instant sticky end ligase master mix (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
|
Name:
Instant Sticky end Ligase Master Mix
Description:
Instant Sticky end Ligase Master Mix 250 rxns
Catalog Number:
m0370l
Price:
384
Size:
250 rxns
Category:
DNA Ligases
|
Buy from Supplier |
Structured Review
New England Biolabs
instant sticky end ligase master mix
Instant Sticky end Ligase Master Mix 250 rxns
https://www.bioz.com/result/instant sticky end ligase master mix/product/New England Biolabs
Average 99 stars, based on 6 article reviews
Price from $9.99 to $1999.99
Instant Sticky end Ligase Master Mix 250 rxns
https://www.bioz.com/result/instant sticky end ligase master mix/product/New England Biolabs
Average 99 stars, based on 6 article reviews
Price from $9.99 to $1999.99
instant sticky end ligase master mix - by Bioz Stars,
2020-03
99/100 stars
Images
Related Articles
Clone Assay:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. After ligation of the digested vector and PCR product using an Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum Article Snippet: After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: Paragraph title: Plasmid construction by classical restriction-ligation cloning ... Subsequent ligation was carried out with Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: Paragraph title: Cloning into bacteria ... Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase Article Snippet: Paragraph title: Gene Cloning and Mutagenesis ... The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity Article Snippet: Paragraph title: Gene Cloning and Mutagenesis ... The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: All PCR products were checked by agarose gel electrophoresis and those aimed for cloning were confirmed by DNA sequencing by Secugen S.L. (Spain). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe Article Snippet: The PCR product was then cloned into pDML20, which was digested with BglII and PmeI. .. A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: Paragraph title: Cloning and expression of recombinant monoclonal antibodies ... Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Centrifugation:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Amplification:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: The BR021 sequence was amplified by PCR using primers to introduce a C-terminal thrombin cleavage site as well as BglII and XhoI restriction sites (all primer sequences are provided in Supplementary Material 1). .. Subsequent ligation was carried out with Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe Article Snippet: Ligation was performed with the Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Mass Spectrometry:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: Recombinant ETX expression constructs and recombinant ETX purification. rETX truncation fragments were constructed based upon the mass spectrometry and Edman degradation results of the current study or from previous results ( , ) describing ETX processing. .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Synthesized:Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe Article Snippet: A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the instant sticky-end ligase mix (NEB) into pDML61, which was cut with the same restriction enzymes. .. Ligation was performed with the Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase Article Snippet: Gene Cloning and Mutagenesis A codon-optimized synthetic gene corresponding to the amino acid sequence of ErA (UniProt entry P06608) lacking the first 22-amino acid signal peptide was synthesized by Genscript as described by Schalk et al. .. The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity Article Snippet: A codon-optimized synthetic gene corresponding to the amino acid sequence of ErA (UniProt entry ) lacking the first 21-amino acid signal peptide was synthesized by Genscript as described earlier ( ). .. The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe Article Snippet: .. A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the Construct:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. After ligation of the digested vector and PCR product using an Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum Article Snippet: Plasmid p94_solB, used for the overexpression of SolB, was constructed by PCR amplifying the 215-bp solB coding region by use of primers that appended BamHI and KasI restriction sites to the product's 5′ and 3′ ends, respectively. .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: Paragraph title: Recombinant ETX expression constructs and recombinant ETX purification. ... The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using In Silico:Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: We introduced between 2 and 7 synonymous mutations simultaneously in silico to the identified regions and reassessed structural stability or pseudoknot formation using the same structure prediction programs. .. Digested PCR products were PCR purified and ligated using Expressing:Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum Article Snippet: .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: Paragraph title: Recombinant ETX expression constructs and recombinant ETX purification. ... The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: Paragraph title: Cloning and expression of recombinant monoclonal antibodies ... Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Modification:Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Transformation Assay:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: .. After ligation of the digested vector and PCR product using an Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: .. Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: Digested PCR products were PCR purified and ligated using Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: E. coli cells were transformed using the RbCl method or by electroporation using a Gene Pulser (Bio-Rad) [ ]. .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Over Expression:Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum Article Snippet: Plasmid p94_solB, used for the overexpression of SolB, was constructed by PCR amplifying the 215-bp solB coding region by use of primers that appended BamHI and KasI restriction sites to the product's 5′ and 3′ ends, respectively. .