cas9 nuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    Cas9 Nuclease S pyogenes
    Description:
    Cas9 Nuclease S pyogenes 2 000 pmol
    Catalog Number:
    M0386M
    Price:
    540
    Size:
    2 000 pmol
    Category:
    Other Endonucleases
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs cas9 nuclease
    Cas9 Nuclease S pyogenes
    Cas9 Nuclease S pyogenes 2 000 pmol
    https://www.bioz.com/result/cas9 nuclease/product/New England Biolabs
    Average 98 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    cas9 nuclease - by Bioz Stars, 2019-10
    98/100 stars

    Images

    1) Product Images from "Clustering-local-unique-enriched-signals (CLUES) promotes identification of novel regulators of ES cell self-renewal and pluripotency"

    Article Title: Clustering-local-unique-enriched-signals (CLUES) promotes identification of novel regulators of ES cell self-renewal and pluripotency

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0206844

    CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a CRISPR/Cas9 negative selection genetic screen (Kolmogorov–Smirnov test, p
    Figure Legend Snippet: CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a CRISPR/Cas9 negative selection genetic screen (Kolmogorov–Smirnov test, p

    Techniques Used: RNA Sequencing Assay, Chromatin Immunoprecipitation, CRISPR, Selection

    Related Articles

    Clone Assay:

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: Paragraph title: Cleavage of HPV L1 genes cloned in plasmid with Cas9-sgRNA ... The Cas9 digestion reaction (30 μL) consisted of 1× Cas9 Nuclease Reaction Buffer, 30 nM Cas9 Nuclease (NEB), 30 nM sgRNA a (16–1274 or 18–1490; Table ) and 30 nM sgRNA b (16–950 or 18–1274; Table ) was firstly incubated at 25 °C for 10 min (this process was referred to as pre-assemble hereafter).

    Amplification:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Single-guide RNAs (sgRNAs) were generated that target sites near the ATG translation initiation site and the first GT splice donor sites for Ncor1, Ncor2, and Raldh2 plus sites flanking the Fgf8 RARE; sgRNAs were designed with maximum specificity using the tool at crispr.mit.edu to ensure that each sgRNA had no more than 17 out of 20 matches with any other site in the mouse genome. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. For injection into mouse embryos, a solution containing 50 ng/µl Cas9 mRNA (Life Technologies) and 20 ng/µl for each sgRNA used was prepared in nuclease free water.

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: The Cas9-gRNA efficiency test of four different gRNAs targeting CD2 was performed in vitro on column-purified 839 bp CD2 PCR products (Wizard SV Gel and PCR Clean-UP System, Promega) which were amplified using Taq PCR Master Mix Kit (Qiagen) and following primers: CD2 cut F: 5′-cct gac aga aag aac tc-3′, CD2 cut R: 5′-ctc act gct cct agg ca-3′. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature.

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: Transcribed sgRNAs were purified by using MEGAclear™ Transcription Clean‐Up Kit (Ambion® ) following the manufacturer's instructions. .. PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions. .. Briefly, each reaction containing 20 μl of nuclease‐free H2 O, 3 μl of 10× Cas9 buffer, 3 μl sgRNA (300 nM), and 1 μl Cas9 (1 μM) was incubated for 10 min at room temperature (RT).

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: Primers used for PCR amplification of the Fos locus are: FOS-F, 5’-GGCTGGCCCTGTATTCCTGAT-3’ and FOS-R, 5’-TCTTCTGACCCTTCCCTACTGAGC-3’ To synthesize gRNA in vitro , expression vectors were first linearized by digestion with DraI, treated with proteinase K, deproteinized by extraction with phenol:chloroform and precipitated. .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB).

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The yield of RNA for each construct is as follows: pDR274, 80 ug; pDR274-C24, 62 ug; pU6T7, 101 ug; pU6T7-C24, 49 ug; pU6T7G, 110 ug; pU6T7G-C24, 13 ug. .. All three in vitro transcribed C24 gRNAs cleaved the ROSA26 PCR amplicon when CAS9 protein is provided in trans ( , lanes 2, 4, 6). .. The RNAs obtained from in vitro transcription of empty vectors had no effect on the same ROSA26 target ( , lanes 1, 3, 5).

    Synthesized:

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The pCAG-T3-T7-hCAS-pA vector was linearized with SphI, purified and CAS9 mRNA was synthesized using the T7 mMessage mMachine Ultra kit (Life Technologies) but omitting the polyadenylation step. .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB).

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). .. The sgRNA was in vitro transcribed from a template using the MEGAscript® T7 Transcription Kit (Thermo Scientific).

    Construct:

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: This line has multiple integrations of a transgenic construct that expresses RFP from the ubi promoter, which is constitutively active in all cell types. .. We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT).

    Incubation:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Single-guide RNAs (sgRNAs) were generated that target sites near the ATG translation initiation site and the first GT splice donor sites for Ncor1, Ncor2, and Raldh2 plus sites flanking the Fgf8 RARE; sgRNAs were designed with maximum specificity using the tool at crispr.mit.edu to ensure that each sgRNA had no more than 17 out of 20 matches with any other site in the mouse genome. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. For injection into mouse embryos, a solution containing 50 ng/µl Cas9 mRNA (Life Technologies) and 20 ng/µl for each sgRNA used was prepared in nuclease free water.

