instant sticky end ligase master mix (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
95
|
Name:
Instant Sticky end Ligase Master Mix
Description:
Catalog Number:
M0370
Price:
392
Category:
DNA Modifying Enzymes
Applications:
DNA Manipulation
Size:
250 reactions
|
Buy from Supplier |
Structured Review
New England Biolabs
instant sticky end ligase master mix
https://www.bioz.com/result/instant sticky end ligase master mix/product/New England Biolabs
Average 95 stars, based on 1 article reviews
Price from $9.99 to $1999.99
https://www.bioz.com/result/instant sticky end ligase master mix/product/New England Biolabs
Average 95 stars, based on 1 article reviews
Price from $9.99 to $1999.99
instant sticky end ligase master mix - by Bioz Stars,
2021-07
95/100 stars
Images
Related Articles
Clone Assay:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Guide sequences in RARα exon 7 were identified using the CRISPR Finder tool in WGE. .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Plasmid Preparation:Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor Article Snippet: Guide sequences in RARα exon 7 were identified using the CRISPR Finder tool in WGE. .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Article Title: A strategy for designing allosteric modulators of transcription factor dimerization Article Snippet: The N1 vectors encoding eGFP or Tomato and PCR-amplified fragments of OLIG2 were digested with XhoI-AgeI or KpnI-AgeI concurrently. .. The linear N1 vector of eGFP or Tomato and digested OLIG2 fragment were ligated by Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an Article Title: Distinct role of FoxO1 in M-CSF- and GM-CSF-differentiated macrophages contributes LPS-mediated IL-10: implication in hyperglycemia Article Snippet: A 1.2 kb of mIL-10 was amplified by PCR from the genomic DNA isolated from the mBMDM by use of the primer