for one week and then run on a 1% SyberSafe/agarose gel (Life Technologies).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: After performing a genomic DNA wipe-out, cDNA was generated from mRNA and polysome-associated RNA using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We used 20 ng pDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We used a dual barcoding strategy where a unique combination of forward and reverse index primers were assigned to each biological sample. .. We performed the PCRs with Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 13 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. The manufacturer reports an error rate of 9.5 × 10−7 for Phusion High-Fidelity PCR Master Mix in GC Buffer.

    Article Title: Flexibility In Vitro of Amino Acid 226 in the Receptor-Binding Site of an H9 Subtype Influenza A Virus and Its Effect In Vivo on Virus Replication, Tropism, and Transmission
    Article Snippet: The 50-μl PCR mixture contained 10 ng of each PCR product, 25 μl of the PCR master mix, 50 pmol/μl of each primer, and 1.5 μl of dimethyl sulfoxide. .. PCR amplification was done using a Phusion high-fidelity PCR master mix with GC buffer (New England Biolabs, Ipswich, MA) under the following cycling parameters: 98°C for 30 s; 98°C for 8 s, 56°C for 1 min, and 72°C for 3 min for 30 cycles; and 72°C for 10 min ( ). .. Independent virus rescue experiments were performed with the nnn226 H9PCR and equi226 H9PCR amplicon libraries, as previously described ( , ).

    Article Title: Identification of polymorphic SVA retrotransposons using a mobile element scanning method for SVA (ME-Scan-SVA)
    Article Snippet: However, for 7 loci (5 polymorphic, 2 de novo) no specific internal/external amplification was achieved. .. The PCRs were performed using One Taq hot start DNA polymerase with GC buffer (cat. no. M0481, New England Biolabs, Ipswich, MA, USA). .. The thermocycling condition is: an initial denaturation at 94 °C for 30 s, followed by 30 cycles of 94 °C for 30 s, a locus-specific annealing temperature (Additional file : Table S2) for 1 min, and 68 °C for 3 min, followed by a final extension at 68 °C for 3 min The PCR products were electrophoresed at 300 volts for 25 min on a 1.5 % GenePure LE Agarose gel (cat. no. E-3120-500, BioExpress, Kaysville, UT, USA).

    Article Title: The characteristics analysis of intestinal microecology on cerebral infarction patients and its correlation with apolipoprotein E
    Article Snippet: The samples were diluted to 1 ng/μL with sterile water. .. The genomic DNA was diluted and used as a template and specific primers with a barcode were used for PCR amplification using Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) and efficient and high-fidelity enzymes. .. The 16S and V4 primers (515F and 806R) were used to evaluate bacterial diversity, 18S and V4 primers (528F and 706R) were used to determine the diversity of eukaryotic microorganisms, and ITS1 primers (ITS5-1737F and ITS2-2043R) were used to examine fungal diversity and the 16S V3-V4/16S V4-V5 region, archaeal 16S V4 region, and 18S V9 and ITS2 regions.

    Article Title: Analysis of intestinal microbial communities of cerebral infarction and ischemia patients based on high throughput sequencing technology and glucose and lipid metabolism
    Article Snippet: The bacterial genomic DNA was amplified with primers specific for the V4 hypervariable regions of the 16SrDNA gene. .. The sequences were forward, 5′-GTGCCAGCMGCCGCGGTAA-3′ and reverse, 5′-GGACTACHVGGGTWTCTAAT-3′, and the reaction was performed using Phusion High-Fidelity PCR master mix with GC buffer (New England Biolabs, Inc., Ipswich, MA, USA). .. Samples were sequenced by Illumina MiSeq platform provided by Illumina, Inc. (San Diego, CA, USA) with the following conditions: Denaturation 1 min at 98°C, 10 sec at 98°C, 30 sec at 50°C and 30 sec at 72°Cfor 30 cycles, and 72°C at 5 min.