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: The editing efficiency of the sgRNAs and the potential induced mutations were assessed using Tracking of Indels by Decomposition (TIDE) software ( https://tide-calculator.nki.nl ; Netherlands Cancer Institute), which only required two Sanger sequencing runs from wild-type cells and mutated cells. .. PCR products (approximately 100 ng per assay) were incubated for 30 minutes at 37°C with the Cas9 protein (New England Biolabs (NEB), Beverly, MA, USA) and α 9-nAChR sgRNA in 10 μ l of NEB buffer 3. .. After cleavage, RNase A (2 μ g) was added, and the reaction mixture was incubated for 15 minutes at 37°C to remove RNA.

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: After cleavage, RNase A (2 μ g) was added, and the reaction mixture was incubated for 15 minutes at 37°C to remove RNA. .. Next, proteinase K (2 μ g) was added, and the reaction mixture was incubated for 15 minutes at 58°C to remove the Cas9 protein. .. The products were resolved on 2% agarose gels and visualized with ethidium bromide (EtBr) staining.

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions. .. Briefly, each reaction containing 20 μl of nuclease‐free H2 O, 3 μl of 10× Cas9 buffer, 3 μl sgRNA (300 nM), and 1 μl Cas9 (1 μM) was incubated for 10 min at room temperature (RT).

    Article Title: CRISPR–Cas9-targeted fragmentation and selective sequencing enable massively parallel microsatellite analysis
    Article Snippet: Both simplex and multiplex adapters were annealed in a final concentration of 15 μM per adapter in Nuclease Free Duplex Buffer (IDT) by a 1% temperature ramp from 94 °C to 20 °C, after an initial 5 min 94 °C denaturation step. .. For each library, 500 ng or 1 μg gDNA was incubated in a 25-μl reaction mixture including 100 nM Cas9 nuclease, 1 × reaction buffer (New England Biolabs) and 100 nM gRNA pool. .. The reaction was incubated at 37 °C overnight, and then heat-inactivated at 70 °C for 10 min.

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The CAS9 mRNA was then purified using the Rneasy Cleanup kit (Qiagen). .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB). .. Template DNA was amplified by PCR and purified using a QIAquick PCR Purification kit (Qiagen).

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: Plasmids cloned with the L1 genes of various HPV subtypes (200 ng) were cut by the Cas9 proteins in complex with a pair of sgRNAs targeting to HPV16 and HPV18 L1 genes. .. The plasmid (200 ng) was mixed with the pre-assembled Cas9-sgRNA complex that contained 1× Cas9 nuclease reaction buffer, 30 nM Cas9 nuclease, 30 nM sgRNA a (16–1274 or 18–1490; Table ), and 30 nM sgRNA b (16–950 or 18–1274; Table ) and incubated at 37 °C for 5 min. .. The digestion reaction (5 μL) was mixed with 5 μL premix Taq (Takara) and incubated at 72 °C for 5 min.

    Activity Assay:

    Article Title: Nucleosomes Selectively Inhibit Cas9 Off-target Activity at a Site Located at the Nucleosome Edge
    Article Snippet: Cas9 enzyme (recombinant S. pyogenes Cas9, New England Biolabs) was preincubated with the indicated sgRNA at a 1:1.6 ratio of Cas9 to sgRNA for 30 min at 37 °C ( ) in 1× Cas9 reaction buffer (20 m m HEPES, 100 m m NaCl, 5 m m MgCl2 , 0.1 m m EDTA; New England Biolabs) prior to the addition of radiolabeled DNA or nucleosome substrates to the reactions. .. Cas9 enzyme (recombinant S. pyogenes Cas9, New England Biolabs) was preincubated with the indicated sgRNA at a 1:1.6 ratio of Cas9 to sgRNA for 30 min at 37 °C ( ) in 1× Cas9 reaction buffer (20 m m HEPES, 100 m m NaCl, 5 m m MgCl2 , 0.1 m m EDTA; New England Biolabs) prior to the addition of radiolabeled DNA or nucleosome substrates to the reactions.

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The CAS9 mRNA was then purified using the Rneasy Cleanup kit (Qiagen). .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB). .. Template DNA was amplified by PCR and purified using a QIAquick PCR Purification kit (Qiagen).

    Expressing:

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: Single copy “heat shock GESTALT” F1 transgenic adults were crossed to “inducible Cas9” F1 transgenic adults and one-cell embryos were injected with 1.5 nl of Cas9 protein (NEB) and sgRNAs 1–4 in salt solution (8 μM Cas9, 100 ng/μl pooled sgRNAs, 50 mM KCl, 3 mM MgCl2 , 5 mM Tris HCl pH 8.0, 0.05% phenol red). .. Injected embryos were first screened for GFP heart expression at 30 hpf to identify the “heat shock GESTALT” transgene These embryos were then heat shocked for 30 min at 37 C to induce Cas9 expression.

