instant sticky end ligase master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Instant Sticky end Ligase Master Mix
    Description:
    Instant Sticky end Ligase Master Mix 250 rxns
    Catalog Number:
    m0370l
    Price:
    384
    Size:
    250 rxns
    Category:
    DNA Ligases
    Buy from Supplier


    Structured Review

    New England Biolabs instant sticky end ligase master mix
    Instant Sticky end Ligase Master Mix
    Instant Sticky end Ligase Master Mix 250 rxns
    https://www.bioz.com/result/instant sticky end ligase master mix/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    instant sticky end ligase master mix - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol.

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. A homologous direct repair (HDR) donor plasmid was prepared in order to introduce a puromycin cassette to repair the DNA double-strand break generated by Cas9 nuclease in RARα exon 7.

    Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum
    Article Snippet: After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Instant Sticky-End master mix (NEB) into the p94MCS expression vector, which had been linearized by digestion with BamHI and KasI and dephosphorylated with Antarctic phosphatase (NEB). .. The Gibson assembly, consisting of the two PCR products containing the native promoter, the new mutated RBS, and the ctfA-ctfB genes, was then cloned into the p94MCS vector, which had been digested with SalI.

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: Paragraph title: Plasmid construction by classical restriction-ligation cloning ... Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: Paragraph title: Cloning into bacteria ... Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega).

    Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase
    Article Snippet: Paragraph title: Gene Cloning and Mutagenesis ... The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England Biolabs), generating a His6 -SUMO-ErA plasmid.

    Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity
    Article Snippet: Paragraph title: Gene Cloning and Mutagenesis ... The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England BioLabs), generating the His6 -SUMO-pET14b -ErA -WT plasmid.

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: All PCR products were checked by agarose gel electrophoresis and those aimed for cloning were confirmed by DNA sequencing by Secugen S.L. (Spain). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs).

    Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
    Article Snippet: The PCR product was then cloned into pDML20, which was digested with BglII and PmeI. .. A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the instant sticky-end ligase mix (NEB) into pDML61, which was cut with the same restriction enzymes.

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Paragraph title: Cloning and expression of recombinant monoclonal antibodies ... Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions.

    Centrifugation:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. For induction, E. coli chi1776 (ATCC) was grown to an optical density at 600 nm (OD600 ) of 0.6 at 37°C before shifting the culture to room temperature and inducing with 1 mM isopropyl-β-d -thiogalactopyranoside (IPTG) for 2.5 h. Cells were harvested by centrifugation and lysed by sonication, and MBP-rETX fusion proteins were purified over amylose resin according to the manufacturer’s instructions (New England Biolabs).

    Amplification:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. These fragments were amplified from genomic SH-SY5Y DNA using primers CATGTGAGGCAAGAGATAAGTCAAC and CTGAACCCGAACCCACTCTGAG, and TCTGTTAGGTATCTCTAGAGGGCAG and GCATCTTTCTTGGGATTCAGTTCTT, respectively, using Phusion® High-Fidelity DNA Polymerase (NEB).

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: The BR021 sequence was amplified by PCR using primers to introduce a C-terminal thrombin cleavage site as well as BglII and XhoI restriction sites (all primer sequences are provided in Supplementary Material 1). .. Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
    Article Snippet: Ligation was performed with the instant sticky-end ligase mix (NEB). .. The first PCR product corresponds to the TDH3 promoter, which was PCR amplified from genomic DNA using primers DML_P371_F and DML_P405_R.

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions. .. Plasmid DNAs were isolated from transformed colonies (8–16 colonies) using the QIAprep spin miniprep kit (Qiagen); similarities to the consensus sequences were confirmed using capillary Sanger sequencing.

    Mass Spectrometry:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: Recombinant ETX expression constructs and recombinant ETX purification. rETX truncation fragments were constructed based upon the mass spectrometry and Edman degradation results of the current study or from previous results ( , ) describing ETX processing. .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment.

    Synthesized:

    Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
    Article Snippet: A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the instant sticky-end ligase mix (NEB) into pDML61, which was cut with the same restriction enzymes. .. Ligation was performed with the instant sticky-end ligase mix (NEB).

    Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase
    Article Snippet: Gene Cloning and Mutagenesis A codon-optimized synthetic gene corresponding to the amino acid sequence of ErA (UniProt entry P06608) lacking the first 22-amino acid signal peptide was synthesized by Genscript as described by Schalk et al. .. The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England Biolabs), generating a His6 -SUMO-ErA plasmid.

    Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity
    Article Snippet: A codon-optimized synthetic gene corresponding to the amino acid sequence of ErA (UniProt entry ) lacking the first 21-amino acid signal peptide was synthesized by Genscript as described earlier ( ). .. The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England BioLabs), generating the His6 -SUMO-pET14b -ErA -WT plasmid.

    Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
    Article Snippet: .. A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the instant sticky-end ligase mix (NEB) into pDML61, which was cut with the same restriction enzymes. .. The resulting plasmid was named pDML99.

    Construct:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol.

    Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum
    Article Snippet: Plasmid p94_solB, used for the overexpression of SolB, was constructed by PCR amplifying the 215-bp solB coding region by use of primers that appended BamHI and KasI restriction sites to the product's 5′ and 3′ ends, respectively. .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Instant Sticky-End master mix (NEB) into the p94MCS expression vector, which had been linearized by digestion with BamHI and KasI and dephosphorylated with Antarctic phosphatase (NEB).

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: Paragraph title: Recombinant ETX expression constructs and recombinant ETX purification. ... The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment.

    In Silico:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: We introduced between 2 and 7 synonymous mutations simultaneously in silico to the identified regions and reassessed structural stability or pseudoknot formation using the same structure prediction programs. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Expressing:

    Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum
    Article Snippet: .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Instant Sticky-End master mix (NEB) into the p94MCS expression vector, which had been linearized by digestion with BamHI and KasI and dephosphorylated with Antarctic phosphatase (NEB). .. Plasmid p94_ctfAB(*RBS), used for the expression of the mutated ctfA-ctfB transcript, was constructed using Gibson assembly to achieve mutagenesis of the ribosomal binding site (RBS) of the ctfA gene.

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: Paragraph title: Recombinant ETX expression constructs and recombinant ETX purification. ... The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment.

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Paragraph title: Cloning and expression of recombinant monoclonal antibodies ... Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions.

    Modification:

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions. .. HEK 293 T cells were cultured using rich glucose (4.5 g/L D-glucose) Dulbecco’s Modified Eagle’s Medium (Gibco BRL) supplemented with heat-inactivated ultra-low IgG fetal bovine serum (Thermo Fisher Scientific), 100 U/mL penicillin, and 100 μg/mL streptomycin.

    Transformation Assay:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. The sequence of each construct was confirmed by DNA sequencing at the University of Pittsburgh Genomics and Proteomics Core Laboratories.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: .. Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Ligation mix (1 µL) was added to 100 µL of just-thawed JM109 cells and the transformation procedure carried out according to the manufacturer’s instructions, and transformants grown overnight at 37 °C on LB ampicillin (0.1 mg/mL) agar.

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB). .. Ligation products were transformed into E. coli , plated on selective LB Agar.

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: E. coli cells were transformed using the RbCl method or by electroporation using a Gene Pulser (Bio-Rad) [ ]. .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs).

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions. .. Plasmid DNAs were isolated from transformed colonies (8–16 colonies) using the QIAprep spin miniprep kit (Qiagen); similarities to the consensus sequences were confirmed using capillary Sanger sequencing.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Ligation mix (1 µL) was added to 100 µL of just-thawed JM109 cells and the transformation procedure carried out according to the manufacturer’s instructions, and transformants grown overnight at 37 °C on LB ampicillin (0.1 mg/mL) agar.

    Over Expression:

    Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum
    Article Snippet: Plasmid p94_solB, used for the overexpression of SolB, was constructed by PCR amplifying the 215-bp solB coding region by use of primers that appended BamHI and KasI restriction sites to the product's 5′ and 3′ ends, respectively. .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Instant Sticky-End master mix (NEB) into the p94MCS expression vector, which had been linearized by digestion with BamHI and KasI and dephosphorylated with Antarctic phosphatase (NEB).