    Article Title: Ab initio reconstruction of transcriptomes of pluripotent and lineage committed cells reveals gene structures of thousands of lincRNAs
    Article Snippet: The sample was run on a 3% Agarose gel (Nusieve 3:1 Agarose) and a 160 – 380 base pair fragment was cut out and extracted. .. PCR was performed with Phusion High-Fidelity DNA Polymerase with GC buffer (New England Biolabs) and 2M Betaine (Sigma). .. [PCR conditions: 30 sec at 98°C, (10 sec at 98°C, 30 sec at 65°C, 30 sec at 72°C -16 cycles) 5 min at 72°C, forever at 4°C], and products were run on a poly-acrylamide gel for 60 minutes at 120 volts.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Contaminating gDNA was eliminated from isolated RNA using the Turbo DNA-free kit (ThermoFisher Scientific) and cDNA was generated using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min). .. We used 50 ng gDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: Six microliters of the resulting RNA was then reverse transcribed using the QuantiTect® Reverse Transcription (RT) kit (Qiagen) as per the manufacturer’s instructions with the specific primer “cRT-CTS2_nest_R” (Supplemental Table ) and with a 30 rather than a 15-min incubation at 42 °C. .. A nested PCR was then performed using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primer concentrations (“cRT-sgRNA_nest_F” + “cRT-CTS2_nest_R” for first PCR, “cRT-sgRNA1_v2_F” + “cRT-CTS2_R” for second PCR, Supplemental Table ) starting from 1 μl of the cDNA. .. One microliter of a 1:10 dilution of the first PCR was transferred into the second PCR (20 μl total reaction volume).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Illumina sequencing adaptors and unique barcode combinations were appended to the HDR-enriched DNA by PCR. .. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 12 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We purified, quantified and sequencing the resulting amplicon libraries as described above.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: To achieve maximum coverage of single and double nucleotide variants, 91% of the complementary base and 3% of each non-complementary base were incorporate at each position in the MRE libraries. .. Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE. .. The resulting PCR products were pooled and purified using the MinElute PCR Purification Kit (Qiagen).

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: Finally, the raw volume of the correctly processed peak was divided by the sum of the raw volume of all peaks to estimate the processing efficiency. .. The region surrounding the PDL1 cut site from our guide was first amplified from the extracted gDNA using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primers (forward: TGCTTTTGAATCCTGCACAA, reverse: CCATTGCTAGCCCTTAATCC) in a 30 μl total reaction with 1 μl gDNA. .. Following amplification, products were purified using Agencourt AMPure XP beads as per the manufacturer’s instructions with 1.8× sample volumes of beads and a 25 μl final elution volume.

    Article Title: Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model
    Article Snippet: DNA was used as template to amplify the 16S V3-V4 region using specific primers with Barcode. .. The efficient hi-fi PCR enzyme and the Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs) were added to insure the amplification efficiency and accuracy. .. The production of PCR was verified by electrophoresis in 1.5% agarose gel, and then recycled by gel extraction kit (qiagen).

    Article Title: The MalR type regulator AcrC is a transcriptional repressor of acarbose biosynthetic genes in Actinoplanes sp. SE50/110
    Article Snippet: Soy flour (full fat) was used from Sobo Naturkost (Cologne, Germany) and purchased at a local store. .. For all PCRs, Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, Ipswich, MA, USA) was used. .. Gibson assembly master mix was prepared with Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA), T5 Exonuclease (Epicentre, Madison, WI, USA) and TaqDNA Ligase (NEB, Ipswich, MA, USA).

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: E. coli ET12567/pUZ8002 was used as the host for intergeneric conjugations . pUWL201PWT, which is a derivative of pUWL201PW containing an oriT sequence that was cloned into its Pst I site, was used as the shuttle vector for gene complementations, biotransformation, and heterologous production of PtmU4 in Streptomyces . .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB). .. For Southern analysis, digoxigenin labeling of DNA probes, hybridization, and detection were performed according to the protocols provided by the manufacturer (Roche Diagnostics Corp.).

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: The 50 µl PCR reaction mixture contained 10 ng of each PCR product, 25 µl of Master PCR mix, 1.5 µl 100% DMSO, and 50 pmol/µl of each primer. .. PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA). .. Alternative HA PCR products without t1 signal sequence or lacking both pol1 and t1 elements were generated to serve as controls for PCR-based reverse genetics ( and ).

    Article Title: Cell culture-adaptive mutations in hepatitis C virus promote viral production by enhancing viral replication and release
    Article Snippet: A series of primers for construction of adaptive variants of wild-type HCV JFH1 listed in Table were designed using the pJFH1 sequence and mutations. .. The pJFH1 plasmid was used as a template for subsequent PCR with Phushion High-Fidelity PCR Master Mix with GC buffer (New England Biolabs) according to the manufacturer’s instructions. .. The preliminary PCR products (mE2-1, mE2-2, mp7-1, mp7-2, mNS4B-1, mNS4B-2, mNS5A-1, mNS5A-2, mNS5A-3, and mNS5A-4) were analyzed by 1% agarose gel electrophoresis, and used for overlap PCR following the combination showed in Tables and to obtain adaptive mutation fragments.

    Ligation:

    Article Title: Ab initio reconstruction of transcriptomes of pluripotent and lineage committed cells reveals gene structures of thousands of lincRNAs
    Article Snippet: Adenine was added to the 3′ end of the DNA fragments to allow adaptor ligation using dATP and Klenow exonuclease (NEB; M0212S) and purified using MiniElute. .. PCR was performed with Phusion High-Fidelity DNA Polymerase with GC buffer (New England Biolabs) and 2M Betaine (Sigma).