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: Primers used for PCR amplification of the Fos locus are: FOS-F, 5’-GGCTGGCCCTGTATTCCTGAT-3’ and FOS-R, 5’-TCTTCTGACCCTTCCCTACTGAGC-3’ To synthesize gRNA in vitro , expression vectors were first linearized by digestion with DraI, treated with proteinase K, deproteinized by extraction with phenol:chloroform and precipitated. .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB).

    Modification:

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: Using the MEGAshortscript T7 kit (Life Technologies), gRNAs were synthesized in vitro and purified with the MEGAclear kit (Life Technologies). pCAG-T3-hCAS-pA vector (plasmid # 48625, provided by Wataru Fujii & Kunihiko Naito, obtained from Addgene) was modified to contain a T7 promoter upstream of Cas9 and is designated pCAG-T3-T7-hCAS-pA (P. Romanienko, unpublished data). .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB).

    Countercurrent Chromatography:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: The Cas9-gRNA efficiency test of four different gRNAs targeting CD2 was performed in vitro on column-purified 839 bp CD2 PCR products (Wizard SV Gel and PCR Clean-UP System, Promega) which were amplified using Taq PCR Master Mix Kit (Qiagen) and following primers: CD2 cut F: 5′-cct gac aga aag aac tc-3′, CD2 cut R: 5′-ctc act gct cct agg ca-3′. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Transfection:

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: The result of the animal study showed the correction of the mutant fumaryl-acetoacetate hydrolase (FAH) genes and stabilization of the FAH protein; the type I tyrosinemia mice were furtherly found to have therapeutic effects of reducing hepatocellular toxicity and a rescue in weight loss of mice. .. In this manuscript, we combined lentiviral transfection with CRISPR/Cas9 techniques to deliver vectors that encode for Cas9 protein and the specific sgRNA to EGFR DNA sequence in SW579 cells. .. The use of lentivirus-based CRISPR/Cas9 is to ensure the high infection efficiency on target cells and can be possibly applied in vivo and in further clinical therapy.

    Cell Culture:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. Fertilized oocytes were then transferred into M2 medium (Millipore) and injected with the Cas9 mRNA/sgRNA solution into the cytoplasm.

    Generated:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Single-guide RNAs (sgRNAs) were generated that target sites near the ATG translation initiation site and the first GT splice donor sites for Ncor1, Ncor2, and Raldh2 plus sites flanking the Fgf8 RARE; sgRNAs were designed with maximum specificity using the tool at crispr.mit.edu to ensure that each sgRNA had no more than 17 out of 20 matches with any other site in the mouse genome. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. For injection into mouse embryos, a solution containing 50 ng/µl Cas9 mRNA (Life Technologies) and 20 ng/µl for each sgRNA used was prepared in nuclease free water.

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: sgRNAs specific to sites 1–4 of the GESTALT array were generated by in vitro transcription as previously described . .. Single copy “heat shock GESTALT” F1 transgenic adults were crossed to “inducible Cas9” F1 transgenic adults and one-cell embryos were injected with 1.5 nl of Cas9 protein (NEB) and sgRNAs 1–4 in salt solution (8 μM Cas9, 100 ng/μl pooled sgRNAs, 50 mM KCl, 3 mM MgCl2 , 5 mM Tris HCl pH 8.0, 0.05% phenol red).

    other:

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: The results indicated that the HPV16 and HPV18 L1 genes could be specifically targeted by their corresponding sgRNA and cut by the guided Cas9 nuclease (Fig. ).

    Sequencing:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Single-guide RNAs (sgRNAs) were generated that target sites near the ATG translation initiation site and the first GT splice donor sites for Ncor1, Ncor2, and Raldh2 plus sites flanking the Fgf8 RARE; sgRNAs were designed with maximum specificity using the tool at crispr.mit.edu to ensure that each sgRNA had no more than 17 out of 20 matches with any other site in the mouse genome. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. For injection into mouse embryos, a solution containing 50 ng/µl Cas9 mRNA (Life Technologies) and 20 ng/µl for each sgRNA used was prepared in nuclease free water.

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: In 2014, Yin and colleagues first reported the pioneer study to correct a genetic disease of type I tyrosinemia in postnatal animals by in vivo CRISPR/Cas9-mediated genome editing [ ]. .. The authors delivered vectors that encode for Cas9 protein and the specific sgRNA to target mutated DNA sequence through mouse tail vein injection. .. The result of the animal study showed the correction of the mutant fumaryl-acetoacetate hydrolase (FAH) genes and stabilization of the FAH protein; the type I tyrosinemia mice were furtherly found to have therapeutic effects of reducing hepatocellular toxicity and a rescue in weight loss of mice.

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: The result of the animal study showed the correction of the mutant fumaryl-acetoacetate hydrolase (FAH) genes and stabilization of the FAH protein; the type I tyrosinemia mice were furtherly found to have therapeutic effects of reducing hepatocellular toxicity and a rescue in weight loss of mice. .. In this manuscript, we combined lentiviral transfection with CRISPR/Cas9 techniques to deliver vectors that encode for Cas9 protein and the specific sgRNA to EGFR DNA sequence in SW579 cells. .. The use of lentivirus-based CRISPR/Cas9 is to ensure the high infection efficiency on target cells and can be possibly applied in vivo and in further clinical therapy.

