cas9 nuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    Cas9 Nuclease S pyogenes
    Description:
    Cas9 Nuclease S pyogenes 2 000 pmol
    Catalog Number:
    m0386m
    Price:
    540
    Size:
    2 000 pmol
    Category:
    Other Endonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs cas9 nuclease
    Cas9 Nuclease S pyogenes
    Cas9 Nuclease S pyogenes 2 000 pmol
    https://www.bioz.com/result/cas9 nuclease/product/New England Biolabs
    Average 98 stars, based on 80 article reviews
    Price from $9.99 to $1999.99
    cas9 nuclease - by Bioz Stars, 2020-05
    98/100 stars

    Images

    1) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    2) Product Images from "Whole exome sequencing of ENU-induced thrombosis modifier mutations in the mouse"

    Article Title: Whole exome sequencing of ENU-induced thrombosis modifier mutations in the mouse

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007658

    An independent CRISPR/Cas9 induced Plcb4 allele validates the rescue phenotype. A) The CRISPR/Cas9-induced Plcb4 ins1 allele (insertion of the nucleotide ‘A’ at amino acid 328) results in a frameshift to the protein coding sequence leading to a premature stop codon. B) Sanger sequencing analysis of gDNA from a wildtype mouse and both gDNA and cDNA from a Plcb4 +/ins1 mouse at the Plcb4 1bp insertion site. C) 169 progeny genotyped from a validation cross of F5 L/L Plcb4 +/ins1 mice with F5 L/+ Tfpi +/- .
    Figure Legend Snippet: An independent CRISPR/Cas9 induced Plcb4 allele validates the rescue phenotype. A) The CRISPR/Cas9-induced Plcb4 ins1 allele (insertion of the nucleotide ‘A’ at amino acid 328) results in a frameshift to the protein coding sequence leading to a premature stop codon. B) Sanger sequencing analysis of gDNA from a wildtype mouse and both gDNA and cDNA from a Plcb4 +/ins1 mouse at the Plcb4 1bp insertion site. C) 169 progeny genotyped from a validation cross of F5 L/L Plcb4 +/ins1 mice with F5 L/+ Tfpi +/- .

    Techniques Used: CRISPR, Sequencing, Mouse Assay

    3) Product Images from "Chromatin-remodeling factor SMARCD2 regulates transcriptional networks controlling differentiation of neutrophil granulocytes"

    Article Title: Chromatin-remodeling factor SMARCD2 regulates transcriptional networks controlling differentiation of neutrophil granulocytes

    Journal: Nature genetics

    doi: 10.1038/ng.3833

    Smarcd2 deficiency in zebrafish. ( a ) Neutrophil numbers in Tg( lyz : dsRed ) nz50 zebrafish at 72 h.p.f. after injection with MOs (control (CRTL) versus translation-start-site blocker (ATG) and splice-site blocker (SB1 and SB2) MOs targeting smarcd2 ). Data represent the numbers of fluorescence-labeled neutrophils per individual fish embryo. Pooled data from two independent MO experiments are shown: CTRL n = 16, ATG n = 16, SB1 n = 16, SB2 n = 16 fish. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t test. Replicates: 2. ( b ) Representative fluorescence images of zebrafish strain Tg( mpx : EGFP ) i114 : smarcd2 wt/wt (wild type) and smarcd2 1/1 (knockout). Reduced numbers of GFP-expressing neutrophils are observed in smarcd2 1/1 mutant fish embryos. Acquired images: smarcd2 wt/wt ( n = 37 images) and smarcd2 1/1 ( n = 10 images). ( c ) Enumeration of neutrophils in smarcd2 wt/wt versus smarcd2 1/1 zebrafish. Numbers of fluorescence-labeled neutrophils were evaluated in caudal hematopoietic tissue for individual fish embryos. n = 38 smarcd2 wt/wt and n = 10 smarcd2 1/1 fish were evaluated in two independent CRISPR/Cas9 experiments. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t .
    Figure Legend Snippet: Smarcd2 deficiency in zebrafish. ( a ) Neutrophil numbers in Tg( lyz : dsRed ) nz50 zebrafish at 72 h.p.f. after injection with MOs (control (CRTL) versus translation-start-site blocker (ATG) and splice-site blocker (SB1 and SB2) MOs targeting smarcd2 ). Data represent the numbers of fluorescence-labeled neutrophils per individual fish embryo. Pooled data from two independent MO experiments are shown: CTRL n = 16, ATG n = 16, SB1 n = 16, SB2 n = 16 fish. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t test. Replicates: 2. ( b ) Representative fluorescence images of zebrafish strain Tg( mpx : EGFP ) i114 : smarcd2 wt/wt (wild type) and smarcd2 1/1 (knockout). Reduced numbers of GFP-expressing neutrophils are observed in smarcd2 1/1 mutant fish embryos. Acquired images: smarcd2 wt/wt ( n = 37 images) and smarcd2 1/1 ( n = 10 images). ( c ) Enumeration of neutrophils in smarcd2 wt/wt versus smarcd2 1/1 zebrafish. Numbers of fluorescence-labeled neutrophils were evaluated in caudal hematopoietic tissue for individual fish embryos. n = 38 smarcd2 wt/wt and n = 10 smarcd2 1/1 fish were evaluated in two independent CRISPR/Cas9 experiments. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t .

    Techniques Used: Injection, Fluorescence, Labeling, Fluorescence In Situ Hybridization, Two Tailed Test, Knock-Out, Expressing, Mutagenesis, CRISPR

    4) Product Images from "Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation"

    Article Title: Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation

    Journal: Small (Weinheim an der Bergstrasse, Germany)

    doi: 10.1002/smll.201702495

    CRISP/Cas9 gene knockout using single-cell electroporation. a) Patterned EGFP-HEK293 cells colonies transfected using the NFP-E with Cas9 nuclease and a specific guide RNA targeting EGFP. All cells of a colony of 14 cells were transfected on day 1 with Cas9/gRNA. b) On day 3, transfected cells multiplied but only three cells in the colony remained positive for GFP fluorescence signal, consistent with knockout of EGFP. c) A nontransfected control colony exhibiting EGFP signal in all cells.
    Figure Legend Snippet: CRISP/Cas9 gene knockout using single-cell electroporation. a) Patterned EGFP-HEK293 cells colonies transfected using the NFP-E with Cas9 nuclease and a specific guide RNA targeting EGFP. All cells of a colony of 14 cells were transfected on day 1 with Cas9/gRNA. b) On day 3, transfected cells multiplied but only three cells in the colony remained positive for GFP fluorescence signal, consistent with knockout of EGFP. c) A nontransfected control colony exhibiting EGFP signal in all cells.

    Techniques Used: Gene Knockout, Electroporation, Transfection, Fluorescence, Knock-Out

    5) Product Images from "Clustering-local-unique-enriched-signals (CLUES) promotes identification of novel regulators of ES cell self-renewal and pluripotency"

    Article Title: Clustering-local-unique-enriched-signals (CLUES) promotes identification of novel regulators of ES cell self-renewal and pluripotency

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0206844

    CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a CRISPR/Cas9 negative selection genetic screen (Kolmogorov–Smirnov test, p
    Figure Legend Snippet: CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a CRISPR/Cas9 negative selection genetic screen (Kolmogorov–Smirnov test, p

    Techniques Used: RNA Sequencing Assay, Chromatin Immunoprecipitation, CRISPR, Selection

    6) Product Images from "Efficacy of In Vivo Electroporation on the Delivery of Molecular Agents into Aphid (Hemiptera: Aphididae) Ovarioles"

    Article Title: Efficacy of In Vivo Electroporation on the Delivery of Molecular Agents into Aphid (Hemiptera: Aphididae) Ovarioles

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/iey041

    Image depicting the electroporation station (a) and the electroporation device (b) used to introduce the CRISPR/Cas9 complex into aphid offspring in vivo.
    Figure Legend Snippet: Image depicting the electroporation station (a) and the electroporation device (b) used to introduce the CRISPR/Cas9 complex into aphid offspring in vivo.

    Techniques Used: Electroporation, Introduce, CRISPR, In Vivo

    Bar graphs representing total aphid offspring per day for 4 d following microinjection and electroporation trials. Graphs represent aphid offspring from the Trial 1: CRISPR treatment, the Trial 2: CRISPR treatment, and the three control treatments: Carrier RNA, Carrier RNA + Cas9, and Cas9.
    Figure Legend Snippet: Bar graphs representing total aphid offspring per day for 4 d following microinjection and electroporation trials. Graphs represent aphid offspring from the Trial 1: CRISPR treatment, the Trial 2: CRISPR treatment, and the three control treatments: Carrier RNA, Carrier RNA + Cas9, and Cas9.

    Techniques Used: Electroporation, CRISPR

    7) Product Images from "Antibody discovery and engineering by enhanced CRISPR-Cas9 integration of variable gene cassette libraries in mammalian cells"

    Article Title: Antibody discovery and engineering by enhanced CRISPR-Cas9 integration of variable gene cassette libraries in mammalian cells

    Journal: mAbs

    doi: 10.1080/19420862.2019.1662691

    Enhanced Cas9-driven HDR by designing a self-linearized donor plasmid. (a) Schematic shows the PnP workflow to reprogram mRuby hybridomas to express a selected antibody following incorporation of a recombinant synthetic antibody in the V H locus. 27 (b) Optimized workflow in which a version of the PnP-mRuby cells constitutively expressing Cas9 26 is used together with an HDR donor plasmid harboring a recognition site for the same Cas9 gRNA that is used to cleave mRuby (protospacer adjacent motif is indicated in red). Following entry of the plasmid and the gRNA complex into the nucleus, Cas9, which is also targeted to the nucleus due to its nuclear localization signal, is recruited to both induce a DSB in the genomic mRuby coding sequence and linearize the plasmid, rendering it more prone to integration by HDR. (c) In vitro testing of plasmid cleavage by recombinant Cas9. Three versions of the self-linearizing plasmid were generated, bearing the cleavage site upstream of the 5ʹ homology arm (pPnP-lin5ʹ), downstream of the 3ʹ homology arm (pPnP-lin3ʹ) and at both sites (pPnP-lin5ʹ/3ʹ). As expected, in the first two cases Cas9 cleavage produced a linearized construct, while the double-cut plasmid underwent both single cleavage at either site or simultaneous cleavage at both, resulting in a shorter construct. (d) Exemplary flow cytometry dot plots show evaluation of HDR integration. The improved plasmids were compared to the unmodified plasmid (pPnP) and to the PCR-linearized donor (PCR). HDR efficiency is evaluated in terms of surface antibody expression 3 d after transfection. (e) Fold improvement of HDR rates of all the linearized donor formats compared to the mean of unmodified plasmid. HDR efficiency is quantified as described in (d). The plot is representative of n = 3 replicates and the error bars indicate standard deviation. Flow cytometry dot plots of all replicates are shown in Figure S1.
    Figure Legend Snippet: Enhanced Cas9-driven HDR by designing a self-linearized donor plasmid. (a) Schematic shows the PnP workflow to reprogram mRuby hybridomas to express a selected antibody following incorporation of a recombinant synthetic antibody in the V H locus. 27 (b) Optimized workflow in which a version of the PnP-mRuby cells constitutively expressing Cas9 26 is used together with an HDR donor plasmid harboring a recognition site for the same Cas9 gRNA that is used to cleave mRuby (protospacer adjacent motif is indicated in red). Following entry of the plasmid and the gRNA complex into the nucleus, Cas9, which is also targeted to the nucleus due to its nuclear localization signal, is recruited to both induce a DSB in the genomic mRuby coding sequence and linearize the plasmid, rendering it more prone to integration by HDR. (c) In vitro testing of plasmid cleavage by recombinant Cas9. Three versions of the self-linearizing plasmid were generated, bearing the cleavage site upstream of the 5ʹ homology arm (pPnP-lin5ʹ), downstream of the 3ʹ homology arm (pPnP-lin3ʹ) and at both sites (pPnP-lin5ʹ/3ʹ). As expected, in the first two cases Cas9 cleavage produced a linearized construct, while the double-cut plasmid underwent both single cleavage at either site or simultaneous cleavage at both, resulting in a shorter construct. (d) Exemplary flow cytometry dot plots show evaluation of HDR integration. The improved plasmids were compared to the unmodified plasmid (pPnP) and to the PCR-linearized donor (PCR). HDR efficiency is evaluated in terms of surface antibody expression 3 d after transfection. (e) Fold improvement of HDR rates of all the linearized donor formats compared to the mean of unmodified plasmid. HDR efficiency is quantified as described in (d). The plot is representative of n = 3 replicates and the error bars indicate standard deviation. Flow cytometry dot plots of all replicates are shown in Figure S1.

    Techniques Used: Plasmid Preparation, Recombinant, Expressing, Sequencing, In Vitro, Generated, Produced, Construct, Flow Cytometry, Cytometry, Polymerase Chain Reaction, Transfection, Standard Deviation

    Characterization of the antibody discovered from immune library screening. (a) Lineage tree of the 41 unique clones retrieved after single-cell sorting. Somatic hypermutations (SHM) refer to non-silent amino acid changes to the V-germline gene. The five clones highlighted in blue were selected as representative due to sequence diversity. V- and J-germline gene usage, CDRH3 sequences and amino acid changes were retrieved via IMGT/V-quest ( http://www.imgt.org/IMGT_vquest/vquest ). (b) Supernatant ELISA of the five clones highlighted in (a) and whose surface expression profile is shown in Figure 2c . Two technical replicates were included for each sample and a five-parameter logistical curve was fitted to the data by nonlinear regression. For each data point, the mean is represented and the error bars indicate standard deviation. PnP-mRuby-Cas9 cell supernatant was used as negative control.
    Figure Legend Snippet: Characterization of the antibody discovered from immune library screening. (a) Lineage tree of the 41 unique clones retrieved after single-cell sorting. Somatic hypermutations (SHM) refer to non-silent amino acid changes to the V-germline gene. The five clones highlighted in blue were selected as representative due to sequence diversity. V- and J-germline gene usage, CDRH3 sequences and amino acid changes were retrieved via IMGT/V-quest ( http://www.imgt.org/IMGT_vquest/vquest ). (b) Supernatant ELISA of the five clones highlighted in (a) and whose surface expression profile is shown in Figure 2c . Two technical replicates were included for each sample and a five-parameter logistical curve was fitted to the data by nonlinear regression. For each data point, the mean is represented and the error bars indicate standard deviation. PnP-mRuby-Cas9 cell supernatant was used as negative control.

    Techniques Used: Library Screening, Clone Assay, FACS, Sequencing, Enzyme-linked Immunosorbent Assay, Expressing, Standard Deviation, Negative Control

    Characterization of antibody variants selected for affinity maturation. (a) The table shows the coding mutations of each of the five unique clones (HEL23v1-5) retrieved after single-cell sorting of the antigen-enriched libraries. (b) Flow cytometry dot plots show the surface expression and HEL-binding profile of the five HEL23 variants (green) and wild-type HEL23 (black). The ratio of HEL over antibody signal for each clone is shown in Figure S5a. (c) Supernatant ELISA comparing HEL binding for the five isolated variants (green) with wild-type HEL23 (black). Supernatants were adjusted to equal IgG-concentration (Fig. S5b). Two technical replicates were included for each of the mutated variants and one for the controls (PnP-HEL23 and PnP-mRuby-Cas9), and a five-parameter logistical curve was fitted to the data by nonlinear regression. For each data point, the mean is represented and the error bars indicate standard deviation. PnP-mRuby-Cas9 cell supernatant was used as negative control. (d) Affinity values of wild-type HEL23 and the five isolated variants obtained by bio-layer interferometry (BLI). The curves and fitting values are reported in Figure S6. (e) Heatmap shows enrichment of all possible substitutions for each WT residue (x-axis) in the HEL + library compared to IgG + library in a log2-fold change scale. Red substitutions are enriched in the HEL + library, while blue substitutions are depleted. White squares (log2 ratio = 0) indicate neutral substitutions not impacted by enrichment, or residues in which the mutation rate is negligible. The mutation rate for each position was calculated by summing the mutation frequency of all replicates (n = 3) for each condition. Key residues found in affinity-matured clones are indicated with black boxes.
    Figure Legend Snippet: Characterization of antibody variants selected for affinity maturation. (a) The table shows the coding mutations of each of the five unique clones (HEL23v1-5) retrieved after single-cell sorting of the antigen-enriched libraries. (b) Flow cytometry dot plots show the surface expression and HEL-binding profile of the five HEL23 variants (green) and wild-type HEL23 (black). The ratio of HEL over antibody signal for each clone is shown in Figure S5a. (c) Supernatant ELISA comparing HEL binding for the five isolated variants (green) with wild-type HEL23 (black). Supernatants were adjusted to equal IgG-concentration (Fig. S5b). Two technical replicates were included for each of the mutated variants and one for the controls (PnP-HEL23 and PnP-mRuby-Cas9), and a five-parameter logistical curve was fitted to the data by nonlinear regression. For each data point, the mean is represented and the error bars indicate standard deviation. PnP-mRuby-Cas9 cell supernatant was used as negative control. (d) Affinity values of wild-type HEL23 and the five isolated variants obtained by bio-layer interferometry (BLI). The curves and fitting values are reported in Figure S6. (e) Heatmap shows enrichment of all possible substitutions for each WT residue (x-axis) in the HEL + library compared to IgG + library in a log2-fold change scale. Red substitutions are enriched in the HEL + library, while blue substitutions are depleted. White squares (log2 ratio = 0) indicate neutral substitutions not impacted by enrichment, or residues in which the mutation rate is negligible. The mutation rate for each position was calculated by summing the mutation frequency of all replicates (n = 3) for each condition. Key residues found in affinity-matured clones are indicated with black boxes.