    Introduce:

    Article Title: Flexibility In Vitro of Amino Acid 226 in the Receptor-Binding Site of an H9 Subtype Influenza A Virus and Its Effect In Vivo on Virus Replication, Tropism, and Transmission
    Article Snippet: In the second approach, an equivalent PCR product, 5′-t1equi HA757-3′ , was generated from pDPAO1-767 using the primer t1FragFwd and 50 pmol/μl of a primer mix containing 20 primers designed to introduce every possible amino acid at position 226. .. PCR amplification was done using a Phusion high-fidelity PCR master mix with GC buffer (New England Biolabs, Ipswich, MA) under the following cycling parameters: 98°C for 30 s; 98°C for 8 s, 56°C for 1 min, and 72°C for 3 min for 30 cycles; and 72°C for 10 min ( ).

    Hemagglutination Assay:

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: Paragraph title: PCR strategy of overlapping HA and NA gene segments with human pol1 promoter ... PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA).

    Generated:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: After performing a genomic DNA wipe-out, cDNA was generated from mRNA and polysome-associated RNA using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Flexibility In Vitro of Amino Acid 226 in the Receptor-Binding Site of an H9 Subtype Influenza A Virus and Its Effect In Vivo on Virus Replication, Tropism, and Transmission
    Article Snippet: In the second approach, an equivalent PCR product, 5′-t1equi HA757-3′ , was generated from pDPAO1-767 using the primer t1FragFwd and 50 pmol/μl of a primer mix containing 20 primers designed to introduce every possible amino acid at position 226. .. PCR amplification was done using a Phusion high-fidelity PCR master mix with GC buffer (New England Biolabs, Ipswich, MA) under the following cycling parameters: 98°C for 30 s; 98°C for 8 s, 56°C for 1 min, and 72°C for 3 min for 30 cycles; and 72°C for 10 min ( ).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Contaminating gDNA was eliminated from isolated RNA using the Turbo DNA-free kit (ThermoFisher Scientific) and cDNA was generated using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We used 50 ng gDNA and cDNA generated from 200 ng of RNA as input for these PCRs. .. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 12 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA). .. PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA).

    DNA Sequencing:

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB). .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB).

    Sequencing:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: After performing a genomic DNA wipe-out, cDNA was generated from mRNA and polysome-associated RNA using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We used 20 ng pDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Paragraph title: pDNA and cDNA library prep and high-throughput sequencing ... We performed the PCRs with Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 13 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Flexibility In Vitro of Amino Acid 226 in the Receptor-Binding Site of an H9 Subtype Influenza A Virus and Its Effect In Vivo on Virus Replication, Tropism, and Transmission
    Article Snippet: The second half of the HA was amplified from pDPAO738-1742 using the set of primers WF10 HA 738-770 and hPol1Rev to generate the PCR product 5′-HA738pol1-3′ that included the second half of the HA followed by the pol 1 promoter sequence. .. PCR amplification was done using a Phusion high-fidelity PCR master mix with GC buffer (New England Biolabs, Ipswich, MA) under the following cycling parameters: 98°C for 30 s; 98°C for 8 s, 56°C for 1 min, and 72°C for 3 min for 30 cycles; and 72°C for 10 min ( ).

    Article Title: Identification of polymorphic SVA retrotransposons using a mobile element scanning method for SVA (ME-Scan-SVA)
    Article Snippet: The PCRs were performed using One Taq hot start DNA polymerase with GC buffer (cat. no. M0481, New England Biolabs, Ipswich, MA, USA). .. The PCRs were performed using One Taq hot start DNA polymerase with GC buffer (cat. no. M0481, New England Biolabs, Ipswich, MA, USA).

    Article Title: Analysis of intestinal microbial communities of cerebral infarction and ischemia patients based on high throughput sequencing technology and glucose and lipid metabolism
    Article Snippet: Paragraph title: Polymerase chain reaction (PCR) amplification and Illumina sequencing ... The sequences were forward, 5′-GTGCCAGCMGCCGCGGTAA-3′ and reverse, 5′-GGACTACHVGGGTWTCTAAT-3′, and the reaction was performed using Phusion High-Fidelity PCR master mix with GC buffer (New England Biolabs, Inc., Ipswich, MA, USA).

    Article Title: Ab initio reconstruction of transcriptomes of pluripotent and lineage committed cells reveals gene structures of thousands of lincRNAs
    Article Snippet: PCR was performed with Phusion High-Fidelity DNA Polymerase with GC buffer (New England Biolabs) and 2M Betaine (Sigma). .. [PCR conditions: 30 sec at 98°C, (10 sec at 98°C, 30 sec at 65°C, 30 sec at 72°C -16 cycles) 5 min at 72°C, forever at 4°C], and products were run on a poly-acrylamide gel for 60 minutes at 120 volts.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Contaminating gDNA was eliminated from isolated RNA using the Turbo DNA-free kit (ThermoFisher Scientific) and cDNA was generated using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min). .. We used 50 ng gDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Illumina sequencing adaptors and unique barcode combinations were appended to the HDR-enriched DNA by PCR. .. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 12 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Therefore, for a 23nt sequence there are 253 combinations of di-nucleotide mismatches. .. Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE.