    Article Title: CRISPR–Cas9-targeted fragmentation and selective sequencing enable massively parallel microsatellite analysis
    Article Snippet: Paragraph title: Targeted fragmentation and sequencing library preparation ... For each library, 500 ng or 1 μg gDNA was incubated in a 25-μl reaction mixture including 100 nM Cas9 nuclease, 1 × reaction buffer (New England Biolabs) and 100 nM gRNA pool.

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: All animal procedures were conducted as approved by the local authorities (LAGeSo, Berlin, Germany) under license number G0211/16. .. We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). .. Since injection efficiencies may vary , we selected embryos with low RFP fluorescence for single cell analysis.

    Injection:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis.

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: In 2014, Yin and colleagues first reported the pioneer study to correct a genetic disease of type I tyrosinemia in postnatal animals by in vivo CRISPR/Cas9-mediated genome editing [ ]. .. The authors delivered vectors that encode for Cas9 protein and the specific sgRNA to target mutated DNA sequence through mouse tail vein injection. .. The result of the animal study showed the correction of the mutant fumaryl-acetoacetate hydrolase (FAH) genes and stabilization of the FAH protein; the type I tyrosinemia mice were furtherly found to have therapeutic effects of reducing hepatocellular toxicity and a rescue in weight loss of mice.

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: sgRNAs specific to sites 1–4 of the GESTALT array were generated by in vitro transcription as previously described . .. Single copy “heat shock GESTALT” F1 transgenic adults were crossed to “inducible Cas9” F1 transgenic adults and one-cell embryos were injected with 1.5 nl of Cas9 protein (NEB) and sgRNAs 1–4 in salt solution (8 μM Cas9, 100 ng/μl pooled sgRNAs, 50 mM KCl, 3 mM MgCl2 , 5 mM Tris HCl pH 8.0, 0.05% phenol red). .. Injected embryos were first screened for GFP heart expression at 30 hpf to identify the “heat shock GESTALT” transgene These embryos were then heat shocked for 30 min at 37 C to induce Cas9 expression.

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: All animal procedures were conducted as approved by the local authorities (LAGeSo, Berlin, Germany) under license number G0211/16. .. We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). .. Since injection efficiencies may vary , we selected embryos with low RFP fluorescence for single cell analysis.

    Recombinant:

    Article Title: Nucleosomes Selectively Inhibit Cas9 Off-target Activity at a Site Located at the Nucleosome Edge
    Article Snippet: Cas9 endonuclease assays were performed in 20-μl reactions at 37 °C for various times: 0–30 min for the DNA time course; 0–60 min for the nucleosome time course; and 30 min for all other measurements. .. Cas9 enzyme (recombinant S. pyogenes Cas9, New England Biolabs) was preincubated with the indicated sgRNA at a 1:1.6 ratio of Cas9 to sgRNA for 30 min at 37 °C ( ) in 1× Cas9 reaction buffer (20 m m HEPES, 100 m m NaCl, 5 m m MgCl2 , 0.1 m m EDTA; New England Biolabs) prior to the addition of radiolabeled DNA or nucleosome substrates to the reactions. .. Reactions were terminated by adding phenol:chloroform:isoamyl alcohol (20:19:1), and the resulting cleavage products were analyzed by electrophoresis on 10% native polyacrylamide gels.

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: The recombinant Cas9 protein was purchased from New England Biolabs (NEB). .. The Cas9 digestion reaction (30 μL) consisted of 1× Cas9 Nuclease Reaction Buffer, 30 nM Cas9 Nuclease (NEB), 30 nM sgRNA a (16–1274 or 18–1490; Table ) and 30 nM sgRNA b (16–950 or 18–1274; Table ) was firstly incubated at 25 °C for 10 min (this process was referred to as pre-assemble hereafter).

    Cellular Antioxidant Activity Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: The Cas9-gRNA efficiency test of four different gRNAs targeting CD2 was performed in vitro on column-purified 839 bp CD2 PCR products (Wizard SV Gel and PCR Clean-UP System, Promega) which were amplified using Taq PCR Master Mix Kit (Qiagen) and following primers: CD2 cut F: 5′-cct gac aga aag aac tc-3′, CD2 cut R: 5′-ctc act gct cct agg ca-3′. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Nucleic Acid Electrophoresis:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Single-guide RNAs (sgRNAs) were generated that target sites near the ATG translation initiation site and the first GT splice donor sites for Ncor1, Ncor2, and Raldh2 plus sites flanking the Fgf8 RARE; sgRNAs were designed with maximum specificity using the tool at crispr.mit.edu to ensure that each sgRNA had no more than 17 out of 20 matches with any other site in the mouse genome. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. For injection into mouse embryos, a solution containing 50 ng/µl Cas9 mRNA (Life Technologies) and 20 ng/µl for each sgRNA used was prepared in nuclease free water.

    DNA Cleavage Assay:

    Article Title: A versatile reporter system for CRISPR-mediated chromosomal rearrangements
    Article Snippet: Paragraph title: Plasmid DNA cleavage assay ... Cas9 protein (NEB) and sgRNA were pre-incubated for 10 min at 37 °C according to NEB protocols.

    Fluorescence:

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: All animal procedures were conducted as approved by the local authorities (LAGeSo, Berlin, Germany) under license number G0211/16. .. We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). .. Since injection efficiencies may vary , we selected embryos with low RFP fluorescence for single cell analysis.