    Electroporation:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: E. coli cells were transformed using the RbCl method or by electroporation using a Gene Pulser (Bio-Rad) [ ]. .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs).

    Inverse PCR:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Mutations were introduced into pHW2000 bidirectional plasmids by inverse PCR with primers (see Supplementary Table ) including selected mutations and unique ligation sites. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Ligation:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: .. Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert. .. 2.1.3 Plasmid propagation, verification and purification Following the construction of the plasmids, 5 μL of the resulting DNA solution was added to 80 μL of lysogeny broth (LB) medium containing chemically competent E. coli NEB 10-β cells.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: .. Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Ligation mix (1 µL) was added to 100 µL of just-thawed JM109 cells and the transformation procedure carried out according to the manufacturer’s instructions, and transformants grown overnight at 37 °C on LB ampicillin (0.1 mg/mL) agar.

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Mutations were introduced into pHW2000 bidirectional plasmids by inverse PCR with primers (see Supplementary Table ) including selected mutations and unique ligation sites. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs). .. Gene Expression Analyses

    Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
    Article Snippet: A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the instant sticky-end ligase mix (NEB) into pDML61, which was cut with the same restriction enzymes. .. Ligation was performed with the instant sticky-end ligase mix (NEB).

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Ligation mix (1 µL) was added to 100 µL of just-thawed JM109 cells and the transformation procedure carried out according to the manufacturer’s instructions, and transformants grown overnight at 37 °C on LB ampicillin (0.1 mg/mL) agar.

    Introduce:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. A homologous direct repair (HDR) donor plasmid was prepared in order to introduce a puromycin cassette to repair the DNA double-strand break generated by Cas9 nuclease in RARα exon 7.

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: The BR021 sequence was amplified by PCR using primers to introduce a C-terminal thrombin cleavage site as well as BglII and XhoI restriction sites (all primer sequences are provided in Supplementary Material 1). .. Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Generated:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. A homologous direct repair (HDR) donor plasmid was prepared in order to introduce a puromycin cassette to repair the DNA double-strand break generated by Cas9 nuclease in RARα exon 7.

    DNA Sequencing:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. The sequence of each construct was confirmed by DNA sequencing at the University of Pittsburgh Genomics and Proteomics Core Laboratories.

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: All PCR products were checked by agarose gel electrophoresis and those aimed for cloning were confirmed by DNA sequencing by Secugen S.L. (Spain). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs).

    Sequencing:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol.

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. The sequence of each construct was confirmed by DNA sequencing at the University of Pittsburgh Genomics and Proteomics Core Laboratories.

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: The BR021 sequence was amplified by PCR using primers to introduce a C-terminal thrombin cleavage site as well as BglII and XhoI restriction sites (all primer sequences are provided in Supplementary Material 1). .. Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Colony PCR and restriction enzyme digests of positive colonies were performed to confirm the presence of the correct insert sequence.

    Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase
    Article Snippet: Gene Cloning and Mutagenesis A codon-optimized synthetic gene corresponding to the amino acid sequence of ErA (UniProt entry P06608) lacking the first 22-amino acid signal peptide was synthesized by Genscript as described by Schalk et al. .. The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England Biolabs), generating a His6 -SUMO-ErA plasmid.

    Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity
    Article Snippet: A codon-optimized synthetic gene corresponding to the amino acid sequence of ErA (UniProt entry ) lacking the first 21-amino acid signal peptide was synthesized by Genscript as described earlier ( ). .. The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England BioLabs), generating the His6 -SUMO-pET14b -ErA -WT plasmid.

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB). .. All plasmids were grown in 200 ml LB Broth prior to preparation by Qiagen HiSpeed Endotoxin-Free MaxiPrep and verified by Sanger Sequencing (Genewiz).

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions. .. Plasmid DNAs were isolated from transformed colonies (8–16 colonies) using the QIAprep spin miniprep kit (Qiagen); similarities to the consensus sequences were confirmed using capillary Sanger sequencing.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Colony PCR and restriction enzyme digests of positive colonies were performed to confirm the presence of the correct insert sequence.

