instant sticky end ligase master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Instant Sticky end Ligase Master Mix
    Description:

    Catalog Number:
    M0370
    Price:
    392
    Category:
    DNA Modifying Enzymes
    Applications:
    DNA Manipulation
    Size:
    250 reactions
    Buy from Supplier


    Structured Review

    New England Biolabs instant sticky end ligase master mix
    Instant Sticky end Ligase Master Mix

    https://www.bioz.com/result/instant sticky end ligase master mix/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    instant sticky end ligase master mix - by Bioz Stars, 2021-07
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Guide sequences in RARα exon 7 were identified using the CRISPR Finder tool in WGE. .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. A homologous direct repair (HDR) donor plasmid was prepared in order to introduce a puromycin cassette to repair the DNA double-strand break generated by Cas9 nuclease in RARα exon 7.

    Plasmid Preparation:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Guide sequences in RARα exon 7 were identified using the CRISPR Finder tool in WGE. .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. A homologous direct repair (HDR) donor plasmid was prepared in order to introduce a puromycin cassette to repair the DNA double-strand break generated by Cas9 nuclease in RARα exon 7.

    Article Title: A strategy for designing allosteric modulators of transcription factor dimerization
    Article Snippet: The N1 vectors encoding eGFP or Tomato and PCR-amplified fragments of OLIG2 were digested with XhoI-AgeI or KpnI-AgeI concurrently. .. The linear N1 vector of eGFP or Tomato and digested OLIG2 fragment were ligated by Instant Sticky-end Ligase Master Mix (NEB). .. Cell Culture and Transient Transfection.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: Distinct role of FoxO1 in M-CSF- and GM-CSF-differentiated macrophages contributes LPS-mediated IL-10: implication in hyperglycemia
    Article Snippet: A 1.2 kb of mIL-10 was amplified by PCR from the genomic DNA isolated from the mBMDM by use of the primer pair 5-CCGCTCGAGAGCAGTGTGTCCACACCTAAAACATC-3 (restriction site Xho I) and 5-CCCAAGCTTCAGCTGTTCTATGTACAGAGGCCCTC-3 (restriction site Hin dIII). .. The amplified product was purified by use of the PCR Clean-Up kit (Qiagen), digested with Xho I and Hin dIII, and ligated in pGL3 basic vector (Promega) by use of the Instant Sticky-end Ligase Master Mix (New England BioLabs, Ipswich, MA, USA). .. The ligation product was transformed in Escherichia coli (NEB 5-alpha Competent cells; New England BioLabs).

    Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory
    Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated (instant sticky-end ligase, NEB, UK) into the appropriate expression vector containing either human IgG1 or Kappa constant regions, prior to transformation into E. Coli NEB5-alpha (NEB). ..

    Sequencing:

    Article Title: Application of droplet digital PCR in the analysis of genome integration and organization of the transgene in BAC transgenic mice
    Article Snippet: .. iPCR and sequencing Extracted genomic DNA was also digested with Sau 3AI, Mse I or Nla III at 37 °C for 2 h. The digested DNA was then heat-inactivated at 65 °C for 20 min, and circularized by self-ligation with an equal volume of Instant Sticky-end Ligase Master Mix (New England Biolabs, Beverly, MA, USA). .. Nested amplification around the circular DNA using primers oriented in a direction opposite to that of conventional PCR was performed using reaction mixtures containing DNA template, 1 × Ex Taq buffer (containing 2.0 mM of MgCl2 ), 250 μM of dNTP mix, 0.5 μM of each primer, and 0.25 U/μl of Ex Taq DNA Polymerase (Takara Bio, Otsu, Japan).

    Ligation:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: The COPII components Sec23 and Sec24 form isoform specific subcomplexes with Sec23D/E and Sec24C/D essential for tip growth
    Article Snippet: Protospacers were synthesized as oligonucleotides (Table S4) and annealed as described ( ). .. Annealed protospacer fragments were transferred to vectors using Instant Sticky-End Ligation Master Mix (New England Biolabs). .. Sec23B and G protospacers designed to tag these genes via HDR as well as Sec23A, D and E protospacers designed to knock out these genes were ligated into pENTR-PpU6-sgRNA-L1L2 ( ).