    Article Title: Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model
    Article Snippet: The efficient hi-fi PCR enzyme and the Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs) were added to insure the amplification efficiency and accuracy. .. The production of PCR was verified by electrophoresis in 1.5% agarose gel, and then recycled by gel extraction kit (qiagen).

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: E. coli ET12567/pUZ8002 was used as the host for intergeneric conjugations . pUWL201PWT, which is a derivative of pUWL201PW containing an oriT sequence that was cloned into its Pst I site, was used as the shuttle vector for gene complementations, biotransformation, and heterologous production of PtmU4 in Streptomyces . .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB).

    Article Title: Cell culture-adaptive mutations in hepatitis C virus promote viral production by enhancing viral replication and release
    Article Snippet: A series of primers for construction of adaptive variants of wild-type HCV JFH1 listed in Table were designed using the pJFH1 sequence and mutations. .. The pJFH1 plasmid was used as a template for subsequent PCR with Phushion High-Fidelity PCR Master Mix with GC buffer (New England Biolabs) according to the manufacturer’s instructions.

    DNA Extraction:

    Article Title: The characteristics analysis of intestinal microecology on cerebral infarction patients and its correlation with apolipoprotein E
    Article Snippet: Paragraph title: 2.2. Genomic DNA extraction and PCR amplification ... The genomic DNA was diluted and used as a template and specific primers with a barcode were used for PCR amplification using Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) and efficient and high-fidelity enzymes.

    Article Title: Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model
    Article Snippet: Paragraph title: DNA Extraction and 16S rDNA Gene Amplicon Pyrosequencing ... The efficient hi-fi PCR enzyme and the Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs) were added to insure the amplification efficiency and accuracy.

    Nucleic Acid Electrophoresis:

    Article Title: Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model
    Article Snippet: DNA purity was verified through agar gel electrophoresis, and was diluted to the concentration of 1.0 ng/μL. .. The efficient hi-fi PCR enzyme and the Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs) were added to insure the amplification efficiency and accuracy.

    Magnetic Beads:

    Article Title: Ab initio reconstruction of transcriptomes of pluripotent and lineage committed cells reveals gene structures of thousands of lincRNAs
    Article Snippet: PCR was performed with Phusion High-Fidelity DNA Polymerase with GC buffer (New England Biolabs) and 2M Betaine (Sigma). .. [PCR conditions: 30 sec at 98°C, (10 sec at 98°C, 30 sec at 65°C, 30 sec at 72°C -16 cycles) 5 min at 72°C, forever at 4°C], and products were run on a poly-acrylamide gel for 60 minutes at 120 volts.

    Isolation:

    Article Title: Seasonal changes in diet and chemical defense in the Climbing Mantella frog (Mantella laevigata)
    Article Snippet: DNA from arthropods was isolated using the NucleoSpin Tissue kit (Macherey-Nagel, Bethlehem, PA, USA) according to manufacturer’s instructions with a few deviations to make the protocol amenable to an undergraduate laboratory course. .. For all reactions, we used 2 μL of each primer (10 μM) and 25 μL of 2X Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) in a total reaction volume of 50 μL.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Contaminating gDNA was eliminated from isolated RNA using the Turbo DNA-free kit (ThermoFisher Scientific) and cDNA was generated using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min).

    Size-exclusion Chromatography:

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: The 50 µl PCR reaction mixture contained 10 ng of each PCR product, 25 µl of Master PCR mix, 1.5 µl 100% DMSO, and 50 pmol/µl of each primer. .. PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA). .. Alternative HA PCR products without t1 signal sequence or lacking both pol1 and t1 elements were generated to serve as controls for PCR-based reverse genetics ( and ).

    Purification:

    Article Title: Seasonal changes in diet and chemical defense in the Climbing Mantella frog (Mantella laevigata)
    Article Snippet: Extraction of genomic DNA then proceeded according to manufacturer’s instructions and purified genomic DNA was stored at -20 ˚C for one week. .. For all reactions, we used 2 μL of each primer (10 μM) and 25 μL of 2X Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) in a total reaction volume of 50 μL.

