t4 rna ligase 2 truncated kq  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    T4 RNA Ligase 2 truncated KQ
    Description:
    T4 RNA Ligase 2 truncated KQ 10 000 units
    Catalog Number:
    m0373l
    Price:
    278
    Size:
    10 000 units
    Category:
    RNA Ligases
    Buy from Supplier


    Structured Review

    New England Biolabs t4 rna ligase 2 truncated kq
    T4 RNA Ligase 2 truncated KQ
    T4 RNA Ligase 2 truncated KQ 10 000 units
    https://www.bioz.com/result/t4 rna ligase 2 truncated kq/product/New England Biolabs
    Average 95 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated kq - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation"

    Article Title: Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0167009

    Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using T4 RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.
    Figure Legend Snippet: Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using T4 RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.

    Techniques Used: Ligation, Modification

    Related Articles

    Clone Assay:

    Article Title: Defining nonsense-mediated mRNA decay intermediates in human cells
    Article Snippet: .. Baker, Catalog # JT9182–01) Ethanol (100% and 75%) (Koptec, Catalog # QDEV1001TP) 2-Propanol (Fisher Scientific, Catalog # A4514) Glycogen Solution (20 mg/ml) (Thermo Fisher Scienctific, Catalog # R0561) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Catalog # S11494) Phenol: Chloroform: Isoamyl Alcohol 25:24:1 Saturated with 10 mM Tris (pH 8.0), 1 mM EDTA (Sigma-Aldrich, Catalog # P2069) Halt Protease and Phosphatase Inhibitor Cocktail, EDTA-free (100×) (Thermo Fisher Scientific, Catalog # 78443) IgG from rabbit serum (Sigma-Aldrich, Catalog # I5006) DNase I (RQ1 RNase-Free DNase) (Promega, Catalog # M6101) RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific Invitrogen, Catalog # 10777019) Shrimp alkaline phosphatase (rSAP) (New England Biolabs, Catalog # M0371L) T4 RNA Ligase 2, truncated KQ (New England Biolabs, Catalog # M0373L) T4 polynucleotide kinase (T4 PNK) (New England Biolabs, Catalog # M0201L) T4 RNA Ligase, cloned, 5 U/μl (Thermo Fisher Scientific, Ambion, Catalog # AM2141) SuperScript III Reverse Transcriptase (Thermo Fisher Scientific, Invitrogen, Catalog # 18080085) Q5 High-Fidelity DNA Polymerase (New England Biolabs, Catalog # M0491S) Urea (EMD Millipore, Catalog # 9510) Acrylamide/bis-acrylamide 19:1 (40%) (Fisher scientific, Catalog # BP1406–1) Acrylamide/bis-acrylamide 29:1 (40%) (Fisher scientific, Catalog # BP1408–1) Ammonium persulfate, crystal (Mallinckrodt chemicals, Catalog # 3460–04) UltraPure TEMED (Thermo Fisher Scientific, Invitrogen, Catalog # 15524010) Sodium dodecyl sulfate (Sigma-Aldrich, Catalog # 75746) TWEEN 20 (Sigma-Aldrich, Catalog # P7949) TRITON X-100 (Sigma-Aldrich, Catalog # T9284) Nonidet P-40 (NP-40) (Sigma-Aldrich, Catalog # I3021) 2-Mercaptoethanol (Sigma-Aldrich, Catalog # M3148) RNase T1 (5 U/μl) (Thermo Fisher Scientific Ambion, AM2283) Halt Protease and Phosphatase Inhibitor Cocktail (100×) (Thermo Fisher Scientific, Catalog # PI78443) Bromophenol blue (Fisher Scientific, Catalog # B-392) 1 Kb Plus DNA Ladder (Thermo Fisher Scientific Invitrogen, Catalog # 10787018) Dynabeads Protein A (Thermo Fisher Scientific, Catalog # 10002D) Anti-phospho-UPF1 Ser1116 antibody (anti-phospho-UPF1 (Ser1127), EMD Millipore, Catalog # 07–1016) 3 M Sodium Acetate (pH 5.5) (Thermo Fisher Scientific Ambion, Catalog # AM9740) Trizma base (Sigma-Aldrich, Catalog # T6066) Boric acid (Millipore Sigma, Catalog # 2720–5KG) Ethylenediaminetetraacetic acid (EDTA), disodium salt (J.T. .. Baker, Catalog # 8993–01) Acrylamide:Bis-Acrylamide (19:1) 40% solution (Fisher Scientific, Catalog # BP1406–1) Ammonium persulfate (APS) (Acros Organics, Catalog # 401165000)

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: .. After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. Ligated RNAs were purified using RNA Clean & Concentrator-25 columns (Zymo Research) and reverse transcribed by SuperScript III (see RNA extraction and qRT-PCR section) and universal RT+linker primer ( ). cDNAs were diluted and 100 ng cDNA was used for PCR reaction using U1 and U2 gene-specific forward primers ( ) and universal RT+linker reverse primer.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: .. Total cellular RNA was isolated from a Δ rnr Δ rimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The reaction products were annealed with primer CJ1341 (5′ CCGTGATTGATGGTGCCTACAG 3′), which is complementary to the cloning linker, and reverse-transcribed.

    Amplification:

    Article Title: Bias-minimized quantification of microRNA reveals widespread alternative processing and 3′ end modification
    Article Snippet: Small RNA libraries were constructed using either the TruSeq small RNA library preparation kit (Illumina) according to manufacturer's instructions or AQ-seq as follows: miRNA-enriched RNA was ligated to 0.25 μM 3′ randomized adapter using 20 units/μl of T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG 8000 (NEB) at 25°C for at least 3 h. The ligated RNA was gel-purified on a 15% urea–polyacrylamide gel using two markers (40 nt and 55 nt) to remove the free 3′ adapter and eluted in 0.3 M NaCl. .. The purified RNA was ligated to 0.18 μM 5′ randomized adapter using 1 unit/μl of T4 RNA ligase 1 (NEB) in 1X T4 RNA ligase reaction buffer supplemented with 1 mM ATP and 20% PEG 8000 (NEB) at 37°C for 1 h. The products were reverse-transcribed using 10 units/μl of SuperScript III reverse transcriptase (Invitrogen) in 1X first-strand buffer (Invitrogen) with 0.2 μM RT primer (RTP, TruSeq kit; Illumina), 0.5 mM dNTP (TruSeq kit; Illumina), and 5 mM DTT (Invitrogen) at 50°C for 1 h. The cDNA was amplified using 0.02 unit/μl of Phusion High-Fidelity DNA Polymerase (Thermo Scientific) in 1X Phusion HF buffer (Thermo Scientific) with 0.5 μM primers (RP1 forward primer and RPIX reverse primer, TruSeq kit; Illumina) and 0.2 mM dNTP (TAKARA).

    Article Title: AID–RNA polymerase II transcription-dependent deamination of IgV DNA
    Article Snippet: RNA transcripts were ligated to a 5′-adenylated, 3′-blocked ssDNA adaptor (5′-rAppGAT CGG AAG AGC ACA CGT CTG AAC TCC AG-NH2 -3′), using T4 RNA Ligase 2-truncated KQ (New England Biolabs) at 16°C for 16 h. Ligated RNA transcripts were annealed to a NG-8 primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT TCA AGT GTG ACT GGA GTT CAG ACG T-3′) and reverse transcribed using NEBNext First Strand Synthesis Enzyme mix (New England Biolabs) in a thermocycler (25°C 10 min, 42°C 15 min, 70°C 15 min). .. The product cDNAs were amplified 30 cycles (94°C 30 s, 45°C 15 s, 72°C 30 s) by Taq DNA polymerase (Promega) using NG-8 and NG-RNA-F (5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T TAT ATG CAT AAA GAC CAG-3′) as PCR primers.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: Total cellular RNA was isolated from a Δ rnr Δ rimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The cDNA products were amplified with CJ1341 and a DNA primer that corresponds to the 16S rRNA nts 537–558 (5′ GGAGGGTGCAAGCGTTAATCGG 3′).

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: 3′ RACE Total cellular RNA was isolated from a Δrnr ΔrimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The cDNA products were amplified with CJ1341 and a DNA primer that corresponds to the 16S rRNA nts 537–558 (5′ GGAGGGTGCAAGCGTTAATCGG 3′).