    Techniques Used: Clone Assay, FACS, Flow Cytometry, Cytometry, Expressing, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Concentration Assay, Standard Deviation, Negative Control, Mutagenesis

    8) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    9) Product Images from "T cell-specific inactivation of mouse CD2 by CRISPR/Cas9"

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9

    Journal: Scientific Reports

    doi: 10.1038/srep21377

    Analysis of transgene copy numbers and mRNA expression levels. ( a ) Serial dilutions of genomic DNA from three F1 offspring of founder #5 ( Fig. 1c ) were analyzed by real-time PCR specific for sequences within the indicated (trans)genes. A regression analysis was performed to calculate the copy number of the transgenes in each individual mouse, as indicated in the table. ( b ) Relative expression of CD4-Cas9 transgenic and endogenous CD4 mRNA. Transgenic splenic B cells, T cells and thymocytes as well as wildtype thymocytes were magnetically enriched and analyzed by RT-PCR. The CD4-Cas9 product is spanning the intron between CD4 Exon 1 and Cas9 ORF. Cxxc1 and Ywhaz served as housekeeping gene. Data was normalized to “dTG T cells Spleen”. ( c ) Relative expression of gRNA(CD2.0). Splenocytes and thymocytes of three different dTG offspring as well as of a wildtype control were analyzed by RT-PCR. Cxxc1 and Ywhaz served as housekeeping gene. Data was normalized to “dTG Thymus” of the third offspring.
    Figure Legend Snippet: Analysis of transgene copy numbers and mRNA expression levels. ( a ) Serial dilutions of genomic DNA from three F1 offspring of founder #5 ( Fig. 1c ) were analyzed by real-time PCR specific for sequences within the indicated (trans)genes. A regression analysis was performed to calculate the copy number of the transgenes in each individual mouse, as indicated in the table. ( b ) Relative expression of CD4-Cas9 transgenic and endogenous CD4 mRNA. Transgenic splenic B cells, T cells and thymocytes as well as wildtype thymocytes were magnetically enriched and analyzed by RT-PCR. The CD4-Cas9 product is spanning the intron between CD4 Exon 1 and Cas9 ORF. Cxxc1 and Ywhaz served as housekeeping gene. Data was normalized to “dTG T cells Spleen”. ( c ) Relative expression of gRNA(CD2.0). Splenocytes and thymocytes of three different dTG offspring as well as of a wildtype control were analyzed by RT-PCR. Cxxc1 and Ywhaz served as housekeeping gene. Data was normalized to “dTG Thymus” of the third offspring.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Transgenic Assay, Reverse Transcription Polymerase Chain Reaction

    Functional analysis ( a ) In vitro test of gRNA efficiency. gRNA(CD2.0) as well as three controls (CD2.1,CD2.2, CD2.3) were incubated with a PCR product for the indicated period of time. Digests were separated on an agarose gel. ( b ) Analysis of the gRNA efficiency. The intensities of the bands resulting from gRNA/Cas9-digested PCR product of three different experiments were analyzed using ImageJ. Shown is the mean and standard error of the mean.
    Figure Legend Snippet: Functional analysis ( a ) In vitro test of gRNA efficiency. gRNA(CD2.0) as well as three controls (CD2.1,CD2.2, CD2.3) were incubated with a PCR product for the indicated period of time. Digests were separated on an agarose gel. ( b ) Analysis of the gRNA efficiency. The intensities of the bands resulting from gRNA/Cas9-digested PCR product of three different experiments were analyzed using ImageJ. Shown is the mean and standard error of the mean.

    Techniques Used: Functional Assay, In Vitro, Incubation, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Conditional gene editing. ( a ) Scheme of the concept of conditional gene editing. In the Cas9 driver strain, the nuclease is placed under control of a cell type or lineage specific promoter. The gRNA construct is driven by the ubiquitous U6 promoter. Both transgenes are co-injected into oocytes. In double-transgenic animals, cell-type specific gene deletions are induced. ( b ) Scheme of constructs used for the CD4dsCas9/U6gRNA(CD2) mouse strain. The two used linearized plasmids are shown. First, distal and proximal enhancer, CD4 promoter followed by exon 1, part of exon 2 and Cas9 with a PolyA at the end. Second, the U6 promoter driven gRNA specific for CD2 followed by the U6 terminator (U6 T). ( c ) PCR analysis of tail biopsies for presence of CD4dsCas9 (835 bp amplicon) (lanes 1 and 5) and U6gRNA(CD2.0) (407 bp amplicon) (lanes 1 and 5) by PCR. DNA from a wildtype (WT) mouse as well as H 2 0 were run as a negative control. 2, 3 and 4 were non-transgenic litter mates.
    Figure Legend Snippet: Conditional gene editing. ( a ) Scheme of the concept of conditional gene editing. In the Cas9 driver strain, the nuclease is placed under control of a cell type or lineage specific promoter. The gRNA construct is driven by the ubiquitous U6 promoter. Both transgenes are co-injected into oocytes. In double-transgenic animals, cell-type specific gene deletions are induced. ( b ) Scheme of constructs used for the CD4dsCas9/U6gRNA(CD2) mouse strain. The two used linearized plasmids are shown. First, distal and proximal enhancer, CD4 promoter followed by exon 1, part of exon 2 and Cas9 with a PolyA at the end. Second, the U6 promoter driven gRNA specific for CD2 followed by the U6 terminator (U6 T). ( c ) PCR analysis of tail biopsies for presence of CD4dsCas9 (835 bp amplicon) (lanes 1 and 5) and U6gRNA(CD2.0) (407 bp amplicon) (lanes 1 and 5) by PCR. DNA from a wildtype (WT) mouse as well as H 2 0 were run as a negative control. 2, 3 and 4 were non-transgenic litter mates.

    Techniques Used: Construct, Injection, Transgenic Assay, Polymerase Chain Reaction, Amplification, Negative Control

    10) Product Images from "Long-read sequencing across the C9orf72 ‘GGGGCC’ repeat expansion: implications for clinical use and genetic discovery efforts in human disease"

    Article Title: Long-read sequencing across the C9orf72 ‘GGGGCC’ repeat expansion: implications for clinical use and genetic discovery efforts in human disease

    Journal: Molecular Neurodegeneration

    doi: 10.1186/s13024-018-0274-4

    Schematic of PacBio no-amplification (No-Amp) targeted sequencing. We applied the PacBio no-amplification (No-Amp) Targeted Sequencing method to a C9orf72 G 4 C 2 repeat expansion carrier to better characterize the repeat’s nucleotide content. The No-Amp targeted sequencing method begins with typical SMRTbell library preparation after the target region is excised by restriction enzyme digestion. Cas9 digestion follows with a guide RNA specific to sequence adjacent (Cas9 Cutting Site) to the region of interest (green), leaving the SMRTbells blunt ended. In this case, the guide RNA was specific to sequence upstream (5′) of the G 4 C 2 repeat expansion on the anti-sense strand. A new capture adapter (red) is then ligated to the blunt ends and captured using magnetic beads (magbeads). This process enriches the library for reads containing the region of interest to maximize read depth
    Figure Legend Snippet: Schematic of PacBio no-amplification (No-Amp) targeted sequencing. We applied the PacBio no-amplification (No-Amp) Targeted Sequencing method to a C9orf72 G 4 C 2 repeat expansion carrier to better characterize the repeat’s nucleotide content. The No-Amp targeted sequencing method begins with typical SMRTbell library preparation after the target region is excised by restriction enzyme digestion. Cas9 digestion follows with a guide RNA specific to sequence adjacent (Cas9 Cutting Site) to the region of interest (green), leaving the SMRTbells blunt ended. In this case, the guide RNA was specific to sequence upstream (5′) of the G 4 C 2 repeat expansion on the anti-sense strand. A new capture adapter (red) is then ligated to the blunt ends and captured using magnetic beads (magbeads). This process enriches the library for reads containing the region of interest to maximize read depth

    Techniques Used: Amplification, Sequencing, Magnetic Beads

    11) Product Images from "Cas9 cleavage assay for pre-screening of sgRNAs using nicking triggered isothermal amplification cleavage assay for pre-screening of sgRNAs using nicking triggered isothermal amplification †Electronic supplementary information (ESI) available: Sequence information, reaction conditions optimization and Cas9 cleavage analysis in a time dependent manner. See DOI: 10.1039/c6sc01355d"

    Article Title: Cas9 cleavage assay for pre-screening of sgRNAs using nicking triggered isothermal amplification cleavage assay for pre-screening of sgRNAs using nicking triggered isothermal amplification †Electronic supplementary information (ESI) available: Sequence information, reaction conditions optimization and Cas9 cleavage analysis in a time dependent manner. See DOI: 10.1039/c6sc01355d

    Journal: Chemical Science

    doi: 10.1039/c6sc01355d

    Cas9 mediated DsRed gene silencing using 18-nt sgRNA and 20-nt sgRNA (with or without a single nucleotide mismatch at the 15 th nucleotide from PAM). (a) Schematic diagram of Cas9–sgRNA mediated DsRed gene silencing. Cas9 nuclease was labelled with an EGFP tag. In the absence of Cas9, DsRed can be expressed in cells. When the functional Cas9–sgRNA complex was present, the complex mediated excision of the DsRed gene and suppressed DsRed expression. (b) Fluorescence imaging of DsRed-expressing Hela cells transfected with the Cas9/sgRNA expression system and grown for 48 h. Green is EGFP and Red is DsRed. Scale bar is 50 μm.
    Figure Legend Snippet: Cas9 mediated DsRed gene silencing using 18-nt sgRNA and 20-nt sgRNA (with or without a single nucleotide mismatch at the 15 th nucleotide from PAM). (a) Schematic diagram of Cas9–sgRNA mediated DsRed gene silencing. Cas9 nuclease was labelled with an EGFP tag. In the absence of Cas9, DsRed can be expressed in cells. When the functional Cas9–sgRNA complex was present, the complex mediated excision of the DsRed gene and suppressed DsRed expression. (b) Fluorescence imaging of DsRed-expressing Hela cells transfected with the Cas9/sgRNA expression system and grown for 48 h. Green is EGFP and Red is DsRed. Scale bar is 50 μm.

    Techniques Used: Functional Assay, Expressing, Fluorescence, Imaging, Transfection

    Schematic diagram of the nicking triggered exponential amplification reaction (NTEXPAR) for the detection of Cas9 cleaved dsDNA. (a) The NTEXPAR probe designed for Cas9 cleavage assay contains a nicking site, target sequence and protospacer adjacent motif (PAM) which can be recognized and cleaved by a Cas9–sgRNA complex. (b) After Cas9 cleavage, the exposed blunt-ended cleavage site can be recognized by a nicking enzyme and DNA polymerase to generate a short single-stranded DNA trigger by a nicking and strand displacement mechanism. The generated ssDNA trigger could be further exponentially amplified with the same enzymes in the presence of a designed amplification template. The amount of cleaved dsDNA could be quantified by measuring the product related fluorescence signal.
    Figure Legend Snippet: Schematic diagram of the nicking triggered exponential amplification reaction (NTEXPAR) for the detection of Cas9 cleaved dsDNA. (a) The NTEXPAR probe designed for Cas9 cleavage assay contains a nicking site, target sequence and protospacer adjacent motif (PAM) which can be recognized and cleaved by a Cas9–sgRNA complex. (b) After Cas9 cleavage, the exposed blunt-ended cleavage site can be recognized by a nicking enzyme and DNA polymerase to generate a short single-stranded DNA trigger by a nicking and strand displacement mechanism. The generated ssDNA trigger could be further exponentially amplified with the same enzymes in the presence of a designed amplification template. The amount of cleaved dsDNA could be quantified by measuring the product related fluorescence signal.

    Techniques Used: Amplification, Cleavage Assay, Sequencing, Generated, Fluorescence

    NTEXPAR probe design for Cas9 cleavage assay. (a) EXPAR amplification of 100 pM Cas9 cleaved 37 bp dsDNA substrate (S-substrate and cS-substrate 1). (b) EXPAR amplification of 100 pM Cas9 cleaved 37 bp dsDNA substrate with a truncated complementary sequence (S-substrate and cS-substrate 2). (c) NTEXPAR amplification of 100 pM Cas9 cleaved 60 bp dsDNA substrate (NT-S-substrate and cNT-S-substrate). (d) NTEXPAR amplification of 100 pM Cas9 cleaved 78 bp dsDNA substrate with a nicking site before the target sequence cleaved (NT- l -substrate and cNT- l -substrate). The reaction mechanism of EXPAR and NTEXPAR is illustrated in the ESI (Scheme S1 † ).
    Figure Legend Snippet: NTEXPAR probe design for Cas9 cleavage assay. (a) EXPAR amplification of 100 pM Cas9 cleaved 37 bp dsDNA substrate (S-substrate and cS-substrate 1). (b) EXPAR amplification of 100 pM Cas9 cleaved 37 bp dsDNA substrate with a truncated complementary sequence (S-substrate and cS-substrate 2). (c) NTEXPAR amplification of 100 pM Cas9 cleaved 60 bp dsDNA substrate (NT-S-substrate and cNT-S-substrate). (d) NTEXPAR amplification of 100 pM Cas9 cleaved 78 bp dsDNA substrate with a nicking site before the target sequence cleaved (NT- l -substrate and cNT- l -substrate). The reaction mechanism of EXPAR and NTEXPAR is illustrated in the ESI (Scheme S1 † ).

    Techniques Used: Cleavage Assay, Amplification, Sequencing

    NTEXPAR for Cas9 cleaved dsDNA detection. (a) Real-time fluorescence measurement of NTEXPAR triggered by Cas9 cleaved dsDNA with various concentrations (10 fM to 100 pM). The blank sample contained all the reaction components except for dsDNA. (b) Linear relationship between the point of inflection (POI) values of the corresponding amplification curves and the logarithm of Cas9 cleaved dsDNA concentrations (10 fM to 100 pM). Error bars are based on triplicate experiments.
    Figure Legend Snippet: NTEXPAR for Cas9 cleaved dsDNA detection. (a) Real-time fluorescence measurement of NTEXPAR triggered by Cas9 cleaved dsDNA with various concentrations (10 fM to 100 pM). The blank sample contained all the reaction components except for dsDNA. (b) Linear relationship between the point of inflection (POI) values of the corresponding amplification curves and the logarithm of Cas9 cleaved dsDNA concentrations (10 fM to 100 pM). Error bars are based on triplicate experiments.

