instant sticky end ligase (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
|
Name:
Instant Sticky end Ligase Master Mix
Description:
Instant Sticky end Ligase Master Mix 250 rxns
Catalog Number:
m0370l
Price:
384
Size:
250 rxns
Category:
DNA Ligases
|
Buy from Supplier |
Structured Review
New England Biolabs
instant sticky end ligase
Instant Sticky end Ligase Master Mix 250 rxns
https://www.bioz.com/result/instant sticky end ligase/product/New England Biolabs
Average 99 stars, based on 27 article reviews
Price from $9.99 to $1999.99
Instant Sticky end Ligase Master Mix 250 rxns
https://www.bioz.com/result/instant sticky end ligase/product/New England Biolabs
Average 99 stars, based on 27 article reviews
Price from $9.99 to $1999.99
instant sticky end ligase - by Bioz Stars,
2020-09
99/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Clone Assay:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Ligation:Article Title: RNA promotes the formation of spatial compartments in the nucleus Article Snippet: .. Ligation was performed as previously described using Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: .. Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Article Title: A single-cell method to map higher-order 3D genome organization in thousands of individual cells reveals structural heterogeneity in mouse ES cells Article Snippet: .. Each well was then supplemented with 6.4 µL of Purification:Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: .. Digested PCR products were PCR purified and ligated using Article Title: MITF reprograms the extracellular matrix and focal adhesion in melanoma Article Snippet: .. Following this, the annealed primers and purified digested vector were ligated at a 15:1 insert to backbone molar ratio using Polymerase Chain Reaction:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Identification and Structural Analysis of an l-Asparaginase Enzyme from Guinea Pig with Putative Tumor Cell Killing Properties * Article Snippet: .. The PCR product was digested with NdeI and BamHI-HF, gel-purified, and ultimately ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO ( s mall u biquitin mo difier) Smt3p tag of 101 residues) using Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: .. Digested PCR products were PCR purified and ligated using Transformation Assay:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: .. Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Plasmid Preparation:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Identification and Structural Analysis of an l-Asparaginase Enzyme from Guinea Pig with Putative Tumor Cell Killing Properties * Article Snippet: .. The PCR product was digested with NdeI and BamHI-HF, gel-purified, and ultimately ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO ( s mall u biquitin mo difier) Smt3p tag of 101 residues) using Article Title: MITF reprograms the extracellular matrix and focal adhesion in melanoma Article Snippet: .. Following this, the annealed primers and purified digested vector were ligated at a 15:1 insert to backbone molar ratio using |