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013). .. First, 5 µl of RT reaction mix was added (10 pmol RT primer) and the reaction was incubated at 65 °C for 5 min. Second, the mix of 2.1 µl 5× First-Strand buffer (Invitrogen, #28025013), 0.3 µl H2 O and 0.8 µl of 0.1 M DTT (Invitrogen #28025013) was added and incubated at 42 °C for 30 min. Third, 3.3 µl of RT reaction was added (0.6ul M-MLV reverse transcriptase, 1 µl 5× First-Strand buffer, Invitrogen #28025013, 0.3 µl H2 O, 0.8 µl of 0.1 M DTT, Invitrogen #28025013 and 0.6 µl 10 mM dNTP mix, Invitrogen #18427088) and the reaction was incubated at 42 °C for 2 h. The first PCR amplification was carried out by adding 35 µl of the reagents (3.5 µl 10×ThermoPol Reaction Buffer, NEB #M0267S, 0.7 µl 10 mM dNTP mix Invitrogen #18427088, 35 pmol RT primer oligo, 35 pmol PCR primer oligo, 0.5 µl Taq DNA Polymerase NEB #M0267S, 23.3 µl H2 O) and incubating at 98 °C for 30 s followed by 13 cycles of 98 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s and a final incubation at 72 °C for 5 min. Next, 1 µl of the amplified product was transferred to a fresh tube and to 25 µl of second PCR reaction (consisting of 10 µM indexed primer, 10 µM 5′ Illumina PCR primer, 2.5 µl 10× ThermoPol Reaction buffer, 0.5 µl Taq DNA Polymerase NEB #M0267S, 0.5 µl 10 mM dNTP mix, Invitrogen #18427088), followed by a 30 s incubation at 98 °C, 13 cycles of 98 °C for 10 s, 67 °C for 30 s, and 72 °C for 30 s and a final incubation at 72 °C for 5 min. PCR products of ~140 bp were gel-purified after the second PCR on an 8% non-denaturing acrylamide gel.

    High Throughput Screening Assay:

    Article Title: RNA-dependent chromatin association of transcription elongation factors and Pol II CTD kinases
    Article Snippet: .. PAR-CLIP library preparation and high-throughput sequencing For 3′ adaptor ligation, beads were resuspended in 1 × T4 RNA ligase buffer (NEB) containing 10 U/µL T4 RNA ligase 2 (KQ) (NEB, M0373), 10 μM 3′ adaptor (5′ 5rApp-TGGAATTCTCGGGTGCCAAGG-3ddC 3′ (IDT, Inc., Coralville, IA )) , 1 U/µL RNase OUT, and 15% (w/v) PEG 8000. ..

    Synthesized:

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: The concentration of the pre-adenylated adaptor was estimated by analysis on an 15% denaturing polyacrylamide gel (made with American Bioanalytical Sequel NE, #AB13021, AB13022) and comparison of band intensity to known quantities of synthesized oligonucletides. .. Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013).

    Construct:

    Article Title: Bias-minimized quantification of microRNA reveals widespread alternative processing and 3′ end modification
    Article Snippet: .. Small RNA libraries were constructed using either the TruSeq small RNA library preparation kit (Illumina) according to manufacturer's instructions or AQ-seq as follows: miRNA-enriched RNA was ligated to 0.25 μM 3′ randomized adapter using 20 units/μl of T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG 8000 (NEB) at 25°C for at least 3 h. The ligated RNA was gel-purified on a 15% urea–polyacrylamide gel using two markers (40 nt and 55 nt) to remove the free 3′ adapter and eluted in 0.3 M NaCl. .. The purified RNA was ligated to 0.18 μM 5′ randomized adapter using 1 unit/μl of T4 RNA ligase 1 (NEB) in 1X T4 RNA ligase reaction buffer supplemented with 1 mM ATP and 20% PEG 8000 (NEB) at 37°C for 1 h. The products were reverse-transcribed using 10 units/μl of SuperScript III reverse transcriptase (Invitrogen) in 1X first-strand buffer (Invitrogen) with 0.2 μM RT primer (RTP, TruSeq kit; Illumina), 0.5 mM dNTP (TruSeq kit; Illumina), and 5 mM DTT (Invitrogen) at 50°C for 1 h. The cDNA was amplified using 0.02 unit/μl of Phusion High-Fidelity DNA Polymerase (Thermo Scientific) in 1X Phusion HF buffer (Thermo Scientific) with 0.5 μM primers (RP1 forward primer and RPIX reverse primer, TruSeq kit; Illumina) and 0.2 mM dNTP (TAKARA).

    Electrophoresis:

    Article Title: Distributed biotin–streptavidin transcription roadblocks for mapping cotranscriptional RNA folding
    Article Snippet: Extracted RNAs were ligated to an RNA linker using T4 RNA Ligase 2 truncated KQ (New England Biolabs) by incubation at room temperature as described previously ( ). .. The resulting dsDNA libraries were analyzed by capillary electrophoresis using an ABI 3730xl and the resulting traces were used to evaluate library length distribution and the presence of adapter dimer prior to sequencing.

    Modification:

    Article Title: Defining nonsense-mediated mRNA decay intermediates in human cells
    Article Snippet: Dulbecco’s Modified Eagle’s Medium (DMEM) (Thermo Fisher Scientific Gibco, Catalog # 11995) Fetal bovine serum (FBS) (VWR, Catalog # 97068–085) Okadaic acid, free acid > 98% (LC Laboratories, Catalog # O-2220) TRIzol Reagent (Thermo Fisher Scientific, Catalog # 15596018) Chloroform (J.T. .. Baker, Catalog # JT9182–01) Ethanol (100% and 75%) (Koptec, Catalog # QDEV1001TP) 2-Propanol (Fisher Scientific, Catalog # A4514) Glycogen Solution (20 mg/ml) (Thermo Fisher Scienctific, Catalog # R0561) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Catalog # S11494) Phenol: Chloroform: Isoamyl Alcohol 25:24:1 Saturated with 10 mM Tris (pH 8.0), 1 mM EDTA (Sigma-Aldrich, Catalog # P2069) Halt Protease and Phosphatase Inhibitor Cocktail, EDTA-free (100×) (Thermo Fisher Scientific, Catalog # 78443) IgG from rabbit serum (Sigma-Aldrich, Catalog # I5006) DNase I (RQ1 RNase-Free DNase) (Promega, Catalog # M6101) RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific Invitrogen, Catalog # 10777019) Shrimp alkaline phosphatase (rSAP) (New England Biolabs, Catalog # M0371L) T4 RNA Ligase 2, truncated KQ (New England Biolabs, Catalog # M0373L) T4 polynucleotide kinase (T4 PNK) (New England Biolabs, Catalog # M0201L) T4 RNA Ligase, cloned, 5 U/μl (Thermo Fisher Scientific, Ambion, Catalog # AM2141) SuperScript III Reverse Transcriptase (Thermo Fisher Scientific, Invitrogen, Catalog # 18080085) Q5 High-Fidelity DNA Polymerase (New England Biolabs, Catalog # M0491S) Urea (EMD Millipore, Catalog # 9510) Acrylamide/bis-acrylamide 19:1 (40%) (Fisher scientific, Catalog # BP1406–1) Acrylamide/bis-acrylamide 29:1 (40%) (Fisher scientific, Catalog # BP1408–1) Ammonium persulfate, crystal (Mallinckrodt chemicals, Catalog # 3460–04) UltraPure TEMED (Thermo Fisher Scientific, Invitrogen, Catalog # 15524010) Sodium dodecyl sulfate (Sigma-Aldrich, Catalog # 75746) TWEEN 20 (Sigma-Aldrich, Catalog # P7949) TRITON X-100 (Sigma-Aldrich, Catalog # T9284) Nonidet P-40 (NP-40) (Sigma-Aldrich, Catalog # I3021) 2-Mercaptoethanol (Sigma-Aldrich, Catalog # M3148) RNase T1 (5 U/μl) (Thermo Fisher Scientific Ambion, AM2283) Halt Protease and Phosphatase Inhibitor Cocktail (100×) (Thermo Fisher Scientific, Catalog # PI78443) Bromophenol blue (Fisher Scientific, Catalog # B-392) 1 Kb Plus DNA Ladder (Thermo Fisher Scientific Invitrogen, Catalog # 10787018) Dynabeads Protein A (Thermo Fisher Scientific, Catalog # 10002D) Anti-phospho-UPF1 Ser1116 antibody (anti-phospho-UPF1 (Ser1127), EMD Millipore, Catalog # 07–1016) 3 M Sodium Acetate (pH 5.5) (Thermo Fisher Scientific Ambion, Catalog # AM9740) Trizma base (Sigma-Aldrich, Catalog # T6066) Boric acid (Millipore Sigma, Catalog # 2720–5KG) Ethylenediaminetetraacetic acid (EDTA), disodium salt (J.T.