    Purification:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Single-guide RNAs (sgRNAs) were generated that target sites near the ATG translation initiation site and the first GT splice donor sites for Ncor1, Ncor2, and Raldh2 plus sites flanking the Fgf8 RARE; sgRNAs were designed with maximum specificity using the tool at crispr.mit.edu to ensure that each sgRNA had no more than 17 out of 20 matches with any other site in the mouse genome. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. For injection into mouse embryos, a solution containing 50 ng/µl Cas9 mRNA (Life Technologies) and 20 ng/µl for each sgRNA used was prepared in nuclease free water.

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: The Cas9-gRNA efficiency test of four different gRNAs targeting CD2 was performed in vitro on column-purified 839 bp CD2 PCR products (Wizard SV Gel and PCR Clean-UP System, Promega) which were amplified using Taq PCR Master Mix Kit (Qiagen) and following primers: CD2 cut F: 5′-cct gac aga aag aac tc-3′, CD2 cut R: 5′-ctc act gct cct agg ca-3′. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: Transcribed sgRNAs were purified by using MEGAclear™ Transcription Clean‐Up Kit (Ambion® ) following the manufacturer's instructions. .. PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions.

    Article Title: CRISPR–Cas9-targeted fragmentation and selective sequencing enable massively parallel microsatellite analysis
    Article Snippet: For each library, 500 ng or 1 μg gDNA was incubated in a 25-μl reaction mixture including 100 nM Cas9 nuclease, 1 × reaction buffer (New England Biolabs) and 100 nM gRNA pool. .. The reaction was incubated at 37 °C overnight, and then heat-inactivated at 70 °C for 10 min.

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The CAS9 mRNA was then purified using the Rneasy Cleanup kit (Qiagen). .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB).

    Polymerase Chain Reaction:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Single-guide RNAs (sgRNAs) were generated that target sites near the ATG translation initiation site and the first GT splice donor sites for Ncor1, Ncor2, and Raldh2 plus sites flanking the Fgf8 RARE; sgRNAs were designed with maximum specificity using the tool at crispr.mit.edu to ensure that each sgRNA had no more than 17 out of 20 matches with any other site in the mouse genome. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. For injection into mouse embryos, a solution containing 50 ng/µl Cas9 mRNA (Life Technologies) and 20 ng/µl for each sgRNA used was prepared in nuclease free water.

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: The Cas9-gRNA efficiency test of four different gRNAs targeting CD2 was performed in vitro on column-purified 839 bp CD2 PCR products (Wizard SV Gel and PCR Clean-UP System, Promega) which were amplified using Taq PCR Master Mix Kit (Qiagen) and following primers: CD2 cut F: 5′-cct gac aga aag aac tc-3′, CD2 cut R: 5′-ctc act gct cct agg ca-3′. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: The editing efficiency of the sgRNAs and the potential induced mutations were assessed using Tracking of Indels by Decomposition (TIDE) software ( https://tide-calculator.nki.nl ; Netherlands Cancer Institute), which only required two Sanger sequencing runs from wild-type cells and mutated cells. .. PCR products (approximately 100 ng per assay) were incubated for 30 minutes at 37°C with the Cas9 protein (New England Biolabs (NEB), Beverly, MA, USA) and α 9-nAChR sgRNA in 10 μ l of NEB buffer 3. .. After cleavage, RNase A (2 μ g) was added, and the reaction mixture was incubated for 15 minutes at 37°C to remove RNA.

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: Transcribed sgRNAs were purified by using MEGAclear™ Transcription Clean‐Up Kit (Ambion® ) following the manufacturer's instructions. .. PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions. .. Briefly, each reaction containing 20 μl of nuclease‐free H2 O, 3 μl of 10× Cas9 buffer, 3 μl sgRNA (300 nM), and 1 μl Cas9 (1 μM) was incubated for 10 min at room temperature (RT).

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: Primers used for PCR amplification of the Fos locus are: FOS-F, 5’-GGCTGGCCCTGTATTCCTGAT-3’ and FOS-R, 5’-TCTTCTGACCCTTCCCTACTGAGC-3’ To synthesize gRNA in vitro , expression vectors were first linearized by digestion with DraI, treated with proteinase K, deproteinized by extraction with phenol:chloroform and precipitated. .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB).

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The yield of RNA for each construct is as follows: pDR274, 80 ug; pDR274-C24, 62 ug; pU6T7, 101 ug; pU6T7-C24, 49 ug; pU6T7G, 110 ug; pU6T7G-C24, 13 ug. .. All three in vitro transcribed C24 gRNAs cleaved the ROSA26 PCR amplicon when CAS9 protein is provided in trans ( , lanes 2, 4, 6). .. The RNAs obtained from in vitro transcription of empty vectors had no effect on the same ROSA26 target ( , lanes 1, 3, 5).

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: It was also found that ctPCR could detect and type HPVs in clinical samples. .. This study developed a new method for detecting target DNA based on Cas9 nuclease, which was named as ctPCR, representing the Cas9-sgRNA-typing PCR. .. This method was verified by detecting the L1 genes of two high-risk HPVs (HPV16 and HPV18) from 11 HPV subtypes successfully.