    Article Title: Ab initio reconstruction of transcriptomes of pluripotent and lineage committed cells reveals gene structures of thousands of lincRNAs
    Article Snippet: Adenine was added to the 3′ end of the DNA fragments to allow adaptor ligation using dATP and Klenow exonuclease (NEB; M0212S) and purified using MiniElute. .. PCR was performed with Phusion High-Fidelity DNA Polymerase with GC buffer (New England Biolabs) and 2M Betaine (Sigma).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min). .. We used 50 ng gDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: RNA was then purified from the reactions using a ChargeSwitch® Total RNA Cell Kit (Thermo Fisher Scientific) without lysis incubation or DNase treatment step and with a final elution volume of 12.5 μl. .. A nested PCR was then performed using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primer concentrations (“cRT-sgRNA_nest_F” + “cRT-CTS2_nest_R” for first PCR, “cRT-sgRNA1_v2_F” + “cRT-CTS2_R” for second PCR, Supplemental Table ) starting from 1 μl of the cDNA.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: The PCRs were purified using the MinElute PCR Purification Kit (Qiagen). .. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 12 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: The 3 PCR products above were purified by agarose gel electrophoresis and combined in equal proportions to generate a full-length HA PCR amplicon using the primer pair pT1FragFwd and hPol1Rev . .. PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA).

    Polymerase Chain Reaction:

    Article Title: Seasonal changes in diet and chemical defense in the Climbing Mantella frog (Mantella laevigata)
    Article Snippet: CO1 was amplified using the general arthropod primers LCO-1490 (5’- GGTCAACAAATCATAAAGATATTGG) and HCO-2198 (5’-TAAACTTCAGGGTGACCAAAAATCA) from Folmer et al. [ ]. .. For all reactions, we used 2 μL of each primer (10 μM) and 25 μL of 2X Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) in a total reaction volume of 50 μL. .. We used a touchdown PCR program to amplify CO1 as follows: 95°C for 5 min; 5 cycles of 95°C for 30 s, 45°C for 30 s with -1°C per cycle, 72°C for 1 min; and 40 rounds of 95°C for 30 s, 40°C for 30 s, and 72°C for 1 min; ending with a single incubation of 72°C for 5 min. PCR reactions were stored at -20°C for one week and then run on a 1% SyberSafe/agarose gel (Life Technologies).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: After performing a genomic DNA wipe-out, cDNA was generated from mRNA and polysome-associated RNA using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We used 20 ng pDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We used a dual barcoding strategy where a unique combination of forward and reverse index primers were assigned to each biological sample. .. We performed the PCRs with Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 13 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. The manufacturer reports an error rate of 9.5 × 10−7 for Phusion High-Fidelity PCR Master Mix in GC Buffer.

    Article Title: Flexibility In Vitro of Amino Acid 226 in the Receptor-Binding Site of an H9 Subtype Influenza A Virus and Its Effect In Vivo on Virus Replication, Tropism, and Transmission
    Article Snippet: The 50-μl PCR mixture contained 10 ng of each PCR product, 25 μl of the PCR master mix, 50 pmol/μl of each primer, and 1.5 μl of dimethyl sulfoxide. .. PCR amplification was done using a Phusion high-fidelity PCR master mix with GC buffer (New England Biolabs, Ipswich, MA) under the following cycling parameters: 98°C for 30 s; 98°C for 8 s, 56°C for 1 min, and 72°C for 3 min for 30 cycles; and 72°C for 10 min ( ). .. Independent virus rescue experiments were performed with the nnn226 H9PCR and equi226 H9PCR amplicon libraries, as previously described ( , ).

    Article Title: Identification of polymorphic SVA retrotransposons using a mobile element scanning method for SVA (ME-Scan-SVA)
    Article Snippet: Paragraph title: Genotyping PCR for validation ... The PCRs were performed using One Taq hot start DNA polymerase with GC buffer (cat. no. M0481, New England Biolabs, Ipswich, MA, USA).

    Article Title: The characteristics analysis of intestinal microecology on cerebral infarction patients and its correlation with apolipoprotein E
    Article Snippet: The samples were diluted to 1 ng/μL with sterile water. .. The genomic DNA was diluted and used as a template and specific primers with a barcode were used for PCR amplification using Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) and efficient and high-fidelity enzymes. .. The 16S and V4 primers (515F and 806R) were used to evaluate bacterial diversity, 18S and V4 primers (528F and 706R) were used to determine the diversity of eukaryotic microorganisms, and ITS1 primers (ITS5-1737F and ITS2-2043R) were used to examine fungal diversity and the 16S V3-V4/16S V4-V5 region, archaeal 16S V4 region, and 18S V9 and ITS2 regions.