    Incubation:

    Article Title: AID–RNA polymerase II transcription-dependent deamination of IgV DNA
    Article Snippet: RNA-seq Illumina library preparation The Pol II transcription reaction mix including AID (see above) was extracted twice with phenol:chloroform:isoamyl alcohol (25:24:1) to remove Pol II and AID followed by incubation with 2 units of DNAse I (New England Biolabs) for 15 min at 37°C. .. RNA transcripts were ligated to a 5′-adenylated, 3′-blocked ssDNA adaptor (5′-rAppGAT CGG AAG AGC ACA CGT CTG AAC TCC AG-NH2 -3′), using T4 RNA Ligase 2-truncated KQ (New England Biolabs) at 16°C for 16 h. Ligated RNA transcripts were annealed to a NG-8 primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT TCA AGT GTG ACT GGA GTT CAG ACG T-3′) and reverse transcribed using NEBNext First Strand Synthesis Enzyme mix (New England Biolabs) in a thermocycler (25°C 10 min, 42°C 15 min, 70°C 15 min).

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: .. Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013). .. First, 5 µl of RT reaction mix was added (10 pmol RT primer) and the reaction was incubated at 65 °C for 5 min. Second, the mix of 2.1 µl 5× First-Strand buffer (Invitrogen, #28025013), 0.3 µl H2 O and 0.8 µl of 0.1 M DTT (Invitrogen #28025013) was added and incubated at 42 °C for 30 min. Third, 3.3 µl of RT reaction was added (0.6ul M-MLV reverse transcriptase, 1 µl 5× First-Strand buffer, Invitrogen #28025013, 0.3 µl H2 O, 0.8 µl of 0.1 M DTT, Invitrogen #28025013 and 0.6 µl 10 mM dNTP mix, Invitrogen #18427088) and the reaction was incubated at 42 °C for 2 h. The first PCR amplification was carried out by adding 35 µl of the reagents (3.5 µl 10×ThermoPol Reaction Buffer, NEB #M0267S, 0.7 µl 10 mM dNTP mix Invitrogen #18427088, 35 pmol RT primer oligo, 35 pmol PCR primer oligo, 0.5 µl Taq DNA Polymerase NEB #M0267S, 23.3 µl H2 O) and incubating at 98 °C for 30 s followed by 13 cycles of 98 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s and a final incubation at 72 °C for 5 min. Next, 1 µl of the amplified product was transferred to a fresh tube and to 25 µl of second PCR reaction (consisting of 10 µM indexed primer, 10 µM 5′ Illumina PCR primer, 2.5 µl 10× ThermoPol Reaction buffer, 0.5 µl Taq DNA Polymerase NEB #M0267S, 0.5 µl 10 mM dNTP mix, Invitrogen #18427088), followed by a 30 s incubation at 98 °C, 13 cycles of 98 °C for 10 s, 67 °C for 30 s, and 72 °C for 30 s and a final incubation at 72 °C for 5 min. PCR products of ~140 bp were gel-purified after the second PCR on an 8% non-denaturing acrylamide gel.

    Article Title: Distributed biotin–streptavidin transcription roadblocks for mapping cotranscriptional RNA folding
    Article Snippet: .. Extracted RNAs were ligated to an RNA linker using T4 RNA Ligase 2 truncated KQ (New England Biolabs) by incubation at room temperature as described previously ( ). .. Reverse transcription of the linker ligation products was performed using Superscript III Reverse Transcriptase (Life Technologies) as described previously ( ).

    Quantitative RT-PCR:

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. Ligated RNAs were purified using RNA Clean & Concentrator-25 columns (Zymo Research) and reverse transcribed by SuperScript III (see RNA extraction and qRT-PCR section) and universal RT+linker primer ( ). cDNAs were diluted and 100 ng cDNA was used for PCR reaction using U1 and U2 gene-specific forward primers ( ) and universal RT+linker reverse primer.

    Acrylamide Gel Assay:

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013). .. First, 5 µl of RT reaction mix was added (10 pmol RT primer) and the reaction was incubated at 65 °C for 5 min. Second, the mix of 2.1 µl 5× First-Strand buffer (Invitrogen, #28025013), 0.3 µl H2 O and 0.8 µl of 0.1 M DTT (Invitrogen #28025013) was added and incubated at 42 °C for 30 min. Third, 3.3 µl of RT reaction was added (0.6ul M-MLV reverse transcriptase, 1 µl 5× First-Strand buffer, Invitrogen #28025013, 0.3 µl H2 O, 0.8 µl of 0.1 M DTT, Invitrogen #28025013 and 0.6 µl 10 mM dNTP mix, Invitrogen #18427088) and the reaction was incubated at 42 °C for 2 h. The first PCR amplification was carried out by adding 35 µl of the reagents (3.5 µl 10×ThermoPol Reaction Buffer, NEB #M0267S, 0.7 µl 10 mM dNTP mix Invitrogen #18427088, 35 pmol RT primer oligo, 35 pmol PCR primer oligo, 0.5 µl Taq DNA Polymerase NEB #M0267S, 23.3 µl H2 O) and incubating at 98 °C for 30 s followed by 13 cycles of 98 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s and a final incubation at 72 °C for 5 min. Next, 1 µl of the amplified product was transferred to a fresh tube and to 25 µl of second PCR reaction (consisting of 10 µM indexed primer, 10 µM 5′ Illumina PCR primer, 2.5 µl 10× ThermoPol Reaction buffer, 0.5 µl Taq DNA Polymerase NEB #M0267S, 0.5 µl 10 mM dNTP mix, Invitrogen #18427088), followed by a 30 s incubation at 98 °C, 13 cycles of 98 °C for 10 s, 67 °C for 30 s, and 72 °C for 30 s and a final incubation at 72 °C for 5 min. PCR products of ~140 bp were gel-purified after the second PCR on an 8% non-denaturing acrylamide gel.

    Activated Clotting Time Assay:

    Article Title: AID–RNA polymerase II transcription-dependent deamination of IgV DNA
    Article Snippet: .. RNA transcripts were ligated to a 5′-adenylated, 3′-blocked ssDNA adaptor (5′-rAppGAT CGG AAG AGC ACA CGT CTG AAC TCC AG-NH2 -3′), using T4 RNA Ligase 2-truncated KQ (New England Biolabs) at 16°C for 16 h. Ligated RNA transcripts were annealed to a NG-8 primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT TCA AGT GTG ACT GGA GTT CAG ACG T-3′) and reverse transcribed using NEBNext First Strand Synthesis Enzyme mix (New England Biolabs) in a thermocycler (25°C 10 min, 42°C 15 min, 70°C 15 min). .. The product cDNAs were amplified 30 cycles (94°C 30 s, 45°C 15 s, 72°C 30 s) by Taq DNA polymerase (Promega) using NG-8 and NG-RNA-F (5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T TAT ATG CAT AAA GAC CAG-3′) as PCR primers.

    Ligation:

    Article Title: Systematic evaluation and optimization of the experimental steps in RNA G-quadruplex structure sequencing
    Article Snippet: .. 3′-adapter ligation reaction The reaction mixture consisted of 1 μl of 1 μM N40 -3′OH RNA (0.1 μM final), 1 μl of 1, 2.5, 5 or 10 μM of 3′-adapter (0.1, 0.25, 0.5 or 1 μM final), 0 or 3.5 μl of 50% polyethylene glycol (PEG) 8000 (0% or 17.5% final), 1 μl of 10X reaction buffer that gave final working concentration of 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2 , 1 mM dithiothreitol (DTT), and 200 U T4 RNA ligase 2, truncated KQ ligase (NEB, M0373S). .. To investigate the effect of PEG concentration on the ligation efficiency, 1 μl of 1 μM N40 -3′OH RNA (0.1 μM final) was reacted with 1 μl of 10 μM of 3′-adapter (1 μM final), under different percentage of PEG 8000.