    Selection:

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: Paragraph title: sgRNA selection, screening, preparation, and validation ... PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions.

    CRISPR:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Paragraph title: 4.2. CRISPR/Cas9 gene editing of mouse embryos ... DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis.

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: The result of the animal study showed the correction of the mutant fumaryl-acetoacetate hydrolase (FAH) genes and stabilization of the FAH protein; the type I tyrosinemia mice were furtherly found to have therapeutic effects of reducing hepatocellular toxicity and a rescue in weight loss of mice. .. In this manuscript, we combined lentiviral transfection with CRISPR/Cas9 techniques to deliver vectors that encode for Cas9 protein and the specific sgRNA to EGFR DNA sequence in SW579 cells. .. The use of lentivirus-based CRISPR/Cas9 is to ensure the high infection efficiency on target cells and can be possibly applied in vivo and in further clinical therapy.

    Activated Clotting Time Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: The Cas9-gRNA efficiency test of four different gRNAs targeting CD2 was performed in vitro on column-purified 839 bp CD2 PCR products (Wizard SV Gel and PCR Clean-UP System, Promega) which were amplified using Taq PCR Master Mix Kit (Qiagen) and following primers: CD2 cut F: 5′-cct gac aga aag aac tc-3′, CD2 cut R: 5′-ctc act gct cct agg ca-3′. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Mouse Assay:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. Fertilized oocytes were then transferred into M2 medium (Millipore) and injected with the Cas9 mRNA/sgRNA solution into the cytoplasm.

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: Transcribed sgRNAs were purified by using MEGAclear™ Transcription Clean‐Up Kit (Ambion® ) following the manufacturer's instructions. .. PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions. .. Briefly, each reaction containing 20 μl of nuclease‐free H2 O, 3 μl of 10× Cas9 buffer, 3 μl sgRNA (300 nM), and 1 μl Cas9 (1 μM) was incubated for 10 min at room temperature (RT).

    Plasmid Preparation:

    Article Title: A versatile reporter system for CRISPR-mediated chromosomal rearrangements
    Article Snippet: Paragraph title: Plasmid DNA cleavage assay ... Cas9 protein (NEB) and sgRNA were pre-incubated for 10 min at 37 °C according to NEB protocols.

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The pCAG-T3-T7-hCAS-pA vector was linearized with SphI, purified and CAS9 mRNA was synthesized using the T7 mMessage mMachine Ultra kit (Life Technologies) but omitting the polyadenylation step. .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB).

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: Paragraph title: Cleavage of HPV L1 genes cloned in plasmid with Cas9-sgRNA ... The Cas9 digestion reaction (30 μL) consisted of 1× Cas9 Nuclease Reaction Buffer, 30 nM Cas9 Nuclease (NEB), 30 nM sgRNA a (16–1274 or 18–1490; Table ) and 30 nM sgRNA b (16–950 or 18–1274; Table ) was firstly incubated at 25 °C for 10 min (this process was referred to as pre-assemble hereafter).

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: Plasmids cloned with the L1 genes of various HPV subtypes (200 ng) were cut by the Cas9 proteins in complex with a pair of sgRNAs targeting to HPV16 and HPV18 L1 genes. .. The plasmid (200 ng) was mixed with the pre-assembled Cas9-sgRNA complex that contained 1× Cas9 nuclease reaction buffer, 30 nM Cas9 nuclease, 30 nM sgRNA a (16–1274 or 18–1490; Table ), and 30 nM sgRNA b (16–950 or 18–1274; Table ) and incubated at 37 °C for 5 min. .. The digestion reaction (5 μL) was mixed with 5 μL premix Taq (Takara) and incubated at 72 °C for 5 min.

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: After overnight cultivation, agar plates were imaged. .. We found that the E . coli with a HPV L1 plasmid was always specifically killed by Cas9 nuclease guided by sgRNA specific to the HPV L1 gene (Fig. ). .. These results revealed that the designed sgRNA could specifically target to its target and the Cas9-sgRNA could be used to type HPV subtypes.

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: We firstly linearized the plasmids cloned with the HPV16 and HPV18 L1 genes with a restriction endonuclease, AatII, which produced linear DNA fragments ended with a 4-base 3′ overhang. .. We cut the linearized HPV16 and HPV18 L1 plasmid DNAs with Cas9 nuclease in complex with the sgRNAs specific to HPV16 and HPV18 L1 genes (Table ). .. The results indicated that the HPV16 and HPV18 L1 genes could be specifically targeted by their corresponding sgRNA and cut by the guided Cas9 nuclease (Fig. ).

    Negative Control:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: One AmpliGrid slide consists of 48 wells, of which every sixth sample was not loaded with a cell and served as negative control. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature.

    Binding Assay:

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). .. The sgRNA was in vitro transcribed from a template using the MEGAscript® T7 Transcription Kit (Thermo Scientific).

    Agarose Gel Electrophoresis:

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions. .. Briefly, each reaction containing 20 μl of nuclease‐free H2 O, 3 μl of 10× Cas9 buffer, 3 μl sgRNA (300 nM), and 1 μl Cas9 (1 μM) was incubated for 10 min at room temperature (RT).