    Techniques Used: Fluorescence, Amplification

    Truncated sgRNA with optimized length enhances Cas9 cleavage specificity. Double stranded DNA substrates were cleaved by Cas9 nuclease with sgRNAs of various lengths (20-nt, 18-nt, 17-nt, 16-nt, and 15-nt). The mismatching site was G/C at the red marked nucleotide. The percentage of Cas9 cleaved dsDNA was measured by NTEXPAR and the concentrations of Cas9 and dsDNA substrate used for all experiments were 2 nM and 100 pM, respectively. Error bars are based on triplicate experiments.
    Figure Legend Snippet: Truncated sgRNA with optimized length enhances Cas9 cleavage specificity. Double stranded DNA substrates were cleaved by Cas9 nuclease with sgRNAs of various lengths (20-nt, 18-nt, 17-nt, 16-nt, and 15-nt). The mismatching site was G/C at the red marked nucleotide. The percentage of Cas9 cleaved dsDNA was measured by NTEXPAR and the concentrations of Cas9 and dsDNA substrate used for all experiments were 2 nM and 100 pM, respectively. Error bars are based on triplicate experiments.

    Techniques Used:

    Cas9 cleavage assay with various Cas9 concentrations. (a) Agarose gel electrophoresis analysis of 100 pM dsDNA cleaved by 1 pM to 20 nM Cas9. (b) NTEXPAR analysis of 100 pM dsDNA cleaved by 1 pM to 20 nM Cas9. (c) Linear relationship between the POI values of the corresponding amplification curves and the logarithm of Cas9 concentrations. Error bars are based on triplicate experiments.
    Figure Legend Snippet: Cas9 cleavage assay with various Cas9 concentrations. (a) Agarose gel electrophoresis analysis of 100 pM dsDNA cleaved by 1 pM to 20 nM Cas9. (b) NTEXPAR analysis of 100 pM dsDNA cleaved by 1 pM to 20 nM Cas9. (c) Linear relationship between the POI values of the corresponding amplification curves and the logarithm of Cas9 concentrations. Error bars are based on triplicate experiments.

    Techniques Used: Cleavage Assay, Agarose Gel Electrophoresis, Amplification

    12) Product Images from "Chromatin-remodeling factor SMARCD2 regulates transcriptional networks controlling differentiation of neutrophil granulocytes"

    Article Title: Chromatin-remodeling factor SMARCD2 regulates transcriptional networks controlling differentiation of neutrophil granulocytes

    Journal: Nature genetics

    doi: 10.1038/ng.3833

    Smarcd2 deficiency in zebrafish. ( a ) Neutrophil numbers in Tg( lyz : dsRed ) nz50 zebrafish at 72 h.p.f. after injection with MOs (control (CRTL) versus translation-start-site blocker (ATG) and splice-site blocker (SB1 and SB2) MOs targeting smarcd2 ). Data represent the numbers of fluorescence-labeled neutrophils per individual fish embryo. Pooled data from two independent MO experiments are shown: CTRL n = 16, ATG n = 16, SB1 n = 16, SB2 n = 16 fish. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t test. Replicates: 2. ( b ) Representative fluorescence images of zebrafish strain Tg( mpx : EGFP ) i114 : smarcd2 wt/wt (wild type) and smarcd2 1/1 (knockout). Reduced numbers of GFP-expressing neutrophils are observed in smarcd2 1/1 mutant fish embryos. Acquired images: smarcd2 wt/wt ( n = 37 images) and smarcd2 1/1 ( n = 10 images). ( c ) Enumeration of neutrophils in smarcd2 wt/wt versus smarcd2 1/1 zebrafish. Numbers of fluorescence-labeled neutrophils were evaluated in caudal hematopoietic tissue for individual fish embryos. n = 38 smarcd2 wt/wt and n = 10 smarcd2 1/1 fish were evaluated in two independent CRISPR/Cas9 experiments. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t .
    Figure Legend Snippet: Smarcd2 deficiency in zebrafish. ( a ) Neutrophil numbers in Tg( lyz : dsRed ) nz50 zebrafish at 72 h.p.f. after injection with MOs (control (CRTL) versus translation-start-site blocker (ATG) and splice-site blocker (SB1 and SB2) MOs targeting smarcd2 ). Data represent the numbers of fluorescence-labeled neutrophils per individual fish embryo. Pooled data from two independent MO experiments are shown: CTRL n = 16, ATG n = 16, SB1 n = 16, SB2 n = 16 fish. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t test. Replicates: 2. ( b ) Representative fluorescence images of zebrafish strain Tg( mpx : EGFP ) i114 : smarcd2 wt/wt (wild type) and smarcd2 1/1 (knockout). Reduced numbers of GFP-expressing neutrophils are observed in smarcd2 1/1 mutant fish embryos. Acquired images: smarcd2 wt/wt ( n = 37 images) and smarcd2 1/1 ( n = 10 images). ( c ) Enumeration of neutrophils in smarcd2 wt/wt versus smarcd2 1/1 zebrafish. Numbers of fluorescence-labeled neutrophils were evaluated in caudal hematopoietic tissue for individual fish embryos. n = 38 smarcd2 wt/wt and n = 10 smarcd2 1/1 fish were evaluated in two independent CRISPR/Cas9 experiments. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t .

    Techniques Used: Injection, Fluorescence, Labeling, Fluorescence In Situ Hybridization, Two Tailed Test, Knock-Out, Expressing, Mutagenesis, CRISPR

    13) Product Images from "Mutation in the Zebrafish cct2 Gene Leads to Abnormalities of Cell Cycle and Cell Death in the Retina: A Model of CCT2-Related Leber Congenital Amaurosis"

    Article Title: Mutation in the Zebrafish cct2 Gene Leads to Abnormalities of Cell Cycle and Cell Death in the Retina: A Model of CCT2-Related Leber Congenital Amaurosis

    Journal: Investigative Ophthalmology & Visual Science

    doi: 10.1167/iovs.17-22919

    Strategy and summary of the genome editing for cct2 by CRISPR-Cas9. (A) Comparison of human and zebrafish CCTβ amino acid sequences. The differing amino acid residues are shown in red. The position of LCA-associated mutations T400 and R516 are shaded and marked by asterisks. (B) The reference sequence of the targeted area of the zebrafish cct2 gene in the TL strain. Exon 14 of cct2 is depicted in capital letters. The intronic sequences surrounding this exon are depicted in lower case letters. The guide RNA sequences (underlined in the reference sequence) are shown below the reference sequence. T, the first 5′ nucleotide in the guide RNA sequences, was substituted by G for in vitro transcription using T7 polymerase. The polymorphic positions are shown in red. The PAM sequence was double underlined. The codon corresponding to threonine 400 is shown in green. (C) Changes in the nucleotide and protein sequences of the cct2-L394H-7del mutant. Upper panel shows the nucleotide sequence. The lower panel shows translated wild-type and mutated proteins. The mutated CCTβ protein has the L394H substitution (underlined) and deletion of seven amino acids. The highly conserved ATP-binding motif is underlined.
    Figure Legend Snippet: Strategy and summary of the genome editing for cct2 by CRISPR-Cas9. (A) Comparison of human and zebrafish CCTβ amino acid sequences. The differing amino acid residues are shown in red. The position of LCA-associated mutations T400 and R516 are shaded and marked by asterisks. (B) The reference sequence of the targeted area of the zebrafish cct2 gene in the TL strain. Exon 14 of cct2 is depicted in capital letters. The intronic sequences surrounding this exon are depicted in lower case letters. The guide RNA sequences (underlined in the reference sequence) are shown below the reference sequence. T, the first 5′ nucleotide in the guide RNA sequences, was substituted by G for in vitro transcription using T7 polymerase. The polymorphic positions are shown in red. The PAM sequence was double underlined. The codon corresponding to threonine 400 is shown in green. (C) Changes in the nucleotide and protein sequences of the cct2-L394H-7del mutant. Upper panel shows the nucleotide sequence. The lower panel shows translated wild-type and mutated proteins. The mutated CCTβ protein has the L394H substitution (underlined) and deletion of seven amino acids. The highly conserved ATP-binding motif is underlined.

    Techniques Used: CRISPR, Sequencing, In Vitro, Mutagenesis, Binding Assay

    14) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    15) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    16) Product Images from "A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells"

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells

    Journal: Nature methods

    doi: 10.1038/nmeth.4264

    CREST-seq experimental design and application to the POU5F1 locus in hESC (A) Workflow of CREST-seq. A total of 11,570 oliogs containing dual sgRNA sequences were cloned into a lentiviral library that was in turn transduced into the H1 POU5F1-eGFP cells with MOI=0.1. After Puromycin selection, the cells were stained with antibodies specifically recognizing POU5F1 (PE) or eGFP (APC), respectively. The indicated “Cis” and “High” populations were sorted by FACS, and the integrated sgRNA pairs were amplified by PCR from genomic DNA followed by high-throughput sequencing. ( B ) Schematic illustration of mono-allelic or bi-allelic deletions of cis -regulatory elements of POU5F1 . The eGFP-tagging allele is designated as P1 and the wild-type allele as P2. Mono-allelic disruption of a POU5F1 CRE on the P1 allele would lead to reduced eGFP expression while POU5F1 protein levels remain relatively unchanged (eGFP-/POU5F1+). Bi-allelic disruption of a POU5F1 CRE would lead to reduction of both eGFP and POU5F1 protein level. (C) FACS analysis of H1 POU5F1-eGFP cells transduced with control lentivirus expressing Cas9 but not sgRNA (left) or the CREST-seq lentiviral library (right) 14-day post transduction. (D) The read counts of sgRNA from “Cis” (left) and “High” (right) are compared to those from a non-sorted control population (Ctrl). The fold changes represent the ratios between read counts in the “Cis” or “High” populations and the “Ctrl” population, with the significance of enrichment calculated by a negative binomial test. Green circles denote eGFP targeting sgRNA pairs; Red dots correspond to sgRNA pairs enriched in the “Cis” population with P -value
    Figure Legend Snippet: CREST-seq experimental design and application to the POU5F1 locus in hESC (A) Workflow of CREST-seq. A total of 11,570 oliogs containing dual sgRNA sequences were cloned into a lentiviral library that was in turn transduced into the H1 POU5F1-eGFP cells with MOI=0.1. After Puromycin selection, the cells were stained with antibodies specifically recognizing POU5F1 (PE) or eGFP (APC), respectively. The indicated “Cis” and “High” populations were sorted by FACS, and the integrated sgRNA pairs were amplified by PCR from genomic DNA followed by high-throughput sequencing. ( B ) Schematic illustration of mono-allelic or bi-allelic deletions of cis -regulatory elements of POU5F1 . The eGFP-tagging allele is designated as P1 and the wild-type allele as P2. Mono-allelic disruption of a POU5F1 CRE on the P1 allele would lead to reduced eGFP expression while POU5F1 protein levels remain relatively unchanged (eGFP-/POU5F1+). Bi-allelic disruption of a POU5F1 CRE would lead to reduction of both eGFP and POU5F1 protein level. (C) FACS analysis of H1 POU5F1-eGFP cells transduced with control lentivirus expressing Cas9 but not sgRNA (left) or the CREST-seq lentiviral library (right) 14-day post transduction. (D) The read counts of sgRNA from “Cis” (left) and “High” (right) are compared to those from a non-sorted control population (Ctrl). The fold changes represent the ratios between read counts in the “Cis” or “High” populations and the “Ctrl” population, with the significance of enrichment calculated by a negative binomial test. Green circles denote eGFP targeting sgRNA pairs; Red dots correspond to sgRNA pairs enriched in the “Cis” population with P -value

    Techniques Used: Clone Assay, Selection, Staining, FACS, Amplification, Polymerase Chain Reaction, Next-Generation Sequencing, Expressing, Transduction

    17) Product Images from "Towards personalised allele-specific CRISPR gene editing to treat autosomal dominant disorders"

    Article Title: Towards personalised allele-specific CRISPR gene editing to treat autosomal dominant disorders

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-16279-4

    Allele-specific cleavage of L527R TGFBI mutation utilising a PAM-specific approach. ( a ) The L527R mutation (c.1580 T > G) is indicated in red and PAM utilised is shown in green. A 20 nt sgRNA targeted to a naturally occurring PAM was designed as a positive control (sgWT, purple –top of figure). A 20 nt sgRNA utilising the novel PAM, containing the L527R mutation, was designed (sgMUTANT, blue – bottom of figure). ( b ) Both sgWT and sgMUTANT were targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity. ( c ) An in vitro digestion with Cas9 protein complexed with a sgRNA utilising the novel L527R PAM was carried out to confirm the specificity observed. Mutant guides of both 20 and 18 nucleotides were tested. Uncropped gel images are available in Supplementary Figure 1 .
    Figure Legend Snippet: Allele-specific cleavage of L527R TGFBI mutation utilising a PAM-specific approach. ( a ) The L527R mutation (c.1580 T > G) is indicated in red and PAM utilised is shown in green. A 20 nt sgRNA targeted to a naturally occurring PAM was designed as a positive control (sgWT, purple –top of figure). A 20 nt sgRNA utilising the novel PAM, containing the L527R mutation, was designed (sgMUTANT, blue – bottom of figure). ( b ) Both sgWT and sgMUTANT were targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity. ( c ) An in vitro digestion with Cas9 protein complexed with a sgRNA utilising the novel L527R PAM was carried out to confirm the specificity observed. Mutant guides of both 20 and 18 nucleotides were tested. Uncropped gel images are available in Supplementary Figure 1 .

    Techniques Used: Mutagenesis, Positive Control, Luciferase, Plasmid Preparation, Sequencing, In Vitro

    Sustained CRISPR/Cas9 mediated silencing of luc2 in vivo . ( a ) The short guide RNA (sgRNA) specific for luc2 was designed to target the 5′ region of the gene, to increase the likelihood of inducing a frame-shifting deletion that would knock out luciferase activity by generating a premature termination codon. ( b ) An in vitro dual-luciferase assay demonstrated successful targeting of luc2 by the sgLuc2 construct, as shown by a significant reduction in luciferase activity when normalized to untreated cells (data normalised against the untreated control = 100%). ( c ) Representative image of mice displaying a maximal reduction in luc2 expression after injection with the sgLuc2 construct (right eye). This image was taken from the mouse represented by the green line in panel (d), below, at 7 days post treatment. ( d ) After treatment, the corneal luciferase activity of each mouse was quantified using a Xenogen IVIS live animal imager every day for 7 days, then every 7 days thereafter, for a total of 6 weeks. Luciferase activity for each treatment group expressed as a percentage of control (R/L ratio %).
    Figure Legend Snippet: Sustained CRISPR/Cas9 mediated silencing of luc2 in vivo . ( a ) The short guide RNA (sgRNA) specific for luc2 was designed to target the 5′ region of the gene, to increase the likelihood of inducing a frame-shifting deletion that would knock out luciferase activity by generating a premature termination codon. ( b ) An in vitro dual-luciferase assay demonstrated successful targeting of luc2 by the sgLuc2 construct, as shown by a significant reduction in luciferase activity when normalized to untreated cells (data normalised against the untreated control = 100%). ( c ) Representative image of mice displaying a maximal reduction in luc2 expression after injection with the sgLuc2 construct (right eye). This image was taken from the mouse represented by the green line in panel (d), below, at 7 days post treatment. ( d ) After treatment, the corneal luciferase activity of each mouse was quantified using a Xenogen IVIS live animal imager every day for 7 days, then every 7 days thereafter, for a total of 6 weeks. Luciferase activity for each treatment group expressed as a percentage of control (R/L ratio %).

    Techniques Used: CRISPR, In Vivo, Knock-Out, Luciferase, Activity Assay, In Vitro, Construct, Mouse Assay, Expressing, Injection

    Confirmation of the specificity achieved using a guide-specific system targeted to prevalent TGFBI mutations In vitro digestion of either wild-type or respective mutant TGFBI sequence via Cas9 protein complexed with an sgRNA. Guides lengths of 20 and 18 nucleotides were assessed. Uncropped gel images are available in Supplementary Figure 2 .
    Figure Legend Snippet: Confirmation of the specificity achieved using a guide-specific system targeted to prevalent TGFBI mutations In vitro digestion of either wild-type or respective mutant TGFBI sequence via Cas9 protein complexed with an sgRNA. Guides lengths of 20 and 18 nucleotides were assessed. Uncropped gel images are available in Supplementary Figure 2 .