    Article Title: ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline
    Article Snippet: Purified small RNAs were treated with RNA polyphosphatase (Illumina, RP8092H) or Tobacco Alkaline Phosphatase (Epicentre Biotechnologies, T81050) to reduce di and triphosphates to monophosphates to facilitate capture of 22G-RNAs by 5′ adapter ligation. .. Preadenylated 3′ adapter was ligated to small RNAs using T4 RNA Ligase 2 Truncated KQ (NEB, M0373S).

    Article Title: RNA-dependent chromatin association of transcription elongation factors and Pol II CTD kinases
    Article Snippet: .. PAR-CLIP library preparation and high-throughput sequencing For 3′ adaptor ligation, beads were resuspended in 1 × T4 RNA ligase buffer (NEB) containing 10 U/µL T4 RNA ligase 2 (KQ) (NEB, M0373), 10 μM 3′ adaptor (5′ 5rApp-TGGAATTCTCGGGTGCCAAGG-3ddC 3′ (IDT, Inc., Coralville, IA )) , 1 U/µL RNase OUT, and 15% (w/v) PEG 8000. ..

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: Paragraph title: 3′ end ligation RACE ... After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT.

    Article Title: Capture, Amplification, and Global Profiling of microRNAs from Low Quantities of Whole Cell Lysate
    Article Snippet: Herein, 500 ng of RNA or lysate from 100,000 cells was ligated to the prepared 3′ adaptor (pre-adenylated and dephosphorylated) using T4 RNA Ligase 2 Truncated KQ (NEB M0373S) at room temperature for 6 hours. .. Alternatively, a size purification step was performed to purify the ligation products using 10% denaturing polyacrylamide gel.

    Article Title: A majority of m6A residues are in the last exons, allowing the potential for 3′ UTR regulation
    Article Snippet: The eluted RNA from the m6 A-IP step and the input RNA fragments were first treated with T4 PNK to remove its 3′ phospho group and then ligated to 68 pmol preadenylated DNA linker (L32N from IDT) with T4 RNA ligase 2 and truncated KQ (New England Biolabs, catalog no. M0373L) overnight at 16°C. .. This ligation mixture was subject to 8% PAGE purification to harvest the ligated product.

    Article Title: Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation
    Article Snippet: .. Ligation Step 1: 1X Buffer 1 (50 mM Tris(hydroxymethyl)aminomethane HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreital, ~20% polyethylene glycol (PEG) 8000) (TriLink Biotechnologies), 0.5 μM CleanTag 3΄ Adapter (TriLink Biotechnologies, LLC.), 40 Units murine RNase Inhibitor (New England Biolabs), 200 Units of T4 RNA Ligase 2 truncated KQ (New England Biolabs), RNA input (1 μg), 10 μL total volume. ..

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: .. Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013). .. First, 5 µl of RT reaction mix was added (10 pmol RT primer) and the reaction was incubated at 65 °C for 5 min. Second, the mix of 2.1 µl 5× First-Strand buffer (Invitrogen, #28025013), 0.3 µl H2 O and 0.8 µl of 0.1 M DTT (Invitrogen #28025013) was added and incubated at 42 °C for 30 min. Third, 3.3 µl of RT reaction was added (0.6ul M-MLV reverse transcriptase, 1 µl 5× First-Strand buffer, Invitrogen #28025013, 0.3 µl H2 O, 0.8 µl of 0.1 M DTT, Invitrogen #28025013 and 0.6 µl 10 mM dNTP mix, Invitrogen #18427088) and the reaction was incubated at 42 °C for 2 h. The first PCR amplification was carried out by adding 35 µl of the reagents (3.5 µl 10×ThermoPol Reaction Buffer, NEB #M0267S, 0.7 µl 10 mM dNTP mix Invitrogen #18427088, 35 pmol RT primer oligo, 35 pmol PCR primer oligo, 0.5 µl Taq DNA Polymerase NEB #M0267S, 23.3 µl H2 O) and incubating at 98 °C for 30 s followed by 13 cycles of 98 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s and a final incubation at 72 °C for 5 min. Next, 1 µl of the amplified product was transferred to a fresh tube and to 25 µl of second PCR reaction (consisting of 10 µM indexed primer, 10 µM 5′ Illumina PCR primer, 2.5 µl 10× ThermoPol Reaction buffer, 0.5 µl Taq DNA Polymerase NEB #M0267S, 0.5 µl 10 mM dNTP mix, Invitrogen #18427088), followed by a 30 s incubation at 98 °C, 13 cycles of 98 °C for 10 s, 67 °C for 30 s, and 72 °C for 30 s and a final incubation at 72 °C for 5 min. PCR products of ~140 bp were gel-purified after the second PCR on an 8% non-denaturing acrylamide gel.

    Article Title: Distributed biotin–streptavidin transcription roadblocks for mapping cotranscriptional RNA folding
    Article Snippet: Extracted RNAs were ligated to an RNA linker using T4 RNA Ligase 2 truncated KQ (New England Biolabs) by incubation at room temperature as described previously ( ). .. Reverse transcription of the linker ligation products was performed using Superscript III Reverse Transcriptase (Life Technologies) as described previously ( ).

    Protease Inhibitor:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: Vented T175 tissue culture flasks (Sarstedt, cat. no. 83.3912.002) 100 mm tissue culture dishes (Sarstedt, cat. no. 83.3902) Trypan Blue Solution, 0.4% (ThermoFisher Scientific, cat. no. 15250–061) Conical 15 ml polypropylene centrifuge tubes (Sarstedt, cat. no. 62.554.002) Nuclease-free 1.7 ml microcentrifuge tubes (GeneMates, cat. no. C-3262–1) MicroAmp Reaction Tube with Cap, 0.2 mL, autoclaved (ThermoFisher Scientific, cat. no. N8010612) Phosphate-buffered saline (PBS, ThermoFisher Scientific, cat. no. 10010–0023) TRIzol reagent (Life Technologies, cat. no. 15596–026) Chloroform (Sigma-Aldrich, cat. no. C2432) Isopropanol (Sigma-Aldrich, cat. no. I9516) UltraPure 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol (ThermoFisher Scientific, cat. no. 15593–031) GlycoBlue Coprecipitant (15mg/ml, Ambion, cat. no. AM9516) DEPC-treated ultrapure water (K.D Medical, cat. no. RGF-3050) RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS, pH 7.4, Boston BioProducts, cat. no. BP-115) IP buffer (50 mM HEPES pH 7.5, 200 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 10% glycerol, 0.1% NP-40) prepared in DEPC-water Complete EDTA-free mini protease inhibitor cocktail tablets (Roche, cat. no. 04 693 159 001). .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence.

    Sequencing:

    Article Title: RNA-dependent chromatin association of transcription elongation factors and Pol II CTD kinases
    Article Snippet: .. PAR-CLIP library preparation and high-throughput sequencing For 3′ adaptor ligation, beads were resuspended in 1 × T4 RNA ligase buffer (NEB) containing 10 U/µL T4 RNA ligase 2 (KQ) (NEB, M0373), 10 μM 3′ adaptor (5′ 5rApp-TGGAATTCTCGGGTGCCAAGG-3ddC 3′ (IDT, Inc., Coralville, IA )) , 1 U/µL RNase OUT, and 15% (w/v) PEG 8000. ..

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. PCR products were gel-extracted and cloned into pGEM-T easy vectors (Promega) and sequenced by Sanger sequencing.

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: Paragraph title: Small RNA library preparation and sequencing ... Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013).

    Article Title: Distributed biotin–streptavidin transcription roadblocks for mapping cotranscriptional RNA folding
    Article Snippet: Paragraph title: Sequencing library processing ... Extracted RNAs were ligated to an RNA linker using T4 RNA Ligase 2 truncated KQ (New England Biolabs) by incubation at room temperature as described previously ( ).