    Polymerase Chain Reaction:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: Distinct role of FoxO1 in M-CSF- and GM-CSF-differentiated macrophages contributes LPS-mediated IL-10: implication in hyperglycemia
    Article Snippet: A 1.2 kb of mIL-10 was amplified by PCR from the genomic DNA isolated from the mBMDM by use of the primer pair 5-CCGCTCGAGAGCAGTGTGTCCACACCTAAAACATC-3 (restriction site Xho I) and 5-CCCAAGCTTCAGCTGTTCTATGTACAGAGGCCCTC-3 (restriction site Hin dIII). .. The amplified product was purified by use of the PCR Clean-Up kit (Qiagen), digested with Xho I and Hin dIII, and ligated in pGL3 basic vector (Promega) by use of the Instant Sticky-end Ligase Master Mix (New England BioLabs, Ipswich, MA, USA). .. The ligation product was transformed in Escherichia coli (NEB 5-alpha Competent cells; New England BioLabs).

    Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory
    Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated (instant sticky-end ligase, NEB, UK) into the appropriate expression vector containing either human IgG1 or Kappa constant regions, prior to transformation into E. Coli NEB5-alpha (NEB). ..

    Transformation Assay:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory
    Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated (instant sticky-end ligase, NEB, UK) into the appropriate expression vector containing either human IgG1 or Kappa constant regions, prior to transformation into E. Coli NEB5-alpha (NEB). ..

    Electroporation:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Amplification:

    Article Title: Distinct role of FoxO1 in M-CSF- and GM-CSF-differentiated macrophages contributes LPS-mediated IL-10: implication in hyperglycemia
    Article Snippet: A 1.2 kb of mIL-10 was amplified by PCR from the genomic DNA isolated from the mBMDM by use of the primer pair 5-CCGCTCGAGAGCAGTGTGTCCACACCTAAAACATC-3 (restriction site Xho I) and 5-CCCAAGCTTCAGCTGTTCTATGTACAGAGGCCCTC-3 (restriction site Hin dIII). .. The amplified product was purified by use of the PCR Clean-Up kit (Qiagen), digested with Xho I and Hin dIII, and ligated in pGL3 basic vector (Promega) by use of the Instant Sticky-end Ligase Master Mix (New England BioLabs, Ipswich, MA, USA). .. The ligation product was transformed in Escherichia coli (NEB 5-alpha Competent cells; New England BioLabs).

    Purification:

    Article Title: Distinct role of FoxO1 in M-CSF- and GM-CSF-differentiated macrophages contributes LPS-mediated IL-10: implication in hyperglycemia
    Article Snippet: A 1.2 kb of mIL-10 was amplified by PCR from the genomic DNA isolated from the mBMDM by use of the primer pair 5-CCGCTCGAGAGCAGTGTGTCCACACCTAAAACATC-3 (restriction site Xho I) and 5-CCCAAGCTTCAGCTGTTCTATGTACAGAGGCCCTC-3 (restriction site Hin dIII). .. The amplified product was purified by use of the PCR Clean-Up kit (Qiagen), digested with Xho I and Hin dIII, and ligated in pGL3 basic vector (Promega) by use of the Instant Sticky-end Ligase Master Mix (New England BioLabs, Ipswich, MA, USA). .. The ligation product was transformed in Escherichia coli (NEB 5-alpha Competent cells; New England BioLabs).

    Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory
    Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated (instant sticky-end ligase, NEB, UK) into the appropriate expression vector containing either human IgG1 or Kappa constant regions, prior to transformation into E. Coli NEB5-alpha (NEB). ..

    Expressing:

    Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory
    Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated (instant sticky-end ligase, NEB, UK) into the appropriate expression vector containing either human IgG1 or Kappa constant regions, prior to transformation into E. Coli NEB5-alpha (NEB). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs instant sticky end ligase master mix
    Instant Sticky End Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/instant sticky end ligase master mix/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    instant sticky end ligase master mix - by Bioz Stars, 2021-07
    95/100 stars
      Buy from Supplier

    Image Search Results