    Techniques Used: In Vitro, Mutagenesis, Sequencing

    Evaluation of Cas9 orthologues in a PAM-specific system targeted to prevalent TGFBI mutations Guide RNA tested shown in purple, PAM utilised shown in green and mutation shown in red. ( a ) 22 and 21 nucleotide guides were designed to target the novel S.aureus Cas9 PAM generated by R555W. Both guide lengths were targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity. ( b ) A guide utilising the novel mutant As Cpf1 PAM generated by R124L was targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity.
    Figure Legend Snippet: Evaluation of Cas9 orthologues in a PAM-specific system targeted to prevalent TGFBI mutations Guide RNA tested shown in purple, PAM utilised shown in green and mutation shown in red. ( a ) 22 and 21 nucleotide guides were designed to target the novel S.aureus Cas9 PAM generated by R555W. Both guide lengths were targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity. ( b ) A guide utilising the novel mutant As Cpf1 PAM generated by R124L was targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity.

    Techniques Used: Mutagenesis, Generated, Luciferase, Plasmid Preparation, Sequencing

    S. pyogenes Cas9 to treat dominant negative TGFBI corneal dystrophies. ( a ) Cas9 (purple outline) can be directed to cut any sequence in the genome (DNA target in grey), provided it is directly upstream of a protospacer adjacent motif known as PAM (pink box). This can be achieved by altering the 20 nucleotide guide sequence, which is associated with a 82 nucleotide scaffold. ( b ) 5 prevalent TGFBI mutations and their associated corneal dystrophy and codon change. ( c ) Schematic of the position of the 60 missense mutations across the TGFBI gene. The hotspots at exons 4, 11, 12 and 14 are evident, with exons 4 and 12 expanded to show the location of the 5 most prevalent TGFBI mutations; R124C, R124H, R125L, R555Q and R555W.
    Figure Legend Snippet: S. pyogenes Cas9 to treat dominant negative TGFBI corneal dystrophies. ( a ) Cas9 (purple outline) can be directed to cut any sequence in the genome (DNA target in grey), provided it is directly upstream of a protospacer adjacent motif known as PAM (pink box). This can be achieved by altering the 20 nucleotide guide sequence, which is associated with a 82 nucleotide scaffold. ( b ) 5 prevalent TGFBI mutations and their associated corneal dystrophy and codon change. ( c ) Schematic of the position of the 60 missense mutations across the TGFBI gene. The hotspots at exons 4, 11, 12 and 14 are evident, with exons 4 and 12 expanded to show the location of the 5 most prevalent TGFBI mutations; R124C, R124H, R125L, R555Q and R555W.

    Techniques Used: Dominant Negative Mutation, Sequencing

    18) Product Images from "Towards personalised allele-specific CRISPR gene editing to treat autosomal dominant disorders"

    Article Title: Towards personalised allele-specific CRISPR gene editing to treat autosomal dominant disorders

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-16279-4

    Allele-specific cleavage of L527R TGFBI mutation utilising a PAM-specific approach. ( a ) The L527R mutation (c.1580 T > G) is indicated in red and PAM utilised is shown in green. A 20 nt sgRNA targeted to a naturally occurring PAM was designed as a positive control (sgWT, purple –top of figure). A 20 nt sgRNA utilising the novel PAM, containing the L527R mutation, was designed (sgMUTANT, blue – bottom of figure). ( b ) Both sgWT and sgMUTANT were targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity. ( c ) An in vitro digestion with Cas9 protein complexed with a sgRNA utilising the novel L527R PAM was carried out to confirm the specificity observed. Mutant guides of both 20 and 18 nucleotides were tested. Uncropped gel images are available in Supplementary Figure 1 .
    Figure Legend Snippet: Allele-specific cleavage of L527R TGFBI mutation utilising a PAM-specific approach. ( a ) The L527R mutation (c.1580 T > G) is indicated in red and PAM utilised is shown in green. A 20 nt sgRNA targeted to a naturally occurring PAM was designed as a positive control (sgWT, purple –top of figure). A 20 nt sgRNA utilising the novel PAM, containing the L527R mutation, was designed (sgMUTANT, blue – bottom of figure). ( b ) Both sgWT and sgMUTANT were targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity. ( c ) An in vitro digestion with Cas9 protein complexed with a sgRNA utilising the novel L527R PAM was carried out to confirm the specificity observed. Mutant guides of both 20 and 18 nucleotides were tested. Uncropped gel images are available in Supplementary Figure 1 .

    Techniques Used: Mutagenesis, Positive Control, Luciferase, Plasmid Preparation, Sequencing, In Vitro

    Sustained CRISPR/Cas9 mediated silencing of luc2 in vivo . ( a ) The short guide RNA (sgRNA) specific for luc2 was designed to target the 5′ region of the gene, to increase the likelihood of inducing a frame-shifting deletion that would knock out luciferase activity by generating a premature termination codon. ( b ) An in vitro dual-luciferase assay demonstrated successful targeting of luc2 by the sgLuc2 construct, as shown by a significant reduction in luciferase activity when normalized to untreated cells (data normalised against the untreated control = 100%). ( c ) Representative image of mice displaying a maximal reduction in luc2 expression after injection with the sgLuc2 construct (right eye). This image was taken from the mouse represented by the green line in panel (d), below, at 7 days post treatment. ( d ) After treatment, the corneal luciferase activity of each mouse was quantified using a Xenogen IVIS live animal imager every day for 7 days, then every 7 days thereafter, for a total of 6 weeks. Luciferase activity for each treatment group expressed as a percentage of control (R/L ratio %).
    Figure Legend Snippet: Sustained CRISPR/Cas9 mediated silencing of luc2 in vivo . ( a ) The short guide RNA (sgRNA) specific for luc2 was designed to target the 5′ region of the gene, to increase the likelihood of inducing a frame-shifting deletion that would knock out luciferase activity by generating a premature termination codon. ( b ) An in vitro dual-luciferase assay demonstrated successful targeting of luc2 by the sgLuc2 construct, as shown by a significant reduction in luciferase activity when normalized to untreated cells (data normalised against the untreated control = 100%). ( c ) Representative image of mice displaying a maximal reduction in luc2 expression after injection with the sgLuc2 construct (right eye). This image was taken from the mouse represented by the green line in panel (d), below, at 7 days post treatment. ( d ) After treatment, the corneal luciferase activity of each mouse was quantified using a Xenogen IVIS live animal imager every day for 7 days, then every 7 days thereafter, for a total of 6 weeks. Luciferase activity for each treatment group expressed as a percentage of control (R/L ratio %).

    Techniques Used: CRISPR, In Vivo, Knock-Out, Luciferase, Activity Assay, In Vitro, Construct, Mouse Assay, Expressing, Injection

    Confirmation of the specificity achieved using a guide-specific system targeted to prevalent TGFBI mutations In vitro digestion of either wild-type or respective mutant TGFBI sequence via Cas9 protein complexed with an sgRNA. Guides lengths of 20 and 18 nucleotides were assessed. Uncropped gel images are available in Supplementary Figure 2 .
    Figure Legend Snippet: Confirmation of the specificity achieved using a guide-specific system targeted to prevalent TGFBI mutations In vitro digestion of either wild-type or respective mutant TGFBI sequence via Cas9 protein complexed with an sgRNA. Guides lengths of 20 and 18 nucleotides were assessed. Uncropped gel images are available in Supplementary Figure 2 .

    Techniques Used: In Vitro, Mutagenesis, Sequencing

    Evaluation of Cas9 orthologues in a PAM-specific system targeted to prevalent TGFBI mutations Guide RNA tested shown in purple, PAM utilised shown in green and mutation shown in red. ( a ) 22 and 21 nucleotide guides were designed to target the novel S.aureus Cas9 PAM generated by R555W. Both guide lengths were targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity. ( b ) A guide utilising the novel mutant As Cpf1 PAM generated by R124L was targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity.
    Figure Legend Snippet: Evaluation of Cas9 orthologues in a PAM-specific system targeted to prevalent TGFBI mutations Guide RNA tested shown in purple, PAM utilised shown in green and mutation shown in red. ( a ) 22 and 21 nucleotide guides were designed to target the novel S.aureus Cas9 PAM generated by R555W. Both guide lengths were targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity. ( b ) A guide utilising the novel mutant As Cpf1 PAM generated by R124L was targeted to a luciferase reporter plasmid containing either a wild-type or mutant TGFBI sequence to determine potency and allele specificity.

    Techniques Used: Mutagenesis, Generated, Luciferase, Plasmid Preparation, Sequencing

    S. pyogenes Cas9 to treat dominant negative TGFBI corneal dystrophies. ( a ) Cas9 (purple outline) can be directed to cut any sequence in the genome (DNA target in grey), provided it is directly upstream of a protospacer adjacent motif known as PAM (pink box). This can be achieved by altering the 20 nucleotide guide sequence, which is associated with a 82 nucleotide scaffold. ( b ) 5 prevalent TGFBI mutations and their associated corneal dystrophy and codon change. ( c ) Schematic of the position of the 60 missense mutations across the TGFBI gene. The hotspots at exons 4, 11, 12 and 14 are evident, with exons 4 and 12 expanded to show the location of the 5 most prevalent TGFBI mutations; R124C, R124H, R125L, R555Q and R555W.
    Figure Legend Snippet: S. pyogenes Cas9 to treat dominant negative TGFBI corneal dystrophies. ( a ) Cas9 (purple outline) can be directed to cut any sequence in the genome (DNA target in grey), provided it is directly upstream of a protospacer adjacent motif known as PAM (pink box). This can be achieved by altering the 20 nucleotide guide sequence, which is associated with a 82 nucleotide scaffold. ( b ) 5 prevalent TGFBI mutations and their associated corneal dystrophy and codon change. ( c ) Schematic of the position of the 60 missense mutations across the TGFBI gene. The hotspots at exons 4, 11, 12 and 14 are evident, with exons 4 and 12 expanded to show the location of the 5 most prevalent TGFBI mutations; R124C, R124H, R125L, R555Q and R555W.

    Techniques Used: Dominant Negative Mutation, Sequencing

    19) Product Images from "One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice"

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice

    Journal: The EMBO Journal

    doi: 10.15252/embj.201899243

    Characterization of PGT121 KI mice Schematic of the TaqMan probes and their targeting sites within the WT IgH and PGT121 IgH. T: TaqMan probe. Schematic showing the annealing sites of primers used to validate PGT121 KI animals. Fo.1F and Fo.2F primers were targeted at promoter region and PGT121 region, respectively, and combined with Re.1R primer targeted to the genomic region after homologous 3′ Arm. KI alleles are predicted to result in the amplification of a Fo.1 fragment (3.3 kb) and Fo.2 fragment (2.8 kb). Genomic DNA was extracted from the F0 founders born after CRISPR injection or from a C57BL/6 (WT) mouse. Long‐range PCR was performed to detect the insertion of the PGT121 VDJ sequences at the correct genomic locus. Table showing the frequency of the different genotypes of mice generated after CRISPR injection with plasmid donors containing long or short homology arms. # of HDR occurrence indicates the integration of the PGT121 heavy chain in the mouse IgH locus. # of Cas9‐mediated D 4 ‐J 4 deletions indicates the efficiency of our sgRNA‐directed Cas9 double‐stranded breaks. HC: heavy chain.
    Figure Legend Snippet: Characterization of PGT121 KI mice Schematic of the TaqMan probes and their targeting sites within the WT IgH and PGT121 IgH. T: TaqMan probe. Schematic showing the annealing sites of primers used to validate PGT121 KI animals. Fo.1F and Fo.2F primers were targeted at promoter region and PGT121 region, respectively, and combined with Re.1R primer targeted to the genomic region after homologous 3′ Arm. KI alleles are predicted to result in the amplification of a Fo.1 fragment (3.3 kb) and Fo.2 fragment (2.8 kb). Genomic DNA was extracted from the F0 founders born after CRISPR injection or from a C57BL/6 (WT) mouse. Long‐range PCR was performed to detect the insertion of the PGT121 VDJ sequences at the correct genomic locus. Table showing the frequency of the different genotypes of mice generated after CRISPR injection with plasmid donors containing long or short homology arms. # of HDR occurrence indicates the integration of the PGT121 heavy chain in the mouse IgH locus. # of Cas9‐mediated D 4 ‐J 4 deletions indicates the efficiency of our sgRNA‐directed Cas9 double‐stranded breaks. HC: heavy chain.

    Techniques Used: Mouse Assay, Amplification, CRISPR, Injection, Polymerase Chain Reaction, Generated, Plasmid Preparation

    One‐step CRISPR zygote injection to generate mice carrying PGT121 heavy chain in the mouse IgH locus Schematic depicting CRISPR/Cas9 injection. A circular plasmid bearing germline PGT121‐gH VDJ sequences, two guide RNAs, and Cas9 protein were injected into zygotes and implanted into pseudopregnant mice. Cas9‐induced double‐stranded breaks in the genome of zygotes are used to insert germline PGT121 VDJ sequences flanked by homologous arms on each side of the cut site via HDR. After 3 weeks, F0 founder mice are born, some of which bear the human bnAbs germline precursor. Strategy for insertion of PGT121 rearranged VDJ into mouse IgH locus. Targeting DNA donor with 5′ (3.9 kb) and 3′ (2.6 kb) homology arms to the C57BL/6 WT mouse IgH locus, murine VHJ558 promoter, leader, and the human PGT121 heavy chain VDJ sequences are located between two homology arms. CRISPR/Cas9‐mediated HDR leads to the insertion of the promoter and PGT121 sequences into the C57BL/6 mouse genome. P: murine VHJ558 promoter; HDR: homology‐directed repair; bnAbs: broadly neutralizing antibodies. sgRNA targeting sites are indicated in red. Three distinct fragments of genomic DNA were amplified by PCR, and in vitro digestion assay was performed with each of the sgRNAs to validate the efficiency of Cas9‐mediated cleavage. Analysis sgRNA off‐target effects in unrelated genes. Amplicons corresponding to Aakt, Map3K10, and Nop9 were generated by PCR by using gene‐specific primers. In vitro digestion assay was performed to measure the Cas9‐directed cleavage efficiency.
    Figure Legend Snippet: One‐step CRISPR zygote injection to generate mice carrying PGT121 heavy chain in the mouse IgH locus Schematic depicting CRISPR/Cas9 injection. A circular plasmid bearing germline PGT121‐gH VDJ sequences, two guide RNAs, and Cas9 protein were injected into zygotes and implanted into pseudopregnant mice. Cas9‐induced double‐stranded breaks in the genome of zygotes are used to insert germline PGT121 VDJ sequences flanked by homologous arms on each side of the cut site via HDR. After 3 weeks, F0 founder mice are born, some of which bear the human bnAbs germline precursor. Strategy for insertion of PGT121 rearranged VDJ into mouse IgH locus. Targeting DNA donor with 5′ (3.9 kb) and 3′ (2.6 kb) homology arms to the C57BL/6 WT mouse IgH locus, murine VHJ558 promoter, leader, and the human PGT121 heavy chain VDJ sequences are located between two homology arms. CRISPR/Cas9‐mediated HDR leads to the insertion of the promoter and PGT121 sequences into the C57BL/6 mouse genome. P: murine VHJ558 promoter; HDR: homology‐directed repair; bnAbs: broadly neutralizing antibodies. sgRNA targeting sites are indicated in red. Three distinct fragments of genomic DNA were amplified by PCR, and in vitro digestion assay was performed with each of the sgRNAs to validate the efficiency of Cas9‐mediated cleavage. Analysis sgRNA off‐target effects in unrelated genes. Amplicons corresponding to Aakt, Map3K10, and Nop9 were generated by PCR by using gene‐specific primers. In vitro digestion assay was performed to measure the Cas9‐directed cleavage efficiency.