    Affinity Purification:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: A custom polyclonal anti-ORF57 antibody prepared by rabbit immunization with KLH-linked synthetic peptide corresponding to aa 119–132 of ORF57 protein and followed by on-column affinity purification ( ; ) is used for this protocol, together with rabbit IgG isotype (ThermoFisher Scientific, cat. no. 02–6102) used in parallel as an antibody negative control. .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence.

    Recombinant:

    Article Title: Defining nonsense-mediated mRNA decay intermediates in human cells
    Article Snippet: .. Baker, Catalog # JT9182–01) Ethanol (100% and 75%) (Koptec, Catalog # QDEV1001TP) 2-Propanol (Fisher Scientific, Catalog # A4514) Glycogen Solution (20 mg/ml) (Thermo Fisher Scienctific, Catalog # R0561) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Catalog # S11494) Phenol: Chloroform: Isoamyl Alcohol 25:24:1 Saturated with 10 mM Tris (pH 8.0), 1 mM EDTA (Sigma-Aldrich, Catalog # P2069) Halt Protease and Phosphatase Inhibitor Cocktail, EDTA-free (100×) (Thermo Fisher Scientific, Catalog # 78443) IgG from rabbit serum (Sigma-Aldrich, Catalog # I5006) DNase I (RQ1 RNase-Free DNase) (Promega, Catalog # M6101) RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific Invitrogen, Catalog # 10777019) Shrimp alkaline phosphatase (rSAP) (New England Biolabs, Catalog # M0371L) T4 RNA Ligase 2, truncated KQ (New England Biolabs, Catalog # M0373L) T4 polynucleotide kinase (T4 PNK) (New England Biolabs, Catalog # M0201L) T4 RNA Ligase, cloned, 5 U/μl (Thermo Fisher Scientific, Ambion, Catalog # AM2141) SuperScript III Reverse Transcriptase (Thermo Fisher Scientific, Invitrogen, Catalog # 18080085) Q5 High-Fidelity DNA Polymerase (New England Biolabs, Catalog # M0491S) Urea (EMD Millipore, Catalog # 9510) Acrylamide/bis-acrylamide 19:1 (40%) (Fisher scientific, Catalog # BP1406–1) Acrylamide/bis-acrylamide 29:1 (40%) (Fisher scientific, Catalog # BP1408–1) Ammonium persulfate, crystal (Mallinckrodt chemicals, Catalog # 3460–04) UltraPure TEMED (Thermo Fisher Scientific, Invitrogen, Catalog # 15524010) Sodium dodecyl sulfate (Sigma-Aldrich, Catalog # 75746) TWEEN 20 (Sigma-Aldrich, Catalog # P7949) TRITON X-100 (Sigma-Aldrich, Catalog # T9284) Nonidet P-40 (NP-40) (Sigma-Aldrich, Catalog # I3021) 2-Mercaptoethanol (Sigma-Aldrich, Catalog # M3148) RNase T1 (5 U/μl) (Thermo Fisher Scientific Ambion, AM2283) Halt Protease and Phosphatase Inhibitor Cocktail (100×) (Thermo Fisher Scientific, Catalog # PI78443) Bromophenol blue (Fisher Scientific, Catalog # B-392) 1 Kb Plus DNA Ladder (Thermo Fisher Scientific Invitrogen, Catalog # 10787018) Dynabeads Protein A (Thermo Fisher Scientific, Catalog # 10002D) Anti-phospho-UPF1 Ser1116 antibody (anti-phospho-UPF1 (Ser1127), EMD Millipore, Catalog # 07–1016) 3 M Sodium Acetate (pH 5.5) (Thermo Fisher Scientific Ambion, Catalog # AM9740) Trizma base (Sigma-Aldrich, Catalog # T6066) Boric acid (Millipore Sigma, Catalog # 2720–5KG) Ethylenediaminetetraacetic acid (EDTA), disodium salt (J.T. .. Baker, Catalog # 8993–01) Acrylamide:Bis-Acrylamide (19:1) 40% solution (Fisher Scientific, Catalog # BP1406–1) Ammonium persulfate (APS) (Acros Organics, Catalog # 401165000)

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: .. Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013). .. First, 5 µl of RT reaction mix was added (10 pmol RT primer) and the reaction was incubated at 65 °C for 5 min. Second, the mix of 2.1 µl 5× First-Strand buffer (Invitrogen, #28025013), 0.3 µl H2 O and 0.8 µl of 0.1 M DTT (Invitrogen #28025013) was added and incubated at 42 °C for 30 min. Third, 3.3 µl of RT reaction was added (0.6ul M-MLV reverse transcriptase, 1 µl 5× First-Strand buffer, Invitrogen #28025013, 0.3 µl H2 O, 0.8 µl of 0.1 M DTT, Invitrogen #28025013 and 0.6 µl 10 mM dNTP mix, Invitrogen #18427088) and the reaction was incubated at 42 °C for 2 h. The first PCR amplification was carried out by adding 35 µl of the reagents (3.5 µl 10×ThermoPol Reaction Buffer, NEB #M0267S, 0.7 µl 10 mM dNTP mix Invitrogen #18427088, 35 pmol RT primer oligo, 35 pmol PCR primer oligo, 0.5 µl Taq DNA Polymerase NEB #M0267S, 23.3 µl H2 O) and incubating at 98 °C for 30 s followed by 13 cycles of 98 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s and a final incubation at 72 °C for 5 min. Next, 1 µl of the amplified product was transferred to a fresh tube and to 25 µl of second PCR reaction (consisting of 10 µM indexed primer, 10 µM 5′ Illumina PCR primer, 2.5 µl 10× ThermoPol Reaction buffer, 0.5 µl Taq DNA Polymerase NEB #M0267S, 0.5 µl 10 mM dNTP mix, Invitrogen #18427088), followed by a 30 s incubation at 98 °C, 13 cycles of 98 °C for 10 s, 67 °C for 30 s, and 72 °C for 30 s and a final incubation at 72 °C for 5 min. PCR products of ~140 bp were gel-purified after the second PCR on an 8% non-denaturing acrylamide gel.

    Nucleic Acid Electrophoresis:

    Article Title: Bias-minimized quantification of microRNA reveals widespread alternative processing and 3′ end modification
    Article Snippet: The RNA mixture was size-fractionated by 15% urea–polyacrylamide gel electrophoresis and eluted in 0.3 M NaCl to enrich miRNA species using two FAM-labeled markers (17 nt and 29 nt). .. Small RNA libraries were constructed using either the TruSeq small RNA library preparation kit (Illumina) according to manufacturer's instructions or AQ-seq as follows: miRNA-enriched RNA was ligated to 0.25 μM 3′ randomized adapter using 20 units/μl of T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG 8000 (NEB) at 25°C for at least 3 h. The ligated RNA was gel-purified on a 15% urea–polyacrylamide gel using two markers (40 nt and 55 nt) to remove the free 3′ adapter and eluted in 0.3 M NaCl.

    RNA Sequencing Assay:

    Article Title: Bias-minimized quantification of microRNA reveals widespread alternative processing and 3′ end modification
    Article Snippet: Paragraph title: Small RNA sequencing library preparation ... Small RNA libraries were constructed using either the TruSeq small RNA library preparation kit (Illumina) according to manufacturer's instructions or AQ-seq as follows: miRNA-enriched RNA was ligated to 0.25 μM 3′ randomized adapter using 20 units/μl of T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG 8000 (NEB) at 25°C for at least 3 h. The ligated RNA was gel-purified on a 15% urea–polyacrylamide gel using two markers (40 nt and 55 nt) to remove the free 3′ adapter and eluted in 0.3 M NaCl.

    Article Title: AID–RNA polymerase II transcription-dependent deamination of IgV DNA
    Article Snippet: Paragraph title: RNA-seq Illumina library preparation ... RNA transcripts were ligated to a 5′-adenylated, 3′-blocked ssDNA adaptor (5′-rAppGAT CGG AAG AGC ACA CGT CTG AAC TCC AG-NH2 -3′), using T4 RNA Ligase 2-truncated KQ (New England Biolabs) at 16°C for 16 h. Ligated RNA transcripts were annealed to a NG-8 primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT TCA AGT GTG ACT GGA GTT CAG ACG T-3′) and reverse transcribed using NEBNext First Strand Synthesis Enzyme mix (New England Biolabs) in a thermocycler (25°C 10 min, 42°C 15 min, 70°C 15 min).