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Electroporation:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: .. After ligation of the digested vector and PCR product using an Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: E. coli cells were transformed using the RbCl method or by electroporation using a Gene Pulser (Bio-Rad) [ ]. .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Inverse PCR:Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: Mutations were introduced into pHW2000 bidirectional plasmids by inverse PCR with primers (see Supplementary Table ) including selected mutations and unique ligation sites. .. Digested PCR products were PCR purified and ligated using Ligation:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: .. After ligation of the digested vector and PCR product using an Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: .. Subsequent ligation was carried out with Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: .. Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: Mutations were introduced into pHW2000 bidirectional plasmids by inverse PCR with primers (see Supplementary Table ) including selected mutations and unique ligation sites. .. Digested PCR products were PCR purified and ligated using Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe Article Snippet: A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Introduce:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: The BR021 sequence was amplified by PCR using primers to introduce a C-terminal thrombin cleavage site as well as BglII and XhoI restriction sites (all primer sequences are provided in Supplementary Material 1). .. Subsequent ligation was carried out with Generated:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using DNA Sequencing:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: All PCR products were checked by agarose gel electrophoresis and those aimed for cloning were confirmed by DNA sequencing by Secugen S.L. (Spain). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Sequencing:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. After ligation of the digested vector and PCR product using an Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: The BR021 sequence was amplified by PCR using primers to introduce a C-terminal thrombin cleavage site as well as BglII and XhoI restriction sites (all primer sequences are provided in Supplementary Material 1). .. Subsequent ligation was carried out with Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase Article Snippet: Gene Cloning and Mutagenesis A codon-optimized synthetic gene corresponding to the amino acid sequence of ErA (UniProt entry P06608) lacking the first 22-amino acid signal peptide was synthesized by Genscript as described by Schalk et al. .. The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity Article Snippet: A codon-optimized synthetic gene corresponding to the amino acid sequence of ErA (UniProt entry ) lacking the first 21-amino acid signal peptide was synthesized by Genscript as described earlier ( ). .. The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: Digested PCR products were PCR purified and ligated using Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Sonication:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Binding Assay:Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum Article Snippet: After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of RNA Sequencing Assay:Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: We also identified four regions in segment 5, amenable to extensive silent mutagenesis that were either highly bound or represented at the same frequency in PAR-CLIP and RNA-seq data sets. .. Digested PCR products were PCR purified and ligated using Mutagenesis:Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum Article Snippet: After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase Article Snippet: Paragraph title: Gene Cloning and Mutagenesis ... The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity Article Snippet: Paragraph title: Gene Cloning and Mutagenesis ... The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: We also identified four regions in segment 5, amenable to extensive silent mutagenesis that were either highly bound or represented at the same frequency in PAR-CLIP and RNA-seq data sets. .. Digested PCR products were PCR purified and ligated using Isolation:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: Briefly, DNA was isolated from wild-type strain SM101 using a MasterPure Gram-positive bacterial DNA purification kit (Epicentre, Madison, WI). .. After ligation of the digested vector and PCR product using an Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Purification:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: Paragraph title: Recombinant ETX expression constructs and recombinant ETX purification. ... The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: Following digestion with BglII and XhoI (NEB) and agarose gel electrophoresis of the backbone, the insert and the backbone were purified using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Subsequent ligation was carried out with Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase Article Snippet: .. The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: .. Digested PCR products were PCR purified and ligated using Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: DNA fragments where purified with QIAquick PCR Purification Kit (Qiagen) or QIAquick Gel Extraction Kit (Qiagen). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: The resulting products were loaded on 2% TBE-agarose gels and bands of ~ 5.9 kb for the HC vector backbone, 5.3 kb for the LC vector backbone, ~ 370 bp for HC inserts, and ~ 340 bp for LC inserts were size-selected on agarose gels and purified as described above. .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: Three restriction digest reactions were pooled and products purified using the QIAgen PCR purification kit according to the manufacturer’s instructions. .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Protein Purification:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: The forward primers contain a site for enterokinase cleavage that was used following protein purification. .