    Techniques Used: CRISPR, Injection, Mouse Assay, Plasmid Preparation, Amplification, Polymerase Chain Reaction, In Vitro, Generated

    20) Product Images from "One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice"

    Article Title: One‐step CRISPR/Cas9 method for the rapid generation of human antibody heavy chain knock‐in mice

    Journal: The EMBO Journal

    doi: 10.15252/embj.201899243

    Characterization of PGT121 KI mice Schematic of the TaqMan probes and their targeting sites within the WT IgH and PGT121 IgH. T: TaqMan probe. Schematic showing the annealing sites of primers used to validate PGT121 KI animals. Fo.1F and Fo.2F primers were targeted at promoter region and PGT121 region, respectively, and combined with Re.1R primer targeted to the genomic region after homologous 3′ Arm. KI alleles are predicted to result in the amplification of a Fo.1 fragment (3.3 kb) and Fo.2 fragment (2.8 kb). Genomic DNA was extracted from the F0 founders born after CRISPR injection or from a C57BL/6 (WT) mouse. Long‐range PCR was performed to detect the insertion of the PGT121 VDJ sequences at the correct genomic locus. Table showing the frequency of the different genotypes of mice generated after CRISPR injection with plasmid donors containing long or short homology arms. # of HDR occurrence indicates the integration of the PGT121 heavy chain in the mouse IgH locus. # of Cas9‐mediated D 4 ‐J 4 deletions indicates the efficiency of our sgRNA‐directed Cas9 double‐stranded breaks. HC: heavy chain.
    Figure Legend Snippet: Characterization of PGT121 KI mice Schematic of the TaqMan probes and their targeting sites within the WT IgH and PGT121 IgH. T: TaqMan probe. Schematic showing the annealing sites of primers used to validate PGT121 KI animals. Fo.1F and Fo.2F primers were targeted at promoter region and PGT121 region, respectively, and combined with Re.1R primer targeted to the genomic region after homologous 3′ Arm. KI alleles are predicted to result in the amplification of a Fo.1 fragment (3.3 kb) and Fo.2 fragment (2.8 kb). Genomic DNA was extracted from the F0 founders born after CRISPR injection or from a C57BL/6 (WT) mouse. Long‐range PCR was performed to detect the insertion of the PGT121 VDJ sequences at the correct genomic locus. Table showing the frequency of the different genotypes of mice generated after CRISPR injection with plasmid donors containing long or short homology arms. # of HDR occurrence indicates the integration of the PGT121 heavy chain in the mouse IgH locus. # of Cas9‐mediated D 4 ‐J 4 deletions indicates the efficiency of our sgRNA‐directed Cas9 double‐stranded breaks. HC: heavy chain.

    Techniques Used: Mouse Assay, Amplification, CRISPR, Injection, Polymerase Chain Reaction, Generated, Plasmid Preparation

    One‐step CRISPR zygote injection to generate mice carrying PGT121 heavy chain in the mouse IgH locus Schematic depicting CRISPR/Cas9 injection. A circular plasmid bearing germline PGT121‐gH VDJ sequences, two guide RNAs, and Cas9 protein were injected into zygotes and implanted into pseudopregnant mice. Cas9‐induced double‐stranded breaks in the genome of zygotes are used to insert germline PGT121 VDJ sequences flanked by homologous arms on each side of the cut site via HDR. After 3 weeks, F0 founder mice are born, some of which bear the human bnAbs germline precursor. Strategy for insertion of PGT121 rearranged VDJ into mouse IgH locus. Targeting DNA donor with 5′ (3.9 kb) and 3′ (2.6 kb) homology arms to the C57BL/6 WT mouse IgH locus, murine VHJ558 promoter, leader, and the human PGT121 heavy chain VDJ sequences are located between two homology arms. CRISPR/Cas9‐mediated HDR leads to the insertion of the promoter and PGT121 sequences into the C57BL/6 mouse genome. P: murine VHJ558 promoter; HDR: homology‐directed repair; bnAbs: broadly neutralizing antibodies. sgRNA targeting sites are indicated in red. Three distinct fragments of genomic DNA were amplified by PCR, and in vitro digestion assay was performed with each of the sgRNAs to validate the efficiency of Cas9‐mediated cleavage. Analysis sgRNA off‐target effects in unrelated genes. Amplicons corresponding to Aakt, Map3K10, and Nop9 were generated by PCR by using gene‐specific primers. In vitro digestion assay was performed to measure the Cas9‐directed cleavage efficiency.
    Figure Legend Snippet: One‐step CRISPR zygote injection to generate mice carrying PGT121 heavy chain in the mouse IgH locus Schematic depicting CRISPR/Cas9 injection. A circular plasmid bearing germline PGT121‐gH VDJ sequences, two guide RNAs, and Cas9 protein were injected into zygotes and implanted into pseudopregnant mice. Cas9‐induced double‐stranded breaks in the genome of zygotes are used to insert germline PGT121 VDJ sequences flanked by homologous arms on each side of the cut site via HDR. After 3 weeks, F0 founder mice are born, some of which bear the human bnAbs germline precursor. Strategy for insertion of PGT121 rearranged VDJ into mouse IgH locus. Targeting DNA donor with 5′ (3.9 kb) and 3′ (2.6 kb) homology arms to the C57BL/6 WT mouse IgH locus, murine VHJ558 promoter, leader, and the human PGT121 heavy chain VDJ sequences are located between two homology arms. CRISPR/Cas9‐mediated HDR leads to the insertion of the promoter and PGT121 sequences into the C57BL/6 mouse genome. P: murine VHJ558 promoter; HDR: homology‐directed repair; bnAbs: broadly neutralizing antibodies. sgRNA targeting sites are indicated in red. Three distinct fragments of genomic DNA were amplified by PCR, and in vitro digestion assay was performed with each of the sgRNAs to validate the efficiency of Cas9‐mediated cleavage. Analysis sgRNA off‐target effects in unrelated genes. Amplicons corresponding to Aakt, Map3K10, and Nop9 were generated by PCR by using gene‐specific primers. In vitro digestion assay was performed to measure the Cas9‐directed cleavage efficiency.

    Techniques Used: CRISPR, Injection, Mouse Assay, Plasmid Preparation, Amplification, Polymerase Chain Reaction, In Vitro, Generated

    21) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    22) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    23) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    24) Product Images from "Efficacy of In Vivo Electroporation on the Delivery of Molecular Agents into Aphid (Hemiptera: Aphididae) Ovarioles"

    Article Title: Efficacy of In Vivo Electroporation on the Delivery of Molecular Agents into Aphid (Hemiptera: Aphididae) Ovarioles

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/iey041

    Image depicting the electroporation station (a) and the electroporation device (b) used to introduce the CRISPR/Cas9 complex into aphid offspring in vivo.
    Figure Legend Snippet: Image depicting the electroporation station (a) and the electroporation device (b) used to introduce the CRISPR/Cas9 complex into aphid offspring in vivo.

    Techniques Used: Electroporation, Introduce, CRISPR, In Vivo

    Bar graphs representing total aphid offspring per day for 4 d following microinjection and electroporation trials. Graphs represent aphid offspring from the Trial 1: CRISPR treatment, the Trial 2: CRISPR treatment, and the three control treatments: Carrier RNA, Carrier RNA + Cas9, and Cas9.
    Figure Legend Snippet: Bar graphs representing total aphid offspring per day for 4 d following microinjection and electroporation trials. Graphs represent aphid offspring from the Trial 1: CRISPR treatment, the Trial 2: CRISPR treatment, and the three control treatments: Carrier RNA, Carrier RNA + Cas9, and Cas9.

    Techniques Used: Electroporation, CRISPR

    25) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    26) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    27) Product Images from "Clustering-local-unique-enriched-signals (CLUES) promotes identification of novel regulators of ES cell self-renewal and pluripotency"

    Article Title: Clustering-local-unique-enriched-signals (CLUES) promotes identification of novel regulators of ES cell self-renewal and pluripotency

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0206844

    CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a CRISPR/Cas9 negative selection genetic screen (Kolmogorov–Smirnov test, p
    Figure Legend Snippet: CLUES captures bivalent chromatin status, core regulation genes circuitry and novel self-renewal and pluripotency regulators of mouse ES cells by integrating prioritized broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4. a. Genes associated with top-ranked broad E-signals of Nanog and Oct4. b. The plots of broad E-signals of H3K4me3, H3K27me3, Nanog and Oct4 and RNA-Seq signals at Sox2, Oct4 and Nanog locus. Y-axes, RPKM of Nanog, Oct4, H3K4me3, and H3K27me3 ChIP-Seq datasets and RNA-Seq datasets. c. A heat-map of broad H3K4me3 E-signals associated with broad H3K27me3 E-signals, top-ranked Nanog (top 5%) and top-ranked Oct4 (top 5%) broad E-signals. The heat-map is rank-ordered by broad H3K4me3 E-signals. d. The top 100 genes revealed by the CLUES integrated analysis are significantly enriched at the top of the list from a CRISPR/Cas9 negative selection genetic screen (Kolmogorov–Smirnov test, p

    Techniques Used: RNA Sequencing Assay, Chromatin Immunoprecipitation, CRISPR, Selection

    28) Product Images from "Whole exome sequencing of ENU-induced thrombosis modifier mutations in the mouse"

    Article Title: Whole exome sequencing of ENU-induced thrombosis modifier mutations in the mouse

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007658

    An independent CRISPR/Cas9 induced Plcb4 allele validates the rescue phenotype. A) The CRISPR/Cas9-induced Plcb4 ins1 allele (insertion of the nucleotide ‘A’ at amino acid 328) results in a frameshift to the protein coding sequence leading to a premature stop codon. B) Sanger sequencing analysis of gDNA from a wildtype mouse and both gDNA and cDNA from a Plcb4 +/ins1 mouse at the Plcb4 1bp insertion site. C) 169 progeny genotyped from a validation cross of F5 L/L Plcb4 +/ins1 mice with F5 L/+ Tfpi +/- .
    Figure Legend Snippet: An independent CRISPR/Cas9 induced Plcb4 allele validates the rescue phenotype. A) The CRISPR/Cas9-induced Plcb4 ins1 allele (insertion of the nucleotide ‘A’ at amino acid 328) results in a frameshift to the protein coding sequence leading to a premature stop codon. B) Sanger sequencing analysis of gDNA from a wildtype mouse and both gDNA and cDNA from a Plcb4 +/ins1 mouse at the Plcb4 1bp insertion site. C) 169 progeny genotyped from a validation cross of F5 L/L Plcb4 +/ins1 mice with F5 L/+ Tfpi +/- .

    Techniques Used: CRISPR, Sequencing, Mouse Assay

    29) Product Images from "Targeted genome fragmentation with CRISPR/Cas9 enables fast and efficient enrichment of small genomic regions and ultra-accurate sequencing with low DNA input (CRISPR-DS)"

    Article Title: Targeted genome fragmentation with CRISPR/Cas9 enables fast and efficient enrichment of small genomic regions and ultra-accurate sequencing with low DNA input (CRISPR-DS)

    Journal: Genome Research

    doi: 10.1101/gr.235291.118

    Visualization of sequencing libraries and data prepared with CRISPR-DS and standard-DS. ( A ) TapeStation gels show distinct bands for CRISPR-DS as opposed to a smear for standard-DS. The size of bands corresponds to the CRISPR/Cas9-cut fragments with adapters. ( B ) CRISPR-DS electropherograms allow visualization and quantification of peaks for quality control of the library prior to sequencing. Standard-DS electropherograms show a diffuse peak that harbors no information about the specificity of the library. ( C ) Dots represent original barcoded DNA molecules. Each DNA molecule has multiple copies generated at PCR ( x -axis). In CRISPR-DS, all DNA molecules (red dots) have preset sizes ( y -axis) and generate a similar number of PCR copies. In standard-DS, sonication shears DNA into variable fragment lengths (blue dots). Smaller fragments amplify better and generate an excess of copies that waste sequencing resources. ( D ) Integrative Genomics Viewer of TP53 coverage with DCS reads generated by CRISPR-DS and standard-DS. CRISPR-DS shows distinct boundaries that correspond to the CRISPR/Cas9 cutting points and an even distribution of depth across positions, both within a fragment and between fragments. Standard-DS shows the typical “peak” pattern generated by random shearing of fragments and hybridization capture, which leads to variable coverage.
    Figure Legend Snippet: Visualization of sequencing libraries and data prepared with CRISPR-DS and standard-DS. ( A ) TapeStation gels show distinct bands for CRISPR-DS as opposed to a smear for standard-DS. The size of bands corresponds to the CRISPR/Cas9-cut fragments with adapters. ( B ) CRISPR-DS electropherograms allow visualization and quantification of peaks for quality control of the library prior to sequencing. Standard-DS electropherograms show a diffuse peak that harbors no information about the specificity of the library. ( C ) Dots represent original barcoded DNA molecules. Each DNA molecule has multiple copies generated at PCR ( x -axis). In CRISPR-DS, all DNA molecules (red dots) have preset sizes ( y -axis) and generate a similar number of PCR copies. In standard-DS, sonication shears DNA into variable fragment lengths (blue dots). Smaller fragments amplify better and generate an excess of copies that waste sequencing resources. ( D ) Integrative Genomics Viewer of TP53 coverage with DCS reads generated by CRISPR-DS and standard-DS. CRISPR-DS shows distinct boundaries that correspond to the CRISPR/Cas9 cutting points and an even distribution of depth across positions, both within a fragment and between fragments. Standard-DS shows the typical “peak” pattern generated by random shearing of fragments and hybridization capture, which leads to variable coverage.

    Techniques Used: Sequencing, CRISPR, Generated, Polymerase Chain Reaction, Sonication, Hybridization

    Schematic representation of key aspects of CRISPR-DS. ( A ) CRISPR/Cas9 digestion of TP53 . Seven fragments containing all TP53 coding exons were excised via targeted cutting using gRNAs. Dark gray represents reference strand, and light gray represents the anti-reference strand. ( B ) Size selection using 0.5× SPRI beads. Uncut, genomic DNA binds to the beads and allows the recovery of the homogenously sized excised fragments in solution. ( C ) Double-stranded DNA molecule fragmented and ligated with double-stranded DS adapters. Adapters contain 10 bp of random, complementary nucleotides and a 3′-dT overhang. ( D ) Error correction by DS. After creating single-strand consensus sequence (SSCS) reads, SSCS reads derived from the same original DNA molecule are compared with one another to create a double-strand consensus sequence (DCS). Only mutations found in both SSCS reads are counted as true mutations in DCS reads.
    Figure Legend Snippet: Schematic representation of key aspects of CRISPR-DS. ( A ) CRISPR/Cas9 digestion of TP53 . Seven fragments containing all TP53 coding exons were excised via targeted cutting using gRNAs. Dark gray represents reference strand, and light gray represents the anti-reference strand. ( B ) Size selection using 0.5× SPRI beads. Uncut, genomic DNA binds to the beads and allows the recovery of the homogenously sized excised fragments in solution. ( C ) Double-stranded DNA molecule fragmented and ligated with double-stranded DS adapters. Adapters contain 10 bp of random, complementary nucleotides and a 3′-dT overhang. ( D ) Error correction by DS. After creating single-strand consensus sequence (SSCS) reads, SSCS reads derived from the same original DNA molecule are compared with one another to create a double-strand consensus sequence (DCS). Only mutations found in both SSCS reads are counted as true mutations in DCS reads.

    Techniques Used: CRISPR, Selection, Sequencing, Derivative Assay

    CRISPR/Cas9 fragmentation enables target enrichment by size selection, eliminates one round of hybridization capture, and increases sequencing yield
    Figure Legend Snippet: CRISPR/Cas9 fragmentation enables target enrichment by size selection, eliminates one round of hybridization capture, and increases sequencing yield

    Techniques Used: CRISPR, Selection, Hybridization, Sequencing

    Comparison of library preparation protocols for standard-DS versus CRISPR-DS. The primary differences between the CRISPR-DS and standard-DS library preparation are the fragmentation methods and the number of hybridization capture steps. Instead of fragmentation by sonication as performed in standard-DS, CRISPR-DS relies on an in vitro excision of target regions by CRISPR/Cas9 followed by size selection for the excised fragments. Although this method requires additional preparation to design locus-specific gRNAs, this is a one-step process that then reduces the protocol by nearly a day. The reduction is achieved by the elimination of the second round of hybridization capture, which is required for sufficient target enrichment in the standard-DS protocol but not in CRISPR-DS. Colored boxes represent 1 h of time.
    Figure Legend Snippet: Comparison of library preparation protocols for standard-DS versus CRISPR-DS. The primary differences between the CRISPR-DS and standard-DS library preparation are the fragmentation methods and the number of hybridization capture steps. Instead of fragmentation by sonication as performed in standard-DS, CRISPR-DS relies on an in vitro excision of target regions by CRISPR/Cas9 followed by size selection for the excised fragments. Although this method requires additional preparation to design locus-specific gRNAs, this is a one-step process that then reduces the protocol by nearly a day. The reduction is achieved by the elimination of the second round of hybridization capture, which is required for sufficient target enrichment in the standard-DS protocol but not in CRISPR-DS. Colored boxes represent 1 h of time.