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: The Cas9 digestion reaction (30 μL) consisted of 1× Cas9 Nuclease Reaction Buffer, 30 nM Cas9 Nuclease (NEB), 30 nM sgRNA a (16–1274 or 18–1490; Table ) and 30 nM sgRNA b (16–950 or 18–1274; Table ) was firstly incubated at 25 °C for 10 min (this process was referred to as pre-assemble hereafter). .. Two hundred ng of substrate DNA (L1 plasmid DNA linearized by AatII) mixed with above solution was incubated at 37 °C for 5 min.

    In Vitro:

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis
    Article Snippet: Single-guide RNAs (sgRNAs) were generated that target sites near the ATG translation initiation site and the first GT splice donor sites for Ncor1, Ncor2, and Raldh2 plus sites flanking the Fgf8 RARE; sgRNAs were designed with maximum specificity using the tool at crispr.mit.edu to ensure that each sgRNA had no more than 17 out of 20 matches with any other site in the mouse genome. .. DNA templates for sgRNAs were generated by PCR amplification (Phusion DNA Polymerase; New England Biolabs) of ssDNA oligonucleotides (purchased from Integrated DNA Technologies) containing on the 5' end a minimal T7 promoter, then a 20 nucleotide sgRNA target sequence (underlined below), and finally the tracrRNA sequence utilized by Cas9 on the 3' end, shown as follows: 5'-GCGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' The 20 nucleotide target sequences used were as follows: Ncor1 ATG (TTACTGATAATGTCAAGTTC), Ncor1 1st splice donor site (GTACCCGACACCAGCAGGTA), Ncor2 ATG (CTGGACCCTACCACCATGTC), Ncor2 1st splice donor site (TAGCCCGGTCCCACACGGTA), Raldh2 ATG (CTGCAGCGAGGCCATGAGCG), Raldh2 1st splice donor site (TCCGCCGGACGGCTTTACCT), Fgf8 RARE upstream (TGCTGAACTGCTGACCCCGG), Fgf8 RARE downstream (TGTTGATGGGTTGGGATGGG). sgRNAs were then transcribed from templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using Megaclear Kit (Life Technologies). sgRNAs were tested in vitro for their cleavage ability in combination with Cas9 nuclease (New England Biolabs); briefly, genomic regions flanking the target sites were PCR amplified, then 100 ng was incubated with 30 nM Cas9 nuclease and 30 ng sgRNA in 30 µl for 1 hour at 37°C, followed by analysis for cleavage by gel electrophoresis. .. For injection into mouse embryos, a solution containing 50 ng/µl Cas9 mRNA (Life Technologies) and 20 ng/µl for each sgRNA used was prepared in nuclease free water.

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: The Cas9-gRNA efficiency test of four different gRNAs targeting CD2 was performed in vitro on column-purified 839 bp CD2 PCR products (Wizard SV Gel and PCR Clean-UP System, Promega) which were amplified using Taq PCR Master Mix Kit (Qiagen) and following primers: CD2 cut F: 5′-cct gac aga aag aac tc-3′, CD2 cut R: 5′-ctc act gct cct agg ca-3′. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature.

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: sgRNAs specific to sites 1–4 of the GESTALT array were generated by in vitro transcription as previously described . .. Single copy “heat shock GESTALT” F1 transgenic adults were crossed to “inducible Cas9” F1 transgenic adults and one-cell embryos were injected with 1.5 nl of Cas9 protein (NEB) and sgRNAs 1–4 in salt solution (8 μM Cas9, 100 ng/μl pooled sgRNAs, 50 mM KCl, 3 mM MgCl2 , 5 mM Tris HCl pH 8.0, 0.05% phenol red).

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: Transcribed sgRNAs were purified by using MEGAclear™ Transcription Clean‐Up Kit (Ambion® ) following the manufacturer's instructions. .. PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions. .. Briefly, each reaction containing 20 μl of nuclease‐free H2 O, 3 μl of 10× Cas9 buffer, 3 μl sgRNA (300 nM), and 1 μl Cas9 (1 μM) was incubated for 10 min at room temperature (RT).

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The CAS9 mRNA was then purified using the Rneasy Cleanup kit (Qiagen). .. To test for DNA cleavage activity in vitro , Rosa26 target DNA template and Fos control DNA template were incubated with gRNA and Cas9 protein (NEB) following the protocol provided by the vendor (NEB). .. Template DNA was amplified by PCR and purified using a QIAquick PCR Purification kit (Qiagen).

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: SgRNAs were prepared by in vitro transcription as described in detail in the Supplemental Information. .. The Cas9 digestion reaction (30 μL) consisted of 1× Cas9 Nuclease Reaction Buffer, 30 nM Cas9 Nuclease (NEB), 30 nM sgRNA a (16–1274 or 18–1490; Table ) and 30 nM sgRNA b (16–950 or 18–1274; Table ) was firstly incubated at 25 °C for 10 min (this process was referred to as pre-assemble hereafter).