    Article Title: Analysis of intestinal microbial communities of cerebral infarction and ischemia patients based on high throughput sequencing technology and glucose and lipid metabolism
    Article Snippet: The bacterial genomic DNA was amplified with primers specific for the V4 hypervariable regions of the 16SrDNA gene. .. The sequences were forward, 5′-GTGCCAGCMGCCGCGGTAA-3′ and reverse, 5′-GGACTACHVGGGTWTCTAAT-3′, and the reaction was performed using Phusion High-Fidelity PCR master mix with GC buffer (New England Biolabs, Inc., Ipswich, MA, USA). .. Samples were sequenced by Illumina MiSeq platform provided by Illumina, Inc. (San Diego, CA, USA) with the following conditions: Denaturation 1 min at 98°C, 10 sec at 98°C, 30 sec at 50°C and 30 sec at 72°Cfor 30 cycles, and 72°C at 5 min.

    Article Title: Ab initio reconstruction of transcriptomes of pluripotent and lineage committed cells reveals gene structures of thousands of lincRNAs
    Article Snippet: The sample was run on a 3% Agarose gel (Nusieve 3:1 Agarose) and a 160 – 380 base pair fragment was cut out and extracted. .. PCR was performed with Phusion High-Fidelity DNA Polymerase with GC buffer (New England Biolabs) and 2M Betaine (Sigma). .. [PCR conditions: 30 sec at 98°C, (10 sec at 98°C, 30 sec at 65°C, 30 sec at 72°C -16 cycles) 5 min at 72°C, forever at 4°C], and products were run on a poly-acrylamide gel for 60 minutes at 120 volts.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Contaminating gDNA was eliminated from isolated RNA using the Turbo DNA-free kit (ThermoFisher Scientific) and cDNA was generated using the QuantiTect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min). .. We used 50 ng gDNA and cDNA generated from 200 ng of RNA as input for these PCRs.

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: Six microliters of the resulting RNA was then reverse transcribed using the QuantiTect® Reverse Transcription (RT) kit (Qiagen) as per the manufacturer’s instructions with the specific primer “cRT-CTS2_nest_R” (Supplemental Table ) and with a 30 rather than a 15-min incubation at 42 °C. .. A nested PCR was then performed using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primer concentrations (“cRT-sgRNA_nest_F” + “cRT-CTS2_nest_R” for first PCR, “cRT-sgRNA1_v2_F” + “cRT-CTS2_R” for second PCR, Supplemental Table ) starting from 1 μl of the cDNA. .. One microliter of a 1:10 dilution of the first PCR was transferred into the second PCR (20 μl total reaction volume).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Illumina sequencing adaptors and unique barcode combinations were appended to the HDR-enriched DNA by PCR. .. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 12 amplification cycles (98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min). .. We purified, quantified and sequencing the resulting amplicon libraries as described above.

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: To achieve maximum coverage of single and double nucleotide variants, 91% of the complementary base and 3% of each non-complementary base were incorporate at each position in the MRE libraries. .. Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE. .. The resulting PCR products were pooled and purified using the MinElute PCR Purification Kit (Qiagen).

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: Finally, the raw volume of the correctly processed peak was divided by the sum of the raw volume of all peaks to estimate the processing efficiency. .. The region surrounding the PDL1 cut site from our guide was first amplified from the extracted gDNA using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primers (forward: TGCTTTTGAATCCTGCACAA, reverse: CCATTGCTAGCCCTTAATCC) in a 30 μl total reaction with 1 μl gDNA. .. Following amplification, products were purified using Agencourt AMPure XP beads as per the manufacturer’s instructions with 1.8× sample volumes of beads and a 25 μl final elution volume.

    Article Title: Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model
    Article Snippet: DNA was used as template to amplify the 16S V3-V4 region using specific primers with Barcode. .. The efficient hi-fi PCR enzyme and the Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs) were added to insure the amplification efficiency and accuracy. .. The production of PCR was verified by electrophoresis in 1.5% agarose gel, and then recycled by gel extraction kit (qiagen).

    Article Title: The MalR type regulator AcrC is a transcriptional repressor of acarbose biosynthetic genes in Actinoplanes sp. SE50/110
    Article Snippet: Soy flour (full fat) was used from Sobo Naturkost (Cologne, Germany) and purchased at a local store. .. For all PCRs, Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, Ipswich, MA, USA) was used. .. Gibson assembly master mix was prepared with Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA), T5 Exonuclease (Epicentre, Madison, WI, USA) and TaqDNA Ligase (NEB, Ipswich, MA, USA).

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: E. coli ET12567/pUZ8002 was used as the host for intergeneric conjugations . pUWL201PWT, which is a derivative of pUWL201PW containing an oriT sequence that was cloned into its Pst I site, was used as the shuttle vector for gene complementations, biotransformation, and heterologous production of PtmU4 in Streptomyces . .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB). .. For Southern analysis, digoxigenin labeling of DNA probes, hybridization, and detection were performed according to the protocols provided by the manufacturer (Roche Diagnostics Corp.).