    Techniques Used: CRISPR, Hybridization, Sonication, In Vitro, Selection

    30) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    31) Product Images from "A GCSFR/CSF3R zebrafish mutant models the persistent basal neutrophil deficiency of severe congenital neutropenia"

    Article Title: A GCSFR/CSF3R zebrafish mutant models the persistent basal neutrophil deficiency of severe congenital neutropenia

    Journal: Scientific Reports

    doi: 10.1038/srep44455

    CRISPR/Cas9-induced mutant zebrafish csf3r alleles. ( a ) Intron/exon structure of zebrafish csf3r locus. ( b ) Domain structure of zebrafish Csf3r protein. Ig = immunoglobulin, FBN = fibronectin. ( c ) Four CRISPR/Cas9-induced csf3r nonsense mutations identified in adult F1 DNA (designated alleles 1–4 for this report) aligned to WT sequence. The corresponding predicted truncated amino acid sequences are shown: blue = native Csf3r sequence, red = predicted non-native sequence downstream of the mutation site, *premature stop.
    Figure Legend Snippet: CRISPR/Cas9-induced mutant zebrafish csf3r alleles. ( a ) Intron/exon structure of zebrafish csf3r locus. ( b ) Domain structure of zebrafish Csf3r protein. Ig = immunoglobulin, FBN = fibronectin. ( c ) Four CRISPR/Cas9-induced csf3r nonsense mutations identified in adult F1 DNA (designated alleles 1–4 for this report) aligned to WT sequence. The corresponding predicted truncated amino acid sequences are shown: blue = native Csf3r sequence, red = predicted non-native sequence downstream of the mutation site, *premature stop.

    Techniques Used: CRISPR, Mutagenesis, Sequencing

    32) Product Images from "Herpesviral lytic gene functions render the viral genome susceptible to novel editing by CRISPR/Cas9"

    Article Title: Herpesviral lytic gene functions render the viral genome susceptible to novel editing by CRISPR/Cas9

    Journal: eLife

    doi: 10.7554/eLife.51662

    Effect of ICP0 on CRISPR-Cas9-induced DNA repair of input HSV genome. HFFs transduced with lentivirus expressing SaCas9 and sgRNA were infected with ICP0-null mutant HSV-1 at an MOI of 3 in the presence of PAA and harvested at the indicated time post infection. The accumulated DNAs were detected by real-time qPCR amplifying within the U L 29 gene ( A ) or over the UL30-5 sgRNA ( B ) target site. The histogram shows the mean values and standard deviations biological replicates (N ≥ 3, Ratio paired t test, *p
    Figure Legend Snippet: Effect of ICP0 on CRISPR-Cas9-induced DNA repair of input HSV genome. HFFs transduced with lentivirus expressing SaCas9 and sgRNA were infected with ICP0-null mutant HSV-1 at an MOI of 3 in the presence of PAA and harvested at the indicated time post infection. The accumulated DNAs were detected by real-time qPCR amplifying within the U L 29 gene ( A ) or over the UL30-5 sgRNA ( B ) target site. The histogram shows the mean values and standard deviations biological replicates (N ≥ 3, Ratio paired t test, *p

    Techniques Used: CRISPR, Transduction, Expressing, Infection, Mutagenesis, Real-time Polymerase Chain Reaction

    Effect of CRISPR-Cas9 on HSV-1 lytic infection. ( A ) Experimental scheme of SaCas9/sgRNA-mediated inhibition of HSV lytic infection. ( B and C ) HFFs transduced with lentivirus expressing SaCas9 and sgRNAs were infected with HSV-1 at an MOI of 0.1 ( C ) or 5 ( D ) and harvested at 48 hpi or 24 hpi, respectively. Viral yields were determined by plaque assays. The histogram shows the mean values and standard deviations of biological replicates at an MOI of 0.1 (N = 3) or at an MOI of 5 (N = 4). All the sgRNA added conditions showed statistical significance compared to +Cas9 /-gRNA (one-way ANOVA with Dunnett’s multiple comparisons test, p
    Figure Legend Snippet: Effect of CRISPR-Cas9 on HSV-1 lytic infection. ( A ) Experimental scheme of SaCas9/sgRNA-mediated inhibition of HSV lytic infection. ( B and C ) HFFs transduced with lentivirus expressing SaCas9 and sgRNAs were infected with HSV-1 at an MOI of 0.1 ( C ) or 5 ( D ) and harvested at 48 hpi or 24 hpi, respectively. Viral yields were determined by plaque assays. The histogram shows the mean values and standard deviations of biological replicates at an MOI of 0.1 (N = 3) or at an MOI of 5 (N = 4). All the sgRNA added conditions showed statistical significance compared to +Cas9 /-gRNA (one-way ANOVA with Dunnett’s multiple comparisons test, p

    Techniques Used: CRISPR, Infection, Inhibition, Transduction, Expressing

    CRISPR/Cas9-induced mutagenesis of quiescent d 109 genomes and effect on reactivation. ( A ) Experimental scheme of SaCas9/sgRNA-mediated inhibition of reactivation of quiescent d 109 genomes in HFFs. HFFs were infected with HSV-1 d 109 virus to establish quiescent infection for 7–10 d and transduced with lentivirus expressing SaCas9 and sgRNAs for 7–10 d. ( B and C ) HFF were infected with d 109 to establish quiescent infection for 7–10 d and transduced with lentivirus expressing SaCas9 and sgRNAs for 7–10 d. To reactivate quiescent d 109 genomes, HFFs were superinfected with WT HSV-1 at an MOI of 5 and harvested at 24 hpi. GFP-positive viral yields were determined by plaque assays on FO6 and V27 cells. The histogram shows the mean values and standard deviations of biological replicates (B and C: N = 5 and N = 7 respectively). All the sgRNA added conditions showed statistical significance compared to +Cas9 /-gRNA (Ratio paired t test, *p
    Figure Legend Snippet: CRISPR/Cas9-induced mutagenesis of quiescent d 109 genomes and effect on reactivation. ( A ) Experimental scheme of SaCas9/sgRNA-mediated inhibition of reactivation of quiescent d 109 genomes in HFFs. HFFs were infected with HSV-1 d 109 virus to establish quiescent infection for 7–10 d and transduced with lentivirus expressing SaCas9 and sgRNAs for 7–10 d. ( B and C ) HFF were infected with d 109 to establish quiescent infection for 7–10 d and transduced with lentivirus expressing SaCas9 and sgRNAs for 7–10 d. To reactivate quiescent d 109 genomes, HFFs were superinfected with WT HSV-1 at an MOI of 5 and harvested at 24 hpi. GFP-positive viral yields were determined by plaque assays on FO6 and V27 cells. The histogram shows the mean values and standard deviations of biological replicates (B and C: N = 5 and N = 7 respectively). All the sgRNA added conditions showed statistical significance compared to +Cas9 /-gRNA (Ratio paired t test, *p

    Techniques Used: CRISPR, Mutagenesis, Inhibition, Infection, Transduction, Expressing

    In vitro cleavage assay. ( A ) Schematic diagram of in vitro cleavage assay ( B ) Results are shown for three sgRNAs targeting U L 30 (UL30-3, -4, and -5). T7 in vitro transcribed sgRNA was combined with SpCas9 protein and a PCR template containing the CRISPR sequence, incubated 1 hr at 37°C and run on an agarose gel. Lane (1) SpCas9+sgRNA, lane (2) Cas9 only, lane (3) sgRNA only, lane (4) no Cas9/sgRNA. Efficient cutting is seen for UL30-4 and -5 but not UL30-3.
    Figure Legend Snippet: In vitro cleavage assay. ( A ) Schematic diagram of in vitro cleavage assay ( B ) Results are shown for three sgRNAs targeting U L 30 (UL30-3, -4, and -5). T7 in vitro transcribed sgRNA was combined with SpCas9 protein and a PCR template containing the CRISPR sequence, incubated 1 hr at 37°C and run on an agarose gel. Lane (1) SpCas9+sgRNA, lane (2) Cas9 only, lane (3) sgRNA only, lane (4) no Cas9/sgRNA. Efficient cutting is seen for UL30-4 and -5 but not UL30-3.

    Techniques Used: In Vitro, Cleavage Assay, Polymerase Chain Reaction, CRISPR, Sequencing, Incubation, Agarose Gel Electrophoresis

    Model for CRISPR/Cas9 mediated inhibition of HSV lytic replication, editing of latent HSV genomes, and inhibition of reactivation of latent HSV. Lytic infection : Cas9/sgRNA cleaves input viral DNA. In the absence of viral DNA replication, either prior to the onset of viral replication or in the presence of PAA, the expression of Cas9/sgRNA targeting viral gene encoded protein is reduced and the input viral DNAs decrease. Cas9/sgRNA induces low levels of indel mutations at the sgRNA target site of the input viral DNA, and cleaved input viral DNA is accumulated. During viral DNA replication, expression of Cas9/sgRNA targeting the viral gene encoded protein is reduced, non-mutated template and its replicated viral DNAs are targeted by SaCas9/sgRNA, which results in a decrease of viral DNA, an increase in indel mutations and accumulation of cleaved viral DNA. Viral protein ICP0 contributes to Cas9/sgRNA-mediated editing/cleavage by removing histones and preventing DNA repair. Quiescent infection : Cas9/sgRNA induces indel mutations to viral DNA without significant change in latent viral DNA levels. (⬤: nucleosome) Reactivation : Cas9/sgRNA induces more indel mutations in non-mutated viral DNA and accumulation of cleaved viral DNA, which results in decrease of the expression of SaCas9/sgRNA targeted gene encoded protein, viral DNA, and viral replication. (⇧: increase, ⬇: decrease, ●: no change).
    Figure Legend Snippet: Model for CRISPR/Cas9 mediated inhibition of HSV lytic replication, editing of latent HSV genomes, and inhibition of reactivation of latent HSV. Lytic infection : Cas9/sgRNA cleaves input viral DNA. In the absence of viral DNA replication, either prior to the onset of viral replication or in the presence of PAA, the expression of Cas9/sgRNA targeting viral gene encoded protein is reduced and the input viral DNAs decrease. Cas9/sgRNA induces low levels of indel mutations at the sgRNA target site of the input viral DNA, and cleaved input viral DNA is accumulated. During viral DNA replication, expression of Cas9/sgRNA targeting the viral gene encoded protein is reduced, non-mutated template and its replicated viral DNAs are targeted by SaCas9/sgRNA, which results in a decrease of viral DNA, an increase in indel mutations and accumulation of cleaved viral DNA. Viral protein ICP0 contributes to Cas9/sgRNA-mediated editing/cleavage by removing histones and preventing DNA repair. Quiescent infection : Cas9/sgRNA induces indel mutations to viral DNA without significant change in latent viral DNA levels. (⬤: nucleosome) Reactivation : Cas9/sgRNA induces more indel mutations in non-mutated viral DNA and accumulation of cleaved viral DNA, which results in decrease of the expression of SaCas9/sgRNA targeted gene encoded protein, viral DNA, and viral replication. (⇧: increase, ⬇: decrease, ●: no change).

    Techniques Used: CRISPR, Inhibition, Infection, Expressing

    Effect of CRISPR-Cas9 on input HSV genomes. ( A ) HFFs transduced with lentivirus expressing Cas9 and sgRNA were infected with HSV-1 at an MOI of 1 in the presence or absence of PAA and harvested at 10 hpi. Proteins were detected by immunoblotting with antibodies specific for the indicated proteins. Immunoblots of GAPDH are shown as a control. ( B and C ) HFFs transduced with lentivirus expressing SaCas9 and sgRNA were infected with HSV-1 at an MOI of 3 in the presence of PAA and harvested at the indicated times post infection. The accumulated DNAs were detected by real time qPCR amplifying within the U L 29 gene ( B ) or over the UL30-5 sgRNA ( C ) target site. The histogram shows the mean values and standard deviations from biological replicates (N ≥ 3, Ratio paired t test, **p
    Figure Legend Snippet: Effect of CRISPR-Cas9 on input HSV genomes. ( A ) HFFs transduced with lentivirus expressing Cas9 and sgRNA were infected with HSV-1 at an MOI of 1 in the presence or absence of PAA and harvested at 10 hpi. Proteins were detected by immunoblotting with antibodies specific for the indicated proteins. Immunoblots of GAPDH are shown as a control. ( B and C ) HFFs transduced with lentivirus expressing SaCas9 and sgRNA were infected with HSV-1 at an MOI of 3 in the presence of PAA and harvested at the indicated times post infection. The accumulated DNAs were detected by real time qPCR amplifying within the U L 29 gene ( B ) or over the UL30-5 sgRNA ( C ) target site. The histogram shows the mean values and standard deviations from biological replicates (N ≥ 3, Ratio paired t test, **p

    Techniques Used: CRISPR, Transduction, Expressing, Infection, Western Blot, Real-time Polymerase Chain Reaction

    33) Product Images from "Inhibition of ErbB kinase signalling promotes resolution of neutrophilic inflammation"

    Article Title: Inhibition of ErbB kinase signalling promotes resolution of neutrophilic inflammation

    Journal: eLife

    doi: 10.7554/eLife.50990

    Pharmacological inhibition and genetic knockdown of egfra and erbb2 by CRISPR/Cas9 reduces neutrophil number at the site of injury in a zebrafish model of inflammation. Tail fin transection was performed as indicated by the red line ( A , upper image). Zebrafish larvae ( mpx :GFP) were pre-treated at two dpf with DMSO, tyrphostin AG825 [Tyr, 10 µM] ( B , minimum n = 28 larvae per condition), or CP-724714 [10 µM] ( C , minimum n = 42 larvae per condition) for 16 hr followed by injury. egfra and erbb2 crispants were generated and injured at two dpf ( D , minimum n = 36 larvae per condition). The number of neutrophils at the site of injury was determined at 4 and 8 hpi by counting GFP-positive neutrophils. To enumerate neutrophils across the whole body, uninjured inhibitor treated larvae (three dpf) ( E , minimum n = 23 larvae per condition) or crispants (two dpf) ( F , minimum n = 28 larvae per condition) were imaged by fluorescent microscopy (A, lower image). Apoptosis was measured at the site of injury after 8 hr by TSA and TUNEL double staining ( G ) (white arrow indicates TUNEL positive neutrophil, scale bar 10 μM) of mpx: GFP tyrphostin AG825 [Tyr, 10 µM] or CP-724714 [10 µM] treated larvae at three dpf ( H , minimum n = 35 larvae per condition). Uninjured inhibitor treated larvae were assessed for neutrophil apoptosis in the CHT at three dpf ( I , minimum n = 27 larvae per group). Apoptosis at the tail fin injury site of egfra erbb2 crispants at two dpf was also measured at eight hpi ( J , minimum n = 26 larvae per group). All data collated from at least three independent experiments, displayed as mean ± SEM. Each icon shows one data point from one individual larvae. Statistically significant differences were calculated by two-way ANOVA with Sidak post-test ( B–D ) or one-way ANOVA with Dunnett’s post-test(E), Students’ t-test ( F ), Kruskal-Wallis test with Dunn’s post-test ( H–I ) or Mann-Whitney U test ( J ), and indicated as *p
    Figure Legend Snippet: Pharmacological inhibition and genetic knockdown of egfra and erbb2 by CRISPR/Cas9 reduces neutrophil number at the site of injury in a zebrafish model of inflammation. Tail fin transection was performed as indicated by the red line ( A , upper image). Zebrafish larvae ( mpx :GFP) were pre-treated at two dpf with DMSO, tyrphostin AG825 [Tyr, 10 µM] ( B , minimum n = 28 larvae per condition), or CP-724714 [10 µM] ( C , minimum n = 42 larvae per condition) for 16 hr followed by injury. egfra and erbb2 crispants were generated and injured at two dpf ( D , minimum n = 36 larvae per condition). The number of neutrophils at the site of injury was determined at 4 and 8 hpi by counting GFP-positive neutrophils. To enumerate neutrophils across the whole body, uninjured inhibitor treated larvae (three dpf) ( E , minimum n = 23 larvae per condition) or crispants (two dpf) ( F , minimum n = 28 larvae per condition) were imaged by fluorescent microscopy (A, lower image). Apoptosis was measured at the site of injury after 8 hr by TSA and TUNEL double staining ( G ) (white arrow indicates TUNEL positive neutrophil, scale bar 10 μM) of mpx: GFP tyrphostin AG825 [Tyr, 10 µM] or CP-724714 [10 µM] treated larvae at three dpf ( H , minimum n = 35 larvae per condition). Uninjured inhibitor treated larvae were assessed for neutrophil apoptosis in the CHT at three dpf ( I , minimum n = 27 larvae per group). Apoptosis at the tail fin injury site of egfra erbb2 crispants at two dpf was also measured at eight hpi ( J , minimum n = 26 larvae per group). All data collated from at least three independent experiments, displayed as mean ± SEM. Each icon shows one data point from one individual larvae. Statistically significant differences were calculated by two-way ANOVA with Sidak post-test ( B–D ) or one-way ANOVA with Dunnett’s post-test(E), Students’ t-test ( F ), Kruskal-Wallis test with Dunn’s post-test ( H–I ) or Mann-Whitney U test ( J ), and indicated as *p

    Techniques Used: Inhibition, CRISPR, Generated, Microscopy, TUNEL Assay, Double Staining, MANN-WHITNEY

    34) Product Images from "Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis"

    Article Title: Nuclear receptor corepressors Ncor1 and Ncor2 (Smrt) are required for retinoic acid-dependent repression of Fgf8 during somitogenesis

    Journal: Developmental biology

    doi: 10.1016/j.ydbio.2016.08.005

    CRISPR/Cas9 gene editing of both Ncor1 and Ncor2 results in disruption of somitogenesis and heart development. (A) Strategy for generating mutations in the first exons of Ncor1 and Ncor2 using sgRNAs targeting the ATG start codon and GT splice donor site.
    Figure Legend Snippet: CRISPR/Cas9 gene editing of both Ncor1 and Ncor2 results in disruption of somitogenesis and heart development. (A) Strategy for generating mutations in the first exons of Ncor1 and Ncor2 using sgRNAs targeting the ATG start codon and GT splice donor site.