    Sonication:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. For induction, E. coli chi1776 (ATCC) was grown to an optical density at 600 nm (OD600 ) of 0.6 at 37°C before shifting the culture to room temperature and inducing with 1 mM isopropyl-β-d -thiogalactopyranoside (IPTG) for 2.5 h. Cells were harvested by centrifugation and lysed by sonication, and MBP-rETX fusion proteins were purified over amylose resin according to the manufacturer’s instructions (New England Biolabs).

    Binding Assay:

    Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum
    Article Snippet: After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Instant Sticky-End master mix (NEB) into the p94MCS expression vector, which had been linearized by digestion with BamHI and KasI and dephosphorylated with Antarctic phosphatase (NEB). .. Plasmid p94_ctfAB(*RBS), used for the expression of the mutated ctfA-ctfB transcript, was constructed using Gibson assembly to achieve mutagenesis of the ribosomal binding site (RBS) of the ctfA gene.

    RNA Sequencing Assay:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: We also identified four regions in segment 5, amenable to extensive silent mutagenesis that were either highly bound or represented at the same frequency in PAR-CLIP and RNA-seq data sets. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Mutagenesis:

    Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum
    Article Snippet: After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Instant Sticky-End master mix (NEB) into the p94MCS expression vector, which had been linearized by digestion with BamHI and KasI and dephosphorylated with Antarctic phosphatase (NEB). .. Plasmid p94_ctfAB(*RBS), used for the expression of the mutated ctfA-ctfB transcript, was constructed using Gibson assembly to achieve mutagenesis of the ribosomal binding site (RBS) of the ctfA gene.

    Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase
    Article Snippet: Paragraph title: Gene Cloning and Mutagenesis ... The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England Biolabs), generating a His6 -SUMO-ErA plasmid.

    Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity
    Article Snippet: Paragraph title: Gene Cloning and Mutagenesis ... The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England BioLabs), generating the His6 -SUMO-pET14b -ErA -WT plasmid.

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: We also identified four regions in segment 5, amenable to extensive silent mutagenesis that were either highly bound or represented at the same frequency in PAR-CLIP and RNA-seq data sets. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Isolation:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Briefly, DNA was isolated from wild-type strain SM101 using a MasterPure Gram-positive bacterial DNA purification kit (Epicentre, Madison, WI). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol.

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions. .. Plasmid DNAs were isolated from transformed colonies (8–16 colonies) using the QIAprep spin miniprep kit (Qiagen); similarities to the consensus sequences were confirmed using capillary Sanger sequencing.

    Purification:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: Paragraph title: Recombinant ETX expression constructs and recombinant ETX purification. ... The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment.

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: Following digestion with BglII and XhoI (NEB) and agarose gel electrophoresis of the backbone, the insert and the backbone were purified using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase
    Article Snippet: .. The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England Biolabs), generating a His6 -SUMO-ErA plasmid. ..

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB). .. Ligation products were transformed into E. coli , plated on selective LB Agar.

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: DNA fragments where purified with QIAquick PCR Purification Kit (Qiagen) or QIAquick Gel Extraction Kit (Qiagen). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs).

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: The resulting products were loaded on 2% TBE-agarose gels and bands of ~ 5.9 kb for the HC vector backbone, 5.3 kb for the LC vector backbone, ~ 370 bp for HC inserts, and ~ 340 bp for LC inserts were size-selected on agarose gels and purified as described above. .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: Three restriction digest reactions were pooled and products purified using the QIAgen PCR purification kit according to the manufacturer’s instructions. .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega).

    Protein Purification:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: The forward primers contain a site for enterokinase cleavage that was used following protein purification. .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment.

    Polymerase Chain Reaction:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: Tunable riboregulator switches for post-transcriptional control of gene expression.
    Article Snippet: Gibson assembly kit, Instant Sticky-end Ligase Master Mix, One Taq DNA polymerase and restriction enzymes were purchased from New England BioLabs. .. Kits from Qiagen were used for purifications of plasmid DNA, PCR products, and enzymatic digestions.

    Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum
    Article Snippet: .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Instant Sticky-End master mix (NEB) into the p94MCS expression vector, which had been linearized by digestion with BamHI and KasI and dephosphorylated with Antarctic phosphatase (NEB). .. Plasmid p94_ctfAB(*RBS), used for the expression of the mutated ctfA-ctfB transcript, was constructed using Gibson assembly to achieve mutagenesis of the ribosomal binding site (RBS) of the ctfA gene.

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. The sequence of each construct was confirmed by DNA sequencing at the University of Pittsburgh Genomics and Proteomics Core Laboratories.

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: The BR021 sequence was amplified by PCR using primers to introduce a C-terminal thrombin cleavage site as well as BglII and XhoI restriction sites (all primer sequences are provided in Supplementary Material 1). .. Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Colony PCR and restriction enzyme digests of positive colonies were performed to confirm the presence of the correct insert sequence.

    Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
    Article Snippet: The PCR product was then inserted into pDML61, which was cut with restriction enzymes SgrAI and AscI. .. Ligation was performed with the instant sticky-end ligase mix (NEB).

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB). .. Ligation products were transformed into E. coli , plated on selective LB Agar.

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: All PCR products were checked by agarose gel electrophoresis and those aimed for cloning were confirmed by DNA sequencing by Secugen S.L. (Spain). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs).

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: Three restriction digest reactions were pooled and products purified using the QIAgen PCR purification kit according to the manufacturer’s instructions. .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega).

    Cell Culture:

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions. .. HEK 293 T cells were cultured using rich glucose (4.5 g/L D-glucose) Dulbecco’s Modified Eagle’s Medium (Gibco BRL) supplemented with heat-inactivated ultra-low IgG fetal bovine serum (Thermo Fisher Scientific), 100 U/mL penicillin, and 100 μg/mL streptomycin.

    Quantitative RT-PCR:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Recombinant:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: Paragraph title: Recombinant ETX expression constructs and recombinant ETX purification. ... The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment.

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Paragraph title: Cloning and expression of recombinant monoclonal antibodies ... Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions.

    CRISPR:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Paragraph title: CRISPR/CAS9 Plasmid Construction for Knockout of RARα ... Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3.

    Plasmid Preparation:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol. .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Article Title: Tunable riboregulator switches for post-transcriptional control of gene expression.
    Article Snippet: Gibson assembly kit, Instant Sticky-end Ligase Master Mix, One Taq DNA polymerase and restriction enzymes were purchased from New England BioLabs. .. Kits from Qiagen were used for purifications of plasmid DNA, PCR products, and enzymatic digestions.

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. A homologous direct repair (HDR) donor plasmid was prepared in order to introduce a puromycin cassette to repair the DNA double-strand break generated by Cas9 nuclease in RARα exon 7.

    Article Title: Small and Low but Potent: the Complex Regulatory Role of the Small RNA SolB in Solventogenesis in Clostridium acetobutylicum
    Article Snippet: .. After double digestion with BamHI and KasI (New England BioLabs), the PCR product was ligated by use of Instant Sticky-End master mix (NEB) into the p94MCS expression vector, which had been linearized by digestion with BamHI and KasI and dephosphorylated with Antarctic phosphatase (NEB). .. Plasmid p94_ctfAB(*RBS), used for the expression of the mutated ctfA-ctfB transcript, was constructed using Gibson assembly to achieve mutagenesis of the ribosomal binding site (RBS) of the ctfA gene.

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. The sequence of each construct was confirmed by DNA sequencing at the University of Pittsburgh Genomics and Proteomics Core Laboratories.

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: Paragraph title: Plasmid construction by classical restriction-ligation cloning ... Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
    Article Snippet: Paragraph title: Plasmid Construction ... Ligation was performed with the instant sticky-end ligase mix (NEB).

    Article Title: Structural Insight into Substrate Selectivity of Erwinia chrysanthemil-Asparaginase
    Article Snippet: .. The synthetic gene was digested with NdeI and Bam HI-HF restriction enzymes, gel purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England Biolabs), generating a His6 -SUMO-ErA plasmid. ..