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: The 50 µl PCR reaction mixture contained 10 ng of each PCR product, 25 µl of Master PCR mix, 1.5 µl 100% DMSO, and 50 pmol/µl of each primer. .. PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA). .. Alternative HA PCR products without t1 signal sequence or lacking both pol1 and t1 elements were generated to serve as controls for PCR-based reverse genetics ( and ).

    Article Title: Cell culture-adaptive mutations in hepatitis C virus promote viral production by enhancing viral replication and release
    Article Snippet: A series of primers for construction of adaptive variants of wild-type HCV JFH1 listed in Table were designed using the pJFH1 sequence and mutations. .. The pJFH1 plasmid was used as a template for subsequent PCR with Phushion High-Fidelity PCR Master Mix with GC buffer (New England Biolabs) according to the manufacturer’s instructions. .. The preliminary PCR products (mE2-1, mE2-2, mp7-1, mp7-2, mNS4B-1, mNS4B-2, mNS5A-1, mNS5A-2, mNS5A-3, and mNS5A-4) were analyzed by 1% agarose gel electrophoresis, and used for overlap PCR following the combination showed in Tables and to obtain adaptive mutation fragments.

    Construct:

    Article Title: Cell culture-adaptive mutations in hepatitis C virus promote viral production by enhancing viral replication and release
    Article Snippet: Plasmid constructs were based on the consensus sequence of HCV pJFH1, which was kindly provided by Dr. Wakita[ ]. .. The pJFH1 plasmid was used as a template for subsequent PCR with Phushion High-Fidelity PCR Master Mix with GC buffer (New England Biolabs) according to the manufacturer’s instructions.

    CRISPR:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Paragraph title: CRISPR/Cas9 mediated endogenous BRCA1 tuning ... To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min).

    Nested PCR:

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: Six microliters of the resulting RNA was then reverse transcribed using the QuantiTect® Reverse Transcription (RT) kit (Qiagen) as per the manufacturer’s instructions with the specific primer “cRT-CTS2_nest_R” (Supplemental Table ) and with a 30 rather than a 15-min incubation at 42 °C. .. A nested PCR was then performed using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primer concentrations (“cRT-sgRNA_nest_F” + “cRT-CTS2_nest_R” for first PCR, “cRT-sgRNA1_v2_F” + “cRT-CTS2_R” for second PCR, Supplemental Table ) starting from 1 μl of the cDNA. .. One microliter of a 1:10 dilution of the first PCR was transferred into the second PCR (20 μl total reaction volume).

    Agarose Gel Electrophoresis:

    Article Title: Ab initio reconstruction of transcriptomes of pluripotent and lineage committed cells reveals gene structures of thousands of lincRNAs
    Article Snippet: The sample was run on a 3% Agarose gel (Nusieve 3:1 Agarose) and a 160 – 380 base pair fragment was cut out and extracted. .. PCR was performed with Phusion High-Fidelity DNA Polymerase with GC buffer (New England Biolabs) and 2M Betaine (Sigma).

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: The 3 PCR products above were purified by agarose gel electrophoresis and combined in equal proportions to generate a full-length HA PCR amplicon using the primer pair pT1FragFwd and hPol1Rev . .. PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA).

    Plasmid Preparation:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We used the All Prep DNA/RNA Mini kit (Qiagen) to simultaneously extract plasmid DNA (pDNA) and mRNA from HEK-293T cells transfected with the degenerate MRE reporter library. .. To create amplicon libraries for high-throughput sequencing, the degenerate MRE and a short flanking region were PCR amplified using the primers bi-dir-Miseq-F and bi-dir-Miseq-R. For cDNA and pDNA we used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 23 amplification cycles (98 °C for 10 s, 65 °C for 10 s, 72 °C for 10 s) and final extension (72 °C for 5 min).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: We nucleofected 1 × 105 HEK-293T cells with the sgRNA expression plasmid (500 ng) and the pooled HDR donors (0.2 μL, 100 μM stock) using the Neon transfection system (ThermoFisher Scientific) in a 10 μL tip (1150 V, 20 ms, 2 pulses). .. To create amplicon libraries for high-throughput sequencing, the targeted locus in the BRCA1 3′UTR was PCR amplified using the primers BRCA1-Miseq-F and BRCA1-Miseq-R. We used Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) and the following cycling conditions: initial denaturation (98 °C for 30 s), 33 amplification cycles (98 °C for 10 s, 64 °C for 12 s, 72 °C for 12 s) and final extension (72 °C for 5 min).

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE. .. Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE.

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: E. coli ET12567/pUZ8002 was used as the host for intergeneric conjugations . pUWL201PWT, which is a derivative of pUWL201PW containing an oriT sequence that was cloned into its Pst I site, was used as the shuttle vector for gene complementations, biotransformation, and heterologous production of PtmU4 in Streptomyces . .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB).

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: The human pol1 promoter was PCR amplified using primers polF and hPol1Rev and the pDP2002 plasmid vector as template. .. PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA).