    Techniques Used: CRISPR

    Double knockout mutations of Ncor1 and Ncor2 generated using CRISPR/Cas9 gene editing result in ectopic Fgf8 expression and FGF signaling in both heart and caudal domains. (A–B) Shown is expression of Fgf8 (panel A) or the FGF target gene Spry2
    Figure Legend Snippet: Double knockout mutations of Ncor1 and Ncor2 generated using CRISPR/Cas9 gene editing result in ectopic Fgf8 expression and FGF signaling in both heart and caudal domains. (A–B) Shown is expression of Fgf8 (panel A) or the FGF target gene Spry2

    Techniques Used: Double Knockout, Generated, CRISPR, Expressing

    Raldh2 mutants generated by CRISPR/Cas9 gene editing phenocopy Raldh2−/− embryos generated by the traditional knockout strategy. (A) Strategy for generating mutations in the first exon of Raldh2 using sgRNAs targeting the ATG start codon
    Figure Legend Snippet: Raldh2 mutants generated by CRISPR/Cas9 gene editing phenocopy Raldh2−/− embryos generated by the traditional knockout strategy. (A) Strategy for generating mutations in the first exon of Raldh2 using sgRNAs targeting the ATG start codon

    Techniques Used: Generated, CRISPR, Knock-Out

    Deletion of Fgf8 RARE in mouse embryos results in small somite phenotype and ectopic caudal Fgf8 expression. Shown are the results obtained from mutant embryos generated by CRISPR/Cas9 gene editing near the Fgf8 RARE. (A–D) Wild-type (WT) and
    Figure Legend Snippet: Deletion of Fgf8 RARE in mouse embryos results in small somite phenotype and ectopic caudal Fgf8 expression. Shown are the results obtained from mutant embryos generated by CRISPR/Cas9 gene editing near the Fgf8 RARE. (A–D) Wild-type (WT) and

    Techniques Used: Expressing, Mutagenesis, Generated, CRISPR

    35) Product Images from "Long-read sequencing across the C9orf72 ‘GGGGCC’ repeat expansion: implications for clinical use and genetic discovery efforts in human disease"

    Article Title: Long-read sequencing across the C9orf72 ‘GGGGCC’ repeat expansion: implications for clinical use and genetic discovery efforts in human disease

    Journal: Molecular Neurodegeneration

    doi: 10.1186/s13024-018-0274-4

    Schematic of PacBio no-amplification (No-Amp) targeted sequencing. We applied the PacBio no-amplification (No-Amp) Targeted Sequencing method to a C9orf72 G 4 C 2 repeat expansion carrier to better characterize the repeat’s nucleotide content. The No-Amp targeted sequencing method begins with typical SMRTbell library preparation after the target region is excised by restriction enzyme digestion. Cas9 digestion follows with a guide RNA specific to sequence adjacent (Cas9 Cutting Site) to the region of interest (green), leaving the SMRTbells blunt ended. In this case, the guide RNA was specific to sequence upstream (5′) of the G 4 C 2 repeat expansion on the anti-sense strand. A new capture adapter (red) is then ligated to the blunt ends and captured using magnetic beads (magbeads). This process enriches the library for reads containing the region of interest to maximize read depth
    Figure Legend Snippet: Schematic of PacBio no-amplification (No-Amp) targeted sequencing. We applied the PacBio no-amplification (No-Amp) Targeted Sequencing method to a C9orf72 G 4 C 2 repeat expansion carrier to better characterize the repeat’s nucleotide content. The No-Amp targeted sequencing method begins with typical SMRTbell library preparation after the target region is excised by restriction enzyme digestion. Cas9 digestion follows with a guide RNA specific to sequence adjacent (Cas9 Cutting Site) to the region of interest (green), leaving the SMRTbells blunt ended. In this case, the guide RNA was specific to sequence upstream (5′) of the G 4 C 2 repeat expansion on the anti-sense strand. A new capture adapter (red) is then ligated to the blunt ends and captured using magnetic beads (magbeads). This process enriches the library for reads containing the region of interest to maximize read depth

    Techniques Used: Amplification, Sequencing, Magnetic Beads

    36) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    37) Product Images from "Targeted genome fragmentation with CRISPR/Cas9 enables fast and efficient enrichment of small genomic regions and ultra-accurate sequencing with low DNA input (CRISPR-DS)"

    Article Title: Targeted genome fragmentation with CRISPR/Cas9 enables fast and efficient enrichment of small genomic regions and ultra-accurate sequencing with low DNA input (CRISPR-DS)

    Journal: Genome Research

    doi: 10.1101/gr.235291.118

    Visualization of sequencing libraries and data prepared with CRISPR-DS and standard-DS. ( A ) TapeStation gels show distinct bands for CRISPR-DS as opposed to a smear for standard-DS. The size of bands corresponds to the CRISPR/Cas9-cut fragments with adapters. ( B ) CRISPR-DS electropherograms allow visualization and quantification of peaks for quality control of the library prior to sequencing. Standard-DS electropherograms show a diffuse peak that harbors no information about the specificity of the library. ( C ) Dots represent original barcoded DNA molecules. Each DNA molecule has multiple copies generated at PCR ( x -axis). In CRISPR-DS, all DNA molecules (red dots) have preset sizes ( y -axis) and generate a similar number of PCR copies. In standard-DS, sonication shears DNA into variable fragment lengths (blue dots). Smaller fragments amplify better and generate an excess of copies that waste sequencing resources. ( D ) Integrative Genomics Viewer of TP53 coverage with DCS reads generated by CRISPR-DS and standard-DS. CRISPR-DS shows distinct boundaries that correspond to the CRISPR/Cas9 cutting points and an even distribution of depth across positions, both within a fragment and between fragments. Standard-DS shows the typical “peak” pattern generated by random shearing of fragments and hybridization capture, which leads to variable coverage.
    Figure Legend Snippet: Visualization of sequencing libraries and data prepared with CRISPR-DS and standard-DS. ( A ) TapeStation gels show distinct bands for CRISPR-DS as opposed to a smear for standard-DS. The size of bands corresponds to the CRISPR/Cas9-cut fragments with adapters. ( B ) CRISPR-DS electropherograms allow visualization and quantification of peaks for quality control of the library prior to sequencing. Standard-DS electropherograms show a diffuse peak that harbors no information about the specificity of the library. ( C ) Dots represent original barcoded DNA molecules. Each DNA molecule has multiple copies generated at PCR ( x -axis). In CRISPR-DS, all DNA molecules (red dots) have preset sizes ( y -axis) and generate a similar number of PCR copies. In standard-DS, sonication shears DNA into variable fragment lengths (blue dots). Smaller fragments amplify better and generate an excess of copies that waste sequencing resources. ( D ) Integrative Genomics Viewer of TP53 coverage with DCS reads generated by CRISPR-DS and standard-DS. CRISPR-DS shows distinct boundaries that correspond to the CRISPR/Cas9 cutting points and an even distribution of depth across positions, both within a fragment and between fragments. Standard-DS shows the typical “peak” pattern generated by random shearing of fragments and hybridization capture, which leads to variable coverage.

    Techniques Used: Sequencing, CRISPR, Generated, Polymerase Chain Reaction, Sonication, Hybridization

    Schematic representation of key aspects of CRISPR-DS. ( A ) CRISPR/Cas9 digestion of TP53 . Seven fragments containing all TP53 coding exons were excised via targeted cutting using gRNAs. Dark gray represents reference strand, and light gray represents the anti-reference strand. ( B ) Size selection using 0.5× SPRI beads. Uncut, genomic DNA binds to the beads and allows the recovery of the homogenously sized excised fragments in solution. ( C ) Double-stranded DNA molecule fragmented and ligated with double-stranded DS adapters. Adapters contain 10 bp of random, complementary nucleotides and a 3′-dT overhang. ( D ) Error correction by DS. After creating single-strand consensus sequence (SSCS) reads, SSCS reads derived from the same original DNA molecule are compared with one another to create a double-strand consensus sequence (DCS). Only mutations found in both SSCS reads are counted as true mutations in DCS reads.
    Figure Legend Snippet: Schematic representation of key aspects of CRISPR-DS. ( A ) CRISPR/Cas9 digestion of TP53 . Seven fragments containing all TP53 coding exons were excised via targeted cutting using gRNAs. Dark gray represents reference strand, and light gray represents the anti-reference strand. ( B ) Size selection using 0.5× SPRI beads. Uncut, genomic DNA binds to the beads and allows the recovery of the homogenously sized excised fragments in solution. ( C ) Double-stranded DNA molecule fragmented and ligated with double-stranded DS adapters. Adapters contain 10 bp of random, complementary nucleotides and a 3′-dT overhang. ( D ) Error correction by DS. After creating single-strand consensus sequence (SSCS) reads, SSCS reads derived from the same original DNA molecule are compared with one another to create a double-strand consensus sequence (DCS). Only mutations found in both SSCS reads are counted as true mutations in DCS reads.

    Techniques Used: CRISPR, Selection, Sequencing, Derivative Assay

    CRISPR/Cas9 fragmentation enables target enrichment by size selection, eliminates one round of hybridization capture, and increases sequencing yield
    Figure Legend Snippet: CRISPR/Cas9 fragmentation enables target enrichment by size selection, eliminates one round of hybridization capture, and increases sequencing yield

    Techniques Used: CRISPR, Selection, Hybridization, Sequencing

    Comparison of library preparation protocols for standard-DS versus CRISPR-DS. The primary differences between the CRISPR-DS and standard-DS library preparation are the fragmentation methods and the number of hybridization capture steps. Instead of fragmentation by sonication as performed in standard-DS, CRISPR-DS relies on an in vitro excision of target regions by CRISPR/Cas9 followed by size selection for the excised fragments. Although this method requires additional preparation to design locus-specific gRNAs, this is a one-step process that then reduces the protocol by nearly a day. The reduction is achieved by the elimination of the second round of hybridization capture, which is required for sufficient target enrichment in the standard-DS protocol but not in CRISPR-DS. Colored boxes represent 1 h of time.
    Figure Legend Snippet: Comparison of library preparation protocols for standard-DS versus CRISPR-DS. The primary differences between the CRISPR-DS and standard-DS library preparation are the fragmentation methods and the number of hybridization capture steps. Instead of fragmentation by sonication as performed in standard-DS, CRISPR-DS relies on an in vitro excision of target regions by CRISPR/Cas9 followed by size selection for the excised fragments. Although this method requires additional preparation to design locus-specific gRNAs, this is a one-step process that then reduces the protocol by nearly a day. The reduction is achieved by the elimination of the second round of hybridization capture, which is required for sufficient target enrichment in the standard-DS protocol but not in CRISPR-DS. Colored boxes represent 1 h of time.

    Techniques Used: CRISPR, Hybridization, Sonication, In Vitro, Selection

    38) Product Images from "CRISPR–Cas9-targeted fragmentation and selective sequencing enable massively parallel microsatellite analysis"

    Article Title: CRISPR–Cas9-targeted fragmentation and selective sequencing enable massively parallel microsatellite analysis

    Journal: Nature Communications

    doi: 10.1038/ncomms14291

    Overview of STR-Seq. ( a ) Guide RNAs and primer probes were designed to target STRs and proximal SNPs. We target both plus and minus strands with only the plus strand targeting illustrated. In the first step, Cas9 enzyme cleaves upstream of STR. The DNA libraries including the STR and SNP are target sequenced. ( b ) After initial alignment of Read 2 from any given paired-end set, we use the primer probe sequence derived from Read 2 as an index tag to link the Read 1 microsatellite internal motif and flanking sequences. If the primer probe sequence aligns within 2 bp of the expected primer probe start position, the paired Read 1 was assigned to its specific STR index tag. Based on the human genome reference, we identified the flanking genomic sequences that mark the complete STR segment and then determined the composition (that is, mononucleotide, dinucleotide and so on) and overall length of the repeat motif structure. Read 1 sequences that contained both the 5′ and 3′ flanking sequences with the internal microsatellite were used for genotyping. STR genotypes are called from Read 1. SNPs are phased with the STR genotype to generate haplotypes. ( c ) As an example of STR-Seq haplotyping, paired end alignments to the reference genome are shown for a STR target (trf747130) for sample NA12878. After the STR genotyping process, 114 and 133 read pairs were identified to have 11 and 8 repeats of a tetranucleotide motif (ATGA) in their Read 1s, respectively. Within each read pair group, all the base calls at the SNP position were identical, being either C (reference) or G (alternative). The site where CRISPR–Cas9 targets is indicated with red arrow, and the two haplotypes are illustrated on the bottom.
    Figure Legend Snippet: Overview of STR-Seq. ( a ) Guide RNAs and primer probes were designed to target STRs and proximal SNPs. We target both plus and minus strands with only the plus strand targeting illustrated. In the first step, Cas9 enzyme cleaves upstream of STR. The DNA libraries including the STR and SNP are target sequenced. ( b ) After initial alignment of Read 2 from any given paired-end set, we use the primer probe sequence derived from Read 2 as an index tag to link the Read 1 microsatellite internal motif and flanking sequences. If the primer probe sequence aligns within 2 bp of the expected primer probe start position, the paired Read 1 was assigned to its specific STR index tag. Based on the human genome reference, we identified the flanking genomic sequences that mark the complete STR segment and then determined the composition (that is, mononucleotide, dinucleotide and so on) and overall length of the repeat motif structure. Read 1 sequences that contained both the 5′ and 3′ flanking sequences with the internal microsatellite were used for genotyping. STR genotypes are called from Read 1. SNPs are phased with the STR genotype to generate haplotypes. ( c ) As an example of STR-Seq haplotyping, paired end alignments to the reference genome are shown for a STR target (trf747130) for sample NA12878. After the STR genotyping process, 114 and 133 read pairs were identified to have 11 and 8 repeats of a tetranucleotide motif (ATGA) in their Read 1s, respectively. Within each read pair group, all the base calls at the SNP position were identical, being either C (reference) or G (alternative). The site where CRISPR–Cas9 targets is indicated with red arrow, and the two haplotypes are illustrated on the bottom.