    Article Title: Design and Characterization of Erwinia Chrysanthemi l-Asparaginase Variants with Diminished l-Glutaminase Activity
    Article Snippet: .. The synthetic gene was digested with NdeI and BamHI-HF restriction enzymes, gel-purified, and ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO (small ubiquitin modifier, Smt3p) using Instant Sticky End DNA ligase (New England BioLabs), generating the His6 -SUMO-pET14b -ErA -WT plasmid. .. This plasmid was subsequently used as template to create 13 ErA single-mutant variants (A31S, A31I, A31L, A31M, A31N, A31T, A31V, E63L, E63Q, P123S, P123N, S254N, S254P).

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: The resulting products were loaded on 2% TBE-agarose gels and bands of ~ 5.9 kb for the HC vector backbone, 5.3 kb for the LC vector backbone, ~ 370 bp for HC inserts, and ~ 340 bp for LC inserts were size-selected on agarose gels and purified as described above. .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: Plasmid (1 µg) 1 µg or insert DNA was restriction enzyme digested with Bgl II and Xho I restriction enzymes (Promega). .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega).

    Selection:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. The plasmid contains a puromycin selection marker flanked by 1253 and 1313 base pairs of genomic DNA from upstream and downstream of RARα exon 7.

    Agarose Gel Electrophoresis:

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: Following digestion with BglII and XhoI (NEB) and agarose gel electrophoresis of the backbone, the insert and the backbone were purified using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: All PCR products were checked by agarose gel electrophoresis and those aimed for cloning were confirmed by DNA sequencing by Secugen S.L. (Spain). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs).

    Knock-Out:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Paragraph title: CRISPR/CAS9 Plasmid Construction for Knockout of RARα ... Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3.

    Spectrophotometry:

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: Products were eluted with 20 µL of H2 O and quantified by a Nanodrop 1000 spectrophotometer and stored at −20 °C until use. .. Insert ( GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega).

    DNA Purification:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Briefly, DNA was isolated from wild-type strain SM101 using a MasterPure Gram-positive bacterial DNA purification kit (Epicentre, Madison, WI). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol.

    Marker:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. The plasmid contains a puromycin selection marker flanked by 1253 and 1313 base pairs of genomic DNA from upstream and downstream of RARα exon 7.

    Article Title: Scarless Gene Tagging with One-Step Transformation and Two-Step Selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
    Article Snippet: HIS3 ) marker from pNH603 using primers DML_P285_F and DML_P286_R. .. A DNA fragment containing a linker (5xGA) and yeast codon-optimized mNeonGreen was synthesized (gBlock, IDT DNA), digested with PacI and AscI, and ligated with the instant sticky-end ligase mix (NEB) into pDML61, which was cut with the same restriction enzymes.

    Gel Extraction:

    Article Title: Single-cell cloning enables the selection of more productive Drosophila melanogaster S2 cells for recombinant protein expression
    Article Snippet: Following digestion with BglII and XhoI (NEB) and agarose gel electrophoresis of the backbone, the insert and the backbone were purified using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Subsequent ligation was carried out with Instant Sticky End Ligase Mix (NEB) using 100 ng of the backbone and 23 ng of the insert.

    Article Title: Testosterone Degradative Pathway of Novosphingobium tardaugens
    Article Snippet: DNA fragments where purified with QIAquick PCR Purification Kit (Qiagen) or QIAquick Gel Extraction Kit (Qiagen). .. Digestion of DNA fragments was done using restriction enzymes (New England Biolab) and ligation was performed with Instant Sticky-end Ligase Master Mix (New England Biolabs).

    Variant Assay:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: We selected variant codon combinations that would disrupt or maintain the predicted vRNA structure but not change the encoded amino acid, alter codon usage, or disrupt alternative reading frames or splicing events. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs instant sticky end ligase master mix
    Instant Sticky End Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/instant sticky end ligase master mix/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    instant sticky end ligase master mix - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results