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs
    Article Snippet: The yield of RNA for each construct is as follows: pDR274, 80 ug; pDR274-C24, 62 ug; pU6T7, 101 ug; pU6T7-C24, 49 ug; pU6T7G, 110 ug; pU6T7G-C24, 13 ug. .. All three in vitro transcribed C24 gRNAs cleaved the ROSA26 PCR amplicon when CAS9 protein is provided in trans ( , lanes 2, 4, 6). .. The RNAs obtained from in vitro transcription of empty vectors had no effect on the same ROSA26 target ( , lanes 1, 3, 5).

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). .. For control experiments in we set up crosses between pairs of adult Cas9 injected fish.

    Transgenic Assay:

    Article Title: Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain
    Article Snippet: sgRNAs specific to sites 1–4 of the GESTALT array were generated by in vitro transcription as previously described . .. Single copy “heat shock GESTALT” F1 transgenic adults were crossed to “inducible Cas9” F1 transgenic adults and one-cell embryos were injected with 1.5 nl of Cas9 protein (NEB) and sgRNAs 1–4 in salt solution (8 μM Cas9, 100 ng/μl pooled sgRNAs, 50 mM KCl, 3 mM MgCl2 , 5 mM Tris HCl pH 8.0, 0.05% phenol red). .. Injected embryos were first screened for GFP heart expression at 30 hpf to identify the “heat shock GESTALT” transgene These embryos were then heat shocked for 30 min at 37 C to induce Cas9 expression.

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: This line has multiple integrations of a transgenic construct that expresses RFP from the ubi promoter, which is constitutively active in all cell types. .. We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT).

    Concentration Assay:

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: All animal procedures were conducted as approved by the local authorities (LAGeSo, Berlin, Germany) under license number G0211/16. .. We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). .. Since injection efficiencies may vary , we selected embryos with low RFP fluorescence for single cell analysis.

    CTG Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: The Cas9-gRNA efficiency test of four different gRNAs targeting CD2 was performed in vitro on column-purified 839 bp CD2 PCR products (Wizard SV Gel and PCR Clean-UP System, Promega) which were amplified using Taq PCR Master Mix Kit (Qiagen) and following primers: CD2 cut F: 5′-cct gac aga aag aac tc-3′, CD2 cut R: 5′-ctc act gct cct agg ca-3′. .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Staining:

    Article Title: CRISPR/Cas9 Genome Editing of Epidermal Growth Factor Receptor Sufficiently Abolished Oncogenicity in Anaplastic Thyroid Cancer
    Article Snippet: PCR products (approximately 100 ng per assay) were incubated for 30 minutes at 37°C with the Cas9 protein (New England Biolabs (NEB), Beverly, MA, USA) and α 9-nAChR sgRNA in 10 μ l of NEB buffer 3. .. Next, proteinase K (2 μ g) was added, and the reaction mixture was incubated for 15 minutes at 58°C to remove the Cas9 protein.

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice
    Article Snippet: PCR amplification of genomic DNA fragments from C57Bl/6 control mice (target and off‐target) was performed using gene‐specific primers ( ) under the following conditions: 98°C for 2 min; 40× (98°C for 20 s, 55°C for 30 s, and 72°C for 1 min); 72°C for 5 min; hold at 4°C; and subsequently sequenced. sgRNA validation was performed by using in vitro digestion with Cas9 nuclease, S. pyogenes assay (NEB) following the manufacturer's instructions. .. Briefly, each reaction containing 20 μl of nuclease‐free H2 O, 3 μl of 10× Cas9 buffer, 3 μl sgRNA (300 nM), and 1 μl Cas9 (1 μM) was incubated for 10 min at room temperature (RT).

    Fluorescence In Situ Hybridization:

    Article Title: Simultaneous lineage tracing and cell-type identification using CRISPR/Cas9-induced genetic scars
    Article Snippet: We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). .. We set up crosses between zebrabow M adults with high RFP fluorescence, and we injected the embryos at the 1-cell stage with 2 nl Cas9 protein (NEB, final concentration 350 ng/µl) in combination with an sgRNA targeting RFP (final concentration 50 ng/µl, sequence: GGTGTCCACGTAGTAGTAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 98
    New England Biolabs cas9 nuclease
    CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a <t>CRISPR/Cas9</t> negative selection genetic screen (Kolmogorov–Smirnov test, p
    Cas9 Nuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 nuclease/product/New England Biolabs
    Average 98 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    cas9 nuclease - by Bioz Stars, 2019-10
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs cas9 protein
    CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a <t>CRISPR/Cas9</t> negative selection genetic screen (Kolmogorov–Smirnov test, p
    Cas9 Protein, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 protein/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    cas9 protein - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a CRISPR/Cas9 negative selection genetic screen (Kolmogorov–Smirnov test, p

    Journal: PLoS ONE

    Article Title: Clustering-local-unique-enriched-signals (CLUES) promotes identification of novel regulators of ES cell self-renewal and pluripotency

    doi: 10.1371/journal.pone.0206844

    Figure Lengend Snippet: CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a CRISPR/Cas9 negative selection genetic screen (Kolmogorov–Smirnov test, p

    Article Snippet: Cas9 Nuclease (M0386, NEB) was used to perform in vitro cleavage on the same amount of input plasmid.

    Techniques: RNA Sequencing Assay, Chromatin Immunoprecipitation, CRISPR, Selection