    Techniques Used: Sequencing, Derivative Assay, Genomic Sequencing, CRISPR

    Performance of targeted CRISPR–Cas9 fragmentation. ( a ) For the STR target presented here (trf676281; [ATAG] n ), two gRNAs were designed with two pairs of primer probes. Read depth and pile-up of Read 1s are compared between negative control and target-specifically fragmented sample DNAs. In the pile-up plots, Read 1s from plus probes (binding downstream of the STR) align to the reference itself (forward reads; blue) while those from minus probe align to the reverse complementary of reference (reverse reads; green). For the two CRISPR–Cas9 target sites, among all reads having an overlap with each, 92 and 67% shared their alignment start positions, respectively (indicated by red dotted arrows). Read depth for the STR region (shaded) was higher than that of other flanking regions when the targeted fragmentation was used. Pink-coloured blocks in read depth and pile-up plots indicate deletion events. In the reference genome, red, yellow, green and blue bars indicate A, C, G and T bases, respectively. ( b ) The read fraction distribution for 2,625 CRISPR–Cas9 target sites are shown that start or stop within 2 bp of the target cut site. The median values are indicated as white dots inside the black boxes, and the difference was significant ( P
    Figure Legend Snippet: Performance of targeted CRISPR–Cas9 fragmentation. ( a ) For the STR target presented here (trf676281; [ATAG] n ), two gRNAs were designed with two pairs of primer probes. Read depth and pile-up of Read 1s are compared between negative control and target-specifically fragmented sample DNAs. In the pile-up plots, Read 1s from plus probes (binding downstream of the STR) align to the reference itself (forward reads; blue) while those from minus probe align to the reverse complementary of reference (reverse reads; green). For the two CRISPR–Cas9 target sites, among all reads having an overlap with each, 92 and 67% shared their alignment start positions, respectively (indicated by red dotted arrows). Read depth for the STR region (shaded) was higher than that of other flanking regions when the targeted fragmentation was used. Pink-coloured blocks in read depth and pile-up plots indicate deletion events. In the reference genome, red, yellow, green and blue bars indicate A, C, G and T bases, respectively. ( b ) The read fraction distribution for 2,625 CRISPR–Cas9 target sites are shown that start or stop within 2 bp of the target cut site. The median values are indicated as white dots inside the black boxes, and the difference was significant ( P

    Techniques Used: CRISPR, Negative Control, Binding Assay

    39) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    40) Product Images from "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method"

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32329-x

    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).
    Figure Legend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.
    Figure Legend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Related Articles

    Countercurrent Chromatography:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Transfection:

    Article Title: Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation
    Article Snippet: .. These cells were grown on patterned substrates as described above in “Cell culture and microstamping for cell colony control.” Colonies of 10 to 20 cells were transfected using the NFP-E with a solution containing Cas9 nuclease (NEB) and a guide RNA (targeting sequence: GGGCGAGGAGCUGUUCACCG; Synthego) both at 1 × 10−6 M final in DPBS. .. This gRNA has been shown to efficiently knock-out the green fluorescent protein gene.

    In Vitro:

    Article Title: Whole exome sequencing of ENU-induced thrombosis modifier mutations in the mouse
    Article Snippet: .. In vitro digestion of target DNA was carried out by complexes of synthetic sgRNA and S . pyogenes Cas9 Nuclease (New England BioLabs) according to manufacturer's recommendations. .. Agarose gel electrophoresis of the reaction products was used to identify sgRNA molecules that mediated template cleavage by Cas9 protein ( ).

    Article Title: Antibody discovery and engineering by enhanced CRISPR-Cas9 integration of variable gene cassette libraries in mammalian cells
    Article Snippet: .. In order to test if PnP-lin donor plasmids were recognized and successfully linearized by the Cas9 nuclease, an in vitro digestion assay was set up in a total reaction volume of 30 μl as follows: 16 μl of nuclease-free water (Thermo, AM9937) were mixed with 3 μl of NEBuffer 3.1 (NEB, B7203), 6 μl of 300 nM crRNA-J/tracr RNA complex (final concentration of 60 nM) and 2 μl of 1 μM Cas9 nuclease (NEB, M0386; final concentration of 60 nM) and the mixture was incubated for 10 min at 25°C in order to prepare the RNP complex. .. 3 μl of 30 nM plasmid DNA were added (final concentration of 3 nM) and samples were incubated for 60 min at 37°C.

    Polymerase Chain Reaction:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: .. This study developed a new method for detecting target DNA based on Cas9 nuclease, which was named as ctPCR, representing the Cas9-sgRNA-typing PCR. ..

    CTG Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Cell Culture:

    Article Title: Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation
    Article Snippet: .. These cells were grown on patterned substrates as described above in “Cell culture and microstamping for cell colony control.” Colonies of 10 to 20 cells were transfected using the NFP-E with a solution containing Cas9 nuclease (NEB) and a guide RNA (targeting sequence: GGGCGAGGAGCUGUUCACCG; Synthego) both at 1 × 10−6 M final in DPBS. .. This gRNA has been shown to efficiently knock-out the green fluorescent protein gene.

    Purification:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Concentration Assay:

    Article Title: Antibody discovery and engineering by enhanced CRISPR-Cas9 integration of variable gene cassette libraries in mammalian cells
    Article Snippet: .. In order to test if PnP-lin donor plasmids were recognized and successfully linearized by the Cas9 nuclease, an in vitro digestion assay was set up in a total reaction volume of 30 μl as follows: 16 μl of nuclease-free water (Thermo, AM9937) were mixed with 3 μl of NEBuffer 3.1 (NEB, B7203), 6 μl of 300 nM crRNA-J/tracr RNA complex (final concentration of 60 nM) and 2 μl of 1 μM Cas9 nuclease (NEB, M0386; final concentration of 60 nM) and the mixture was incubated for 10 min at 25°C in order to prepare the RNP complex. .. 3 μl of 30 nM plasmid DNA were added (final concentration of 3 nM) and samples were incubated for 60 min at 37°C.

    Incubation:

    Article Title: Antibody discovery and engineering by enhanced CRISPR-Cas9 integration of variable gene cassette libraries in mammalian cells
    Article Snippet: .. In order to test if PnP-lin donor plasmids were recognized and successfully linearized by the Cas9 nuclease, an in vitro digestion assay was set up in a total reaction volume of 30 μl as follows: 16 μl of nuclease-free water (Thermo, AM9937) were mixed with 3 μl of NEBuffer 3.1 (NEB, B7203), 6 μl of 300 nM crRNA-J/tracr RNA complex (final concentration of 60 nM) and 2 μl of 1 μM Cas9 nuclease (NEB, M0386; final concentration of 60 nM) and the mixture was incubated for 10 min at 25°C in order to prepare the RNP complex. .. 3 μl of 30 nM plasmid DNA were added (final concentration of 3 nM) and samples were incubated for 60 min at 37°C.

    other:

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: The results indicated that the HPV16 and HPV18 L1 genes could be specifically targeted by their corresponding sgRNA and cut by the guided Cas9 nuclease (Fig. ).

    Article Title: Chromatin-remodeling factor SMARCD2 regulates transcriptional networks controlling differentiation of neutrophil granulocytes
    Article Snippet: Individual sgRNAs (50–200 ng/µl) mixed with 20 µM Cas9 nuclease (New England BioLabs) at a 1:1 ratio were microinjected (500–1,000 pg) into the cytoplasm of one-cell-stage Tg( mpx : EGFP ) embryos.

    Sequencing:

    Article Title: Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation
    Article Snippet: .. These cells were grown on patterned substrates as described above in “Cell culture and microstamping for cell colony control.” Colonies of 10 to 20 cells were transfected using the NFP-E with a solution containing Cas9 nuclease (NEB) and a guide RNA (targeting sequence: GGGCGAGGAGCUGUUCACCG; Synthego) both at 1 × 10−6 M final in DPBS. .. This gRNA has been shown to efficiently knock-out the green fluorescent protein gene.

    Activated Clotting Time Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Cellular Antioxidant Activity Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs cas9 nuclease
    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of <t>Cas9-cut</t> product (named as general-specific primers, gs-primers).
    Cas9 Nuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 nuclease/product/New England Biolabs
    Average 98 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    cas9 nuclease - by Bioz Stars, 2020-05
    98/100 stars
      Buy from Supplier

    Image Search Results


    Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Journal: Scientific Reports

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    doi: 10.1038/s41598-018-32329-x

    Figure Lengend Snippet: Detection of HPV L1 gene with ctPCR by using different primers. ( A ) A schematic of the experimental procedures for detecting and typing HPV DNA with ctPCR by using different primers. ( B ) Detection of HPV16 L1 gene by ctPCR with different primers. ( C ) Detection of HPV18 L1 gene by ctPCR with different primers. The final PCR products were run with agarose gel. Single primer, a general primer complementary to the constant T adaptor used in ctPCR detection; Sg-primer, a pair of primers complementary to constant T adaptor and 3 nucleotides at the end of Cas9-cut product (named as general-specific primers, gs-primers).

    Article Snippet: The results indicated that the HPV16 and HPV18 L1 genes could be specifically targeted by their corresponding sgRNA and cut by the guided Cas9 nuclease (Fig. ).

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Journal: Scientific Reports

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method

    doi: 10.1038/s41598-018-32329-x

    Figure Lengend Snippet: Cas9-sgRNA cleavage of HPV16 and HPV18 L1 genes. ( A ) HPV L1 plasmids and locations of sgRNA targets and universal PCR primers in the L1 and E6-E7 genes of HPV16 and HPV18. ( B ) Cas9-sgRNA cleavage of HPV16 L1 gene using sgRNA 16–1274 and 16–950. ( C ) Cas9-sgRNA cleavage of HPV18 L1 gene using sgRNA 18–1490 and 18–1274. The Cas9 protein was in complex with the sgRNAs specific to HPV16 or 18 L1 genes and used to cut the linearized HPV16 or HPV18 L1 plasmids ( A ). The DNAs were run with agarose gel.

    Article Snippet: The results indicated that the HPV16 and HPV18 L1 genes could be specifically targeted by their corresponding sgRNA and cut by the guided Cas9 nuclease (Fig. ).

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    An independent CRISPR/Cas9 induced Plcb4 allele validates the rescue phenotype. A) The CRISPR/Cas9-induced Plcb4 ins1 allele (insertion of the nucleotide ‘A’ at amino acid 328) results in a frameshift to the protein coding sequence leading to a premature stop codon. B) Sanger sequencing analysis of gDNA from a wildtype mouse and both gDNA and cDNA from a Plcb4 +/ins1 mouse at the Plcb4 1bp insertion site. C) 169 progeny genotyped from a validation cross of F5 L/L Plcb4 +/ins1 mice with F5 L/+ Tfpi +/- .

    Journal: PLoS Genetics

    Article Title: Whole exome sequencing of ENU-induced thrombosis modifier mutations in the mouse

    doi: 10.1371/journal.pgen.1007658

    Figure Lengend Snippet: An independent CRISPR/Cas9 induced Plcb4 allele validates the rescue phenotype. A) The CRISPR/Cas9-induced Plcb4 ins1 allele (insertion of the nucleotide ‘A’ at amino acid 328) results in a frameshift to the protein coding sequence leading to a premature stop codon. B) Sanger sequencing analysis of gDNA from a wildtype mouse and both gDNA and cDNA from a Plcb4 +/ins1 mouse at the Plcb4 1bp insertion site. C) 169 progeny genotyped from a validation cross of F5 L/L Plcb4 +/ins1 mice with F5 L/+ Tfpi +/- .

    Article Snippet: In vitro digestion of target DNA was carried out by complexes of synthetic sgRNA and S . pyogenes Cas9 Nuclease (New England BioLabs) according to manufacturer's recommendations.

    Techniques: CRISPR, Sequencing, Mouse Assay

    Smarcd2 deficiency in zebrafish. ( a ) Neutrophil numbers in Tg( lyz : dsRed ) nz50 zebrafish at 72 h.p.f. after injection with MOs (control (CRTL) versus translation-start-site blocker (ATG) and splice-site blocker (SB1 and SB2) MOs targeting smarcd2 ). Data represent the numbers of fluorescence-labeled neutrophils per individual fish embryo. Pooled data from two independent MO experiments are shown: CTRL n = 16, ATG n = 16, SB1 n = 16, SB2 n = 16 fish. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t test. Replicates: 2. ( b ) Representative fluorescence images of zebrafish strain Tg( mpx : EGFP ) i114 : smarcd2 wt/wt (wild type) and smarcd2 1/1 (knockout). Reduced numbers of GFP-expressing neutrophils are observed in smarcd2 1/1 mutant fish embryos. Acquired images: smarcd2 wt/wt ( n = 37 images) and smarcd2 1/1 ( n = 10 images). ( c ) Enumeration of neutrophils in smarcd2 wt/wt versus smarcd2 1/1 zebrafish. Numbers of fluorescence-labeled neutrophils were evaluated in caudal hematopoietic tissue for individual fish embryos. n = 38 smarcd2 wt/wt and n = 10 smarcd2 1/1 fish were evaluated in two independent CRISPR/Cas9 experiments. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t .

    Journal: Nature genetics

    Article Title: Chromatin-remodeling factor SMARCD2 regulates transcriptional networks controlling differentiation of neutrophil granulocytes

    doi: 10.1038/ng.3833

    Figure Lengend Snippet: Smarcd2 deficiency in zebrafish. ( a ) Neutrophil numbers in Tg( lyz : dsRed ) nz50 zebrafish at 72 h.p.f. after injection with MOs (control (CRTL) versus translation-start-site blocker (ATG) and splice-site blocker (SB1 and SB2) MOs targeting smarcd2 ). Data represent the numbers of fluorescence-labeled neutrophils per individual fish embryo. Pooled data from two independent MO experiments are shown: CTRL n = 16, ATG n = 16, SB1 n = 16, SB2 n = 16 fish. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t test. Replicates: 2. ( b ) Representative fluorescence images of zebrafish strain Tg( mpx : EGFP ) i114 : smarcd2 wt/wt (wild type) and smarcd2 1/1 (knockout). Reduced numbers of GFP-expressing neutrophils are observed in smarcd2 1/1 mutant fish embryos. Acquired images: smarcd2 wt/wt ( n = 37 images) and smarcd2 1/1 ( n = 10 images). ( c ) Enumeration of neutrophils in smarcd2 wt/wt versus smarcd2 1/1 zebrafish. Numbers of fluorescence-labeled neutrophils were evaluated in caudal hematopoietic tissue for individual fish embryos. n = 38 smarcd2 wt/wt and n = 10 smarcd2 1/1 fish were evaluated in two independent CRISPR/Cas9 experiments. Center values, mean; error bars, s.d. P values were calculated by two-tailed unpaired t .

    Article Snippet: Individual sgRNAs (50–200 ng/µl) mixed with 20 µM Cas9 nuclease (New England BioLabs) at a 1:1 ratio were microinjected (500–1,000 pg) into the cytoplasm of one-cell-stage Tg( mpx : EGFP ) embryos.

    Techniques: Injection, Fluorescence, Labeling, Fluorescence In Situ Hybridization, Two Tailed Test, Knock-Out, Expressing, Mutagenesis, CRISPR

    CRISP/Cas9 gene knockout using single-cell electroporation. a) Patterned EGFP-HEK293 cells colonies transfected using the NFP-E with Cas9 nuclease and a specific guide RNA targeting EGFP. All cells of a colony of 14 cells were transfected on day 1 with Cas9/gRNA. b) On day 3, transfected cells multiplied but only three cells in the colony remained positive for GFP fluorescence signal, consistent with knockout of EGFP. c) A nontransfected control colony exhibiting EGFP signal in all cells.

    Journal: Small (Weinheim an der Bergstrasse, Germany)

    Article Title: Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation

    doi: 10.1002/smll.201702495

    Figure Lengend Snippet: CRISP/Cas9 gene knockout using single-cell electroporation. a) Patterned EGFP-HEK293 cells colonies transfected using the NFP-E with Cas9 nuclease and a specific guide RNA targeting EGFP. All cells of a colony of 14 cells were transfected on day 1 with Cas9/gRNA. b) On day 3, transfected cells multiplied but only three cells in the colony remained positive for GFP fluorescence signal, consistent with knockout of EGFP. c) A nontransfected control colony exhibiting EGFP signal in all cells.

    Article Snippet: These cells were grown on patterned substrates as described above in “Cell culture and microstamping for cell colony control.” Colonies of 10 to 20 cells were transfected using the NFP-E with a solution containing Cas9 nuclease (NEB) and a guide RNA (targeting sequence: GGGCGAGGAGCUGUUCACCG; Synthego) both at 1 × 10−6 M final in DPBS.

    Techniques: Gene Knockout, Electroporation, Transfection, Fluorescence, Knock-Out