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Polymerase Chain Reaction:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: .. After ligation of the digested vector and PCR product using an Article Title: Tunable riboregulator switches for post-transcriptional control of gene expression. Article Snippet: Gibson assembly kit, Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum Article Snippet: .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: The BR021 sequence was amplified by PCR using primers to introduce a C-terminal thrombin cleavage site as well as BglII and XhoI restriction sites (all primer sequences are provided in Supplementary Material 1). .. Subsequent ligation was carried out with Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe Article Snippet: The PCR product was then inserted into pDML61, which was cut with restriction enzymes SgrAI and AscI. .. Ligation was performed with the Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: .. Digested PCR products were PCR purified and ligated using Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: All PCR products were checked by agarose gel electrophoresis and those aimed for cloning were confirmed by DNA sequencing by Secugen S.L. (Spain). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: Three restriction digest reactions were pooled and products purified using the QIAgen PCR purification kit according to the manufacturer’s instructions. .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Cell Culture:Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Quantitative RT-PCR:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: After ligation of the digested vector and PCR product using an Recombinant:Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: Paragraph title: Recombinant ETX expression constructs and recombinant ETX purification. ... The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: Paragraph title: Cloning and expression of recombinant monoclonal antibodies ... Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using CRISPR:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Paragraph title: CRISPR/CAS9 Plasmid Construction for Knockout of RARα ... Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Plasmid Preparation:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: .. After ligation of the digested vector and PCR product using an Article Title: Tunable riboregulator switches for post-transcriptional control of gene expression. Article Snippet: Gibson assembly kit, Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum Article Snippet: .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: Paragraph title: Plasmid construction by classical restriction-ligation cloning ... Subsequent ligation was carried out with Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe Article Snippet: Paragraph title: Plasmid Construction ... Ligation was performed with the Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase Article Snippet: .. The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity Article Snippet: .. The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid. .. Digested PCR products were PCR purified and ligated using Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes Article Snippet: The resulting products were loaded on 2% TBE-agarose gels and bands of ~ 5.9 kb for the HC vector backbone, 5.3 kb for the LC vector backbone, ~ 370 bp for HC inserts, and ~ 340 bp for LC inserts were size-selected on agarose gels and purified as described above. .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: Plasmid (1 µg) 1 µg or insert DNA was restriction enzyme digested with Bgl II and Xho I restriction enzymes (Promega). .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 Selection:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Agarose Gel Electrophoresis:Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: Following digestion with BglII and XhoI (NEB) and agarose gel electrophoresis of the backbone, the insert and the backbone were purified using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Subsequent ligation was carried out with Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: All PCR products were checked by agarose gel electrophoresis and those aimed for cloning were confirmed by DNA sequencing by Secugen S.L. (Spain). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Knock-Out:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Paragraph title: CRISPR/CAS9 Plasmid Construction for Knockout of RARα ... Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Spectrophotometry:Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2 Article Snippet: Products were eluted with 20 µL of H2 O and quantified by a Nanodrop 1000 spectrophotometer and stored at −20 °C until use. .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 DNA Purification:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: Briefly, DNA was isolated from wild-type strain SM101 using a MasterPure Gram-positive bacterial DNA purification kit (Epicentre, Madison, WI). .. After ligation of the digested vector and PCR product using an Marker:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe Article Snippet: HIS3 ) marker from pNH603 using primers DML_P285_F and DML_P286_R. .. A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the Gel Extraction:Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression Article Snippet: Following digestion with BglII and XhoI (NEB) and agarose gel electrophoresis of the backbone, the insert and the backbone were purified using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Subsequent ligation was carried out with Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens Article Snippet: DNA fragments where purified with QIAquick PCR Purification Kit (Qiagen) or QIAquick Gel Extraction Kit (Qiagen). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Variant Assay:Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: We selected variant codon combinations that would disrupt or maintain the predicted vRNA structure but not change the encoded amino acid, alter codon usage, or disrupt alternative reading frames or splicing events. .. Digested PCR products were PCR purified and ligated using |