    Article Title: Cell culture-adaptive mutations in hepatitis C virus promote viral production by enhancing viral replication and release
    Article Snippet: A series of primers for construction of adaptive variants of wild-type HCV JFH1 listed in Table were designed using the pJFH1 sequence and mutations. .. The pJFH1 plasmid was used as a template for subsequent PCR with Phushion High-Fidelity PCR Master Mix with GC buffer (New England Biolabs) according to the manufacturer’s instructions. .. The preliminary PCR products (mE2-1, mE2-2, mp7-1, mp7-2, mNS4B-1, mNS4B-2, mNS5A-1, mNS5A-2, mNS5A-3, and mNS5A-4) were analyzed by 1% agarose gel electrophoresis, and used for overlap PCR following the combination showed in Tables and to obtain adaptive mutation fragments.

    RNA Extraction:

    Article Title: Ab initio reconstruction of transcriptomes of pluripotent and lineage committed cells reveals gene structures of thousands of lincRNAs
    Article Snippet: Paragraph title: RNA Extraction & Library Preparation ... PCR was performed with Phusion High-Fidelity DNA Polymerase with GC buffer (New England Biolabs) and 2M Betaine (Sigma).

    Sample Prep:

    Article Title: Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model
    Article Snippet: The efficient hi-fi PCR enzyme and the Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs) were added to insure the amplification efficiency and accuracy. .. The production of PCR was verified by electrophoresis in 1.5% agarose gel, and then recycled by gel extraction kit (qiagen).

    Sampling:

    Article Title: The characteristics analysis of intestinal microecology on cerebral infarction patients and its correlation with apolipoprotein E
    Article Snippet: After sampling, 500 mg of fecal matter was collected and the fecal genome was extracted using an Extraction Kit (Beijing Tiangen Biochemical Technology Co., Ltd., Beijing, China). .. The genomic DNA was diluted and used as a template and specific primers with a barcode were used for PCR amplification using Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) and efficient and high-fidelity enzymes.

    Produced:

    Article Title: Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
    Article Snippet: PCR reaction conditions were 98°C for 30 sec, and then 30 cycles at 98°C for 8 s, 56°C for 1 min and 72°C for 3 min, ending with 72°C for 10 min. PCR products were amplified using the Phusion high-fidelity PCR master mix with GC Buffer (New England Biolabs, Ipswich, MA). .. PCR products were purified by agarose gel electrophoresis and quantitated after gel purification using Nanodrop 1000 (Nanodrop, Wilmington, DE).

    Concentration Assay:

    Article Title: Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model
    Article Snippet: DNA purity was verified through agar gel electrophoresis, and was diluted to the concentration of 1.0 ng/μL. .. The efficient hi-fi PCR enzyme and the Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs) were added to insure the amplification efficiency and accuracy.

    Marker:

    Article Title: Seasonal changes in diet and chemical defense in the Climbing Mantella frog (Mantella laevigata)
    Article Snippet: We used PCR to amplify a segment of the cytochrome oxidase 1 ( CO1 or cox1 ) gene from the mitochondrial DNA, the standard marker for DNA barcoding. .. For all reactions, we used 2 μL of each primer (10 μM) and 25 μL of 2X Phusion High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) in a total reaction volume of 50 μL.

    Lysis:

    Article Title: Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression
    Article Snippet: RNA was then purified from the reactions using a ChargeSwitch® Total RNA Cell Kit (Thermo Fisher Scientific) without lysis incubation or DNase treatment step and with a final elution volume of 12.5 μl. .. A nested PCR was then performed using Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) with 500 nM primer concentrations (“cRT-sgRNA_nest_F” + “cRT-CTS2_nest_R” for first PCR, “cRT-sgRNA1_v2_F” + “cRT-CTS2_R” for second PCR, Supplemental Table ) starting from 1 μl of the cDNA.

    Variant Assay:

    Article Title: Precise tuning of gene expression levels in mammalian cells
    Article Snippet: Paragraph title: MRE variant library construction ... Each degenerate oligo was PCR amplified in triplicate using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), using primers miR17_Lib_Gen_F and miR17_Lib_Gen_R, which append BsmBI recognition sites on both sides of the MRE.

    Homologous Recombination:

    Article Title: Biosynthesis of thiocarboxylic acid-containing natural products
    Article Snippet: The REDIRECT Technology kit for PCR-targeting homologous recombination was provided by The John Innes Center (Norwich, UK) . pOJ260 was used as a shuttle vector for gene homologous recombination . .. Cosmid libraries were screened by PCR using OneTaq 2× Master Mix with GC buffer (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs gc buffer
    Gc Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 86 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gc buffer/product/New England Biolabs
    Average 99 stars, based on 86 article reviews
    Price from $9.99 to $1999.99
    gc buffer - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results