    Article Title: ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline
    Article Snippet: Paragraph title: Small RNA sequencing ... Preadenylated 3′ adapter was ligated to small RNAs using T4 RNA Ligase 2 Truncated KQ (NEB, M0373S).

    Isolation:

    Article Title: Bias-minimized quantification of microRNA reveals widespread alternative processing and 3′ end modification
    Article Snippet: Small RNA sequencing library preparation Total RNA was isolated from HEK293T and HeLa cells using TRIzol (Invitrogen) and mixed with 1 μl of 10 nM spike-in control oligos, thirty non-human RNA sequences of 21–23 nt in length ( ). .. Small RNA libraries were constructed using either the TruSeq small RNA library preparation kit (Illumina) according to manufacturer's instructions or AQ-seq as follows: miRNA-enriched RNA was ligated to 0.25 μM 3′ randomized adapter using 20 units/μl of T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG 8000 (NEB) at 25°C for at least 3 h. The ligated RNA was gel-purified on a 15% urea–polyacrylamide gel using two markers (40 nt and 55 nt) to remove the free 3′ adapter and eluted in 0.3 M NaCl.

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: .. After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. Ligated RNAs were purified using RNA Clean & Concentrator-25 columns (Zymo Research) and reverse transcribed by SuperScript III (see RNA extraction and qRT-PCR section) and universal RT+linker primer ( ). cDNAs were diluted and 100 ng cDNA was used for PCR reaction using U1 and U2 gene-specific forward primers ( ) and universal RT+linker reverse primer.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: .. Total cellular RNA was isolated from a Δ rnr Δ rimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The reaction products were annealed with primer CJ1341 (5′ CCGTGATTGATGGTGCCTACAG 3′), which is complementary to the cloning linker, and reverse-transcribed.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: .. 3′ RACE Total cellular RNA was isolated from a Δrnr ΔrimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The reaction products were annealed with primer CJ1341 (5′ CCGTGATTGATGGTGCCTACAG 3′), which is complementary to the cloning linker, and reverse-transcribed.

    Negative Control:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: A custom polyclonal anti-ORF57 antibody prepared by rabbit immunization with KLH-linked synthetic peptide corresponding to aa 119–132 of ORF57 protein and followed by on-column affinity purification ( ; ) is used for this protocol, together with rabbit IgG isotype (ThermoFisher Scientific, cat. no. 02–6102) used in parallel as an antibody negative control. .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence.

    Microscopy:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Purification:

    Article Title: Bias-minimized quantification of microRNA reveals widespread alternative processing and 3′ end modification
    Article Snippet: Small RNA libraries were constructed using either the TruSeq small RNA library preparation kit (Illumina) according to manufacturer's instructions or AQ-seq as follows: miRNA-enriched RNA was ligated to 0.25 μM 3′ randomized adapter using 20 units/μl of T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG 8000 (NEB) at 25°C for at least 3 h. The ligated RNA was gel-purified on a 15% urea–polyacrylamide gel using two markers (40 nt and 55 nt) to remove the free 3′ adapter and eluted in 0.3 M NaCl. .. The purified RNA was ligated to 0.18 μM 5′ randomized adapter using 1 unit/μl of T4 RNA ligase 1 (NEB) in 1X T4 RNA ligase reaction buffer supplemented with 1 mM ATP and 20% PEG 8000 (NEB) at 37°C for 1 h. The products were reverse-transcribed using 10 units/μl of SuperScript III reverse transcriptase (Invitrogen) in 1X first-strand buffer (Invitrogen) with 0.2 μM RT primer (RTP, TruSeq kit; Illumina), 0.5 mM dNTP (TruSeq kit; Illumina), and 5 mM DTT (Invitrogen) at 50°C for 1 h. The cDNA was amplified using 0.02 unit/μl of Phusion High-Fidelity DNA Polymerase (Thermo Scientific) in 1X Phusion HF buffer (Thermo Scientific) with 0.5 μM primers (RP1 forward primer and RPIX reverse primer, TruSeq kit; Illumina) and 0.2 mM dNTP (TAKARA).

    Article Title: AID–RNA polymerase II transcription-dependent deamination of IgV DNA
    Article Snippet: RNA transcripts were ligated to a 5′-adenylated, 3′-blocked ssDNA adaptor (5′-rAppGAT CGG AAG AGC ACA CGT CTG AAC TCC AG-NH2 -3′), using T4 RNA Ligase 2-truncated KQ (New England Biolabs) at 16°C for 16 h. Ligated RNA transcripts were annealed to a NG-8 primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT TCA AGT GTG ACT GGA GTT CAG ACG T-3′) and reverse transcribed using NEBNext First Strand Synthesis Enzyme mix (New England Biolabs) in a thermocycler (25°C 10 min, 42°C 15 min, 70°C 15 min). .. The RNA-seq library was purified using AMPure XP beads (Beckman Coulter) and sequenced on a MiniSeq system.

    Article Title: ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline
    Article Snippet: Purified small RNAs were treated with RNA polyphosphatase (Illumina, RP8092H) or Tobacco Alkaline Phosphatase (Epicentre Biotechnologies, T81050) to reduce di and triphosphates to monophosphates to facilitate capture of 22G-RNAs by 5′ adapter ligation. .. Preadenylated 3′ adapter was ligated to small RNAs using T4 RNA Ligase 2 Truncated KQ (NEB, M0373S).

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. Ligated RNAs were purified using RNA Clean & Concentrator-25 columns (Zymo Research) and reverse transcribed by SuperScript III (see RNA extraction and qRT-PCR section) and universal RT+linker primer ( ). cDNAs were diluted and 100 ng cDNA was used for PCR reaction using U1 and U2 gene-specific forward primers ( ) and universal RT+linker reverse primer.

    Article Title: Capture, Amplification, and Global Profiling of microRNAs from Low Quantities of Whole Cell Lysate
    Article Snippet: Herein, 500 ng of RNA or lysate from 100,000 cells was ligated to the prepared 3′ adaptor (pre-adenylated and dephosphorylated) using T4 RNA Ligase 2 Truncated KQ (NEB M0373S) at room temperature for 6 hours. .. Alternatively, a size purification step was performed to purify the ligation products using 10% denaturing polyacrylamide gel.

    Article Title: A majority of m6A residues are in the last exons, allowing the potential for 3′ UTR regulation
    Article Snippet: The eluted RNA from the m6 A-IP step and the input RNA fragments were first treated with T4 PNK to remove its 3′ phospho group and then ligated to 68 pmol preadenylated DNA linker (L32N from IDT) with T4 RNA ligase 2 and truncated KQ (New England Biolabs, catalog no. M0373L) overnight at 16°C. .. This ligation mixture was subject to 8% PAGE purification to harvest the ligated product.

    Article Title: Distributed biotin–streptavidin transcription roadblocks for mapping cotranscriptional RNA folding
    Article Snippet: Sequencing library processing An RNA linker was adenylated using the 5΄ DNA adenylation kit (New England Biolabs), purified by TRIzol extraction, and quantified using a Qubit Fluorometer as described previously ( ). .. Extracted RNAs were ligated to an RNA linker using T4 RNA Ligase 2 truncated KQ (New England Biolabs) by incubation at room temperature as described previously ( ).

    IA:

    Article Title: RNA-dependent chromatin association of transcription elongation factors and Pol II CTD kinases
    Article Snippet: .. PAR-CLIP library preparation and high-throughput sequencing For 3′ adaptor ligation, beads were resuspended in 1 × T4 RNA ligase buffer (NEB) containing 10 U/µL T4 RNA ligase 2 (KQ) (NEB, M0373), 10 μM 3′ adaptor (5′ 5rApp-TGGAATTCTCGGGTGCCAAGG-3ddC 3′ (IDT, Inc., Coralville, IA )) , 1 U/µL RNase OUT, and 15% (w/v) PEG 8000. ..

    Polymerase Chain Reaction:

    Article Title: Bias-minimized quantification of microRNA reveals widespread alternative processing and 3′ end modification
    Article Snippet: Small RNA libraries were constructed using either the TruSeq small RNA library preparation kit (Illumina) according to manufacturer's instructions or AQ-seq as follows: miRNA-enriched RNA was ligated to 0.25 μM 3′ randomized adapter using 20 units/μl of T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG 8000 (NEB) at 25°C for at least 3 h. The ligated RNA was gel-purified on a 15% urea–polyacrylamide gel using two markers (40 nt and 55 nt) to remove the free 3′ adapter and eluted in 0.3 M NaCl. .. The PCR-amplified cDNA was gel-purified using a 6% polyacrylamide gel to remove adapter dimers and sequenced using MiSeq or HiSeq platforms.

    Article Title: AID–RNA polymerase II transcription-dependent deamination of IgV DNA
    Article Snippet: RNA transcripts were ligated to a 5′-adenylated, 3′-blocked ssDNA adaptor (5′-rAppGAT CGG AAG AGC ACA CGT CTG AAC TCC AG-NH2 -3′), using T4 RNA Ligase 2-truncated KQ (New England Biolabs) at 16°C for 16 h. Ligated RNA transcripts were annealed to a NG-8 primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT TCA AGT GTG ACT GGA GTT CAG ACG T-3′) and reverse transcribed using NEBNext First Strand Synthesis Enzyme mix (New England Biolabs) in a thermocycler (25°C 10 min, 42°C 15 min, 70°C 15 min). .. The product cDNAs were amplified 30 cycles (94°C 30 s, 45°C 15 s, 72°C 30 s) by Taq DNA polymerase (Promega) using NG-8 and NG-RNA-F (5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T TAT ATG CAT AAA GAC CAG-3′) as PCR primers.

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. Ligated RNAs were purified using RNA Clean & Concentrator-25 columns (Zymo Research) and reverse transcribed by SuperScript III (see RNA extraction and qRT-PCR section) and universal RT+linker primer ( ). cDNAs were diluted and 100 ng cDNA was used for PCR reaction using U1 and U2 gene-specific forward primers ( ) and universal RT+linker reverse primer.

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013). .. First, 5 µl of RT reaction mix was added (10 pmol RT primer) and the reaction was incubated at 65 °C for 5 min. Second, the mix of 2.1 µl 5× First-Strand buffer (Invitrogen, #28025013), 0.3 µl H2 O and 0.8 µl of 0.1 M DTT (Invitrogen #28025013) was added and incubated at 42 °C for 30 min. Third, 3.3 µl of RT reaction was added (0.6ul M-MLV reverse transcriptase, 1 µl 5× First-Strand buffer, Invitrogen #28025013, 0.3 µl H2 O, 0.8 µl of 0.1 M DTT, Invitrogen #28025013 and 0.6 µl 10 mM dNTP mix, Invitrogen #18427088) and the reaction was incubated at 42 °C for 2 h. The first PCR amplification was carried out by adding 35 µl of the reagents (3.5 µl 10×ThermoPol Reaction Buffer, NEB #M0267S, 0.7 µl 10 mM dNTP mix Invitrogen #18427088, 35 pmol RT primer oligo, 35 pmol PCR primer oligo, 0.5 µl Taq DNA Polymerase NEB #M0267S, 23.3 µl H2 O) and incubating at 98 °C for 30 s followed by 13 cycles of 98 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s and a final incubation at 72 °C for 5 min. Next, 1 µl of the amplified product was transferred to a fresh tube and to 25 µl of second PCR reaction (consisting of 10 µM indexed primer, 10 µM 5′ Illumina PCR primer, 2.5 µl 10× ThermoPol Reaction buffer, 0.5 µl Taq DNA Polymerase NEB #M0267S, 0.5 µl 10 mM dNTP mix, Invitrogen #18427088), followed by a 30 s incubation at 98 °C, 13 cycles of 98 °C for 10 s, 67 °C for 30 s, and 72 °C for 30 s and a final incubation at 72 °C for 5 min. PCR products of ~140 bp were gel-purified after the second PCR on an 8% non-denaturing acrylamide gel.

    Labeling:

    Article Title: Distributed biotin–streptavidin transcription roadblocks for mapping cotranscriptional RNA folding
    Article Snippet: Extracted RNAs were ligated to an RNA linker using T4 RNA Ligase 2 truncated KQ (New England Biolabs) by incubation at room temperature as described previously ( ). .. Ligation of an Illumina A_b adapter fragment was performed using CircLigase I ssDNA ligase (Epicentre) as described previously ( ). ssDNA libraries were used to generate fluorescently labeled dsDNA libraries as described previously ( ).

    Polyacrylamide Gel Electrophoresis:

    Article Title: A majority of m6A residues are in the last exons, allowing the potential for 3′ UTR regulation
    Article Snippet: The eluted RNA from the m6 A-IP step and the input RNA fragments were first treated with T4 PNK to remove its 3′ phospho group and then ligated to 68 pmol preadenylated DNA linker (L32N from IDT) with T4 RNA ligase 2 and truncated KQ (New England Biolabs, catalog no. M0373L) overnight at 16°C. .. This ligation mixture was subject to 8% PAGE purification to harvest the ligated product.

    Lysis:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: The tablet could be also directly dissolved in 10 ml of lysis buffer. .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence.

    cDNA Library Assay:

    Article Title: A majority of m6A residues are in the last exons, allowing the potential for 3′ UTR regulation
    Article Snippet: Paragraph title: BrdU-CLIP cDNA library protocol ... The eluted RNA from the m6 A-IP step and the input RNA fragments were first treated with T4 PNK to remove its 3′ phospho group and then ligated to 68 pmol preadenylated DNA linker (L32N from IDT) with T4 RNA ligase 2 and truncated KQ (New England Biolabs, catalog no. M0373L) overnight at 16°C.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: AID–RNA polymerase II transcription-dependent deamination of IgV DNA
    Article Snippet: RNA transcripts were ligated to a 5′-adenylated, 3′-blocked ssDNA adaptor (5′-rAppGAT CGG AAG AGC ACA CGT CTG AAC TCC AG-NH2 -3′), using T4 RNA Ligase 2-truncated KQ (New England Biolabs) at 16°C for 16 h. Ligated RNA transcripts were annealed to a NG-8 primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT TCA AGT GTG ACT GGA GTT CAG ACG T-3′) and reverse transcribed using NEBNext First Strand Synthesis Enzyme mix (New England Biolabs) in a thermocycler (25°C 10 min, 42°C 15 min, 70°C 15 min). .. The product cDNAs were amplified 30 cycles (94°C 30 s, 45°C 15 s, 72°C 30 s) by Taq DNA polymerase (Promega) using NG-8 and NG-RNA-F (5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T TAT ATG CAT AAA GAC CAG-3′) as PCR primers.

    RNA Extraction:

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. Ligated RNAs were purified using RNA Clean & Concentrator-25 columns (Zymo Research) and reverse transcribed by SuperScript III (see RNA extraction and qRT-PCR section) and universal RT+linker primer ( ). cDNAs were diluted and 100 ng cDNA was used for PCR reaction using U1 and U2 gene-specific forward primers ( ) and universal RT+linker reverse primer.

    Selection:

    Article Title: ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline
    Article Snippet: Small RNA sequencing Small RNAs in the 18–28-nt range were purified from total RNA by size selection using electrophoretic transfer from 17% polyacrylamide gels. .. Preadenylated 3′ adapter was ligated to small RNAs using T4 RNA Ligase 2 Truncated KQ (NEB, M0373S).

    Agarose Gel Electrophoresis:

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: Total cellular RNA was isolated from a Δ rnr Δ rimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The products were resolved on an agarose gel, eluted and sequenced to determine the 3′ ends of the different rRNA fragments.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: 3′ RACE Total cellular RNA was isolated from a Δrnr ΔrimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The products were resolved on an agarose gel, eluted and sequenced to determine the 3′ ends of the different rRNA fragments.

    Concentration Assay:

    Article Title: Systematic evaluation and optimization of the experimental steps in RNA G-quadruplex structure sequencing
    Article Snippet: .. 3′-adapter ligation reaction The reaction mixture consisted of 1 μl of 1 μM N40 -3′OH RNA (0.1 μM final), 1 μl of 1, 2.5, 5 or 10 μM of 3′-adapter (0.1, 0.25, 0.5 or 1 μM final), 0 or 3.5 μl of 50% polyethylene glycol (PEG) 8000 (0% or 17.5% final), 1 μl of 10X reaction buffer that gave final working concentration of 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2 , 1 mM dithiothreitol (DTT), and 200 U T4 RNA ligase 2, truncated KQ ligase (NEB, M0373S). .. To investigate the effect of PEG concentration on the ligation efficiency, 1 μl of 1 μM N40 -3′OH RNA (0.1 μM final) was reacted with 1 μl of 10 μM of 3′-adapter (1 μM final), under different percentage of PEG 8000.

    Article Title: Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation
    Article Snippet: The concentration of the pre-adenylated adaptor was estimated by analysis on an 15% denaturing polyacrylamide gel (made with American Bioanalytical Sequel NE, #AB13021, AB13022) and comparison of band intensity to known quantities of synthesized oligonucletides. .. Small RNA library preparation: Single-cell or half-cell lysate (5 µl) was subjected to 3′ adaptor ligation by adding 5.24 µl of 3′ adapter ligation reaction mixture (1 pmol 3′ adapter, 1.66 µl 50% PEG 8000, NEB #M0373S, 250 U T4 RNA Ligase 2 truncated KQ, NEB #M0373S, 0.83 µl 10 × T4 RNA ligase buffer, NEB #M0373S, 20 U recombinant RNase Inhibitor, Takara, #2313 A) and the reaction was incubated at 30 °C for 6 h followed by 4 °C for 10 h. Next, 5 µl adaptor-digestion mixture was added (10 pmol RT primer, 5 U Lambda exonuclease, NEB #0262 S, 5 U 5′ deadenylase, NEB #M0331S) and the reaction was incubated at 30 °C for 15 min followed by 37 °C for 15 min. Next, 5 µl 5′ adapter ligation reaction mixture was added (10 pmol 5′ adapter oligo, 10 U T4 RNA ligase 1, Thermo Fisher #EL0021, 1 µl T4 RNA ligase buffer, Thermo Fisher #EL0021, 2 µl 50% PEG 8000, NEB #M0373S) and incubated at 37 °C for 1 h. Reverse transcription reaction was performed in three steps using M-MLV reverse transcriptase (RT) (Invitrogen #28025013).

    CTG Assay:

    Article Title: AID–RNA polymerase II transcription-dependent deamination of IgV DNA
    Article Snippet: .. RNA transcripts were ligated to a 5′-adenylated, 3′-blocked ssDNA adaptor (5′-rAppGAT CGG AAG AGC ACA CGT CTG AAC TCC AG-NH2 -3′), using T4 RNA Ligase 2-truncated KQ (New England Biolabs) at 16°C for 16 h. Ligated RNA transcripts were annealed to a NG-8 primer (5′-CAA GCA GAA GAC GGC ATA CGA GAT TCA AGT GTG ACT GGA GTT CAG ACG T-3′) and reverse transcribed using NEBNext First Strand Synthesis Enzyme mix (New England Biolabs) in a thermocycler (25°C 10 min, 42°C 15 min, 70°C 15 min). .. The product cDNAs were amplified 30 cycles (94°C 30 s, 45°C 15 s, 72°C 30 s) by Taq DNA polymerase (Promega) using NG-8 and NG-RNA-F (5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T TAT ATG CAT AAA GAC CAG-3′) as PCR primers.

    Staining:

    Article Title: Defining nonsense-mediated mRNA decay intermediates in human cells
    Article Snippet: .. Baker, Catalog # JT9182–01) Ethanol (100% and 75%) (Koptec, Catalog # QDEV1001TP) 2-Propanol (Fisher Scientific, Catalog # A4514) Glycogen Solution (20 mg/ml) (Thermo Fisher Scienctific, Catalog # R0561) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Catalog # S11494) Phenol: Chloroform: Isoamyl Alcohol 25:24:1 Saturated with 10 mM Tris (pH 8.0), 1 mM EDTA (Sigma-Aldrich, Catalog # P2069) Halt Protease and Phosphatase Inhibitor Cocktail, EDTA-free (100×) (Thermo Fisher Scientific, Catalog # 78443) IgG from rabbit serum (Sigma-Aldrich, Catalog # I5006) DNase I (RQ1 RNase-Free DNase) (Promega, Catalog # M6101) RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific Invitrogen, Catalog # 10777019) Shrimp alkaline phosphatase (rSAP) (New England Biolabs, Catalog # M0371L) T4 RNA Ligase 2, truncated KQ (New England Biolabs, Catalog # M0373L) T4 polynucleotide kinase (T4 PNK) (New England Biolabs, Catalog # M0201L) T4 RNA Ligase, cloned, 5 U/μl (Thermo Fisher Scientific, Ambion, Catalog # AM2141) SuperScript III Reverse Transcriptase (Thermo Fisher Scientific, Invitrogen, Catalog # 18080085) Q5 High-Fidelity DNA Polymerase (New England Biolabs, Catalog # M0491S) Urea (EMD Millipore, Catalog # 9510) Acrylamide/bis-acrylamide 19:1 (40%) (Fisher scientific, Catalog # BP1406–1) Acrylamide/bis-acrylamide 29:1 (40%) (Fisher scientific, Catalog # BP1408–1) Ammonium persulfate, crystal (Mallinckrodt chemicals, Catalog # 3460–04) UltraPure TEMED (Thermo Fisher Scientific, Invitrogen, Catalog # 15524010) Sodium dodecyl sulfate (Sigma-Aldrich, Catalog # 75746) TWEEN 20 (Sigma-Aldrich, Catalog # P7949) TRITON X-100 (Sigma-Aldrich, Catalog # T9284) Nonidet P-40 (NP-40) (Sigma-Aldrich, Catalog # I3021) 2-Mercaptoethanol (Sigma-Aldrich, Catalog # M3148) RNase T1 (5 U/μl) (Thermo Fisher Scientific Ambion, AM2283) Halt Protease and Phosphatase Inhibitor Cocktail (100×) (Thermo Fisher Scientific, Catalog # PI78443) Bromophenol blue (Fisher Scientific, Catalog # B-392) 1 Kb Plus DNA Ladder (Thermo Fisher Scientific Invitrogen, Catalog # 10787018) Dynabeads Protein A (Thermo Fisher Scientific, Catalog # 10002D) Anti-phospho-UPF1 Ser1116 antibody (anti-phospho-UPF1 (Ser1127), EMD Millipore, Catalog # 07–1016) 3 M Sodium Acetate (pH 5.5) (Thermo Fisher Scientific Ambion, Catalog # AM9740) Trizma base (Sigma-Aldrich, Catalog # T6066) Boric acid (Millipore Sigma, Catalog # 2720–5KG) Ethylenediaminetetraacetic acid (EDTA), disodium salt (J.T. .. Baker, Catalog # 8993–01) Acrylamide:Bis-Acrylamide (19:1) 40% solution (Fisher Scientific, Catalog # BP1406–1) Ammonium persulfate (APS) (Acros Organics, Catalog # 401165000)

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs t4 rna ligase 2 truncated kq
    Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using <t>T4</t> RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.
    T4 Rna Ligase 2 Truncated Kq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 truncated kq/product/New England Biolabs
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated kq - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using T4 RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.

    Journal: PLoS ONE

    Article Title: Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation

    doi: 10.1371/journal.pone.0167009

    Figure Lengend Snippet: Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using T4 RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.

    Article Snippet: Ligation Step 1: 1X Buffer 1 (50 mM Tris(hydroxymethyl)aminomethane HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreital, ~20% polyethylene glycol (PEG) 8000) (TriLink Biotechnologies), 0.5 μM CleanTag 3΄ Adapter (TriLink Biotechnologies, LLC.), 40 Units murine RNase Inhibitor (New England Biolabs), 200 Units of T4 RNA Ligase 2 truncated KQ (New England Biolabs), RNA input (1 μg), 10 μL total volume.

    Techniques: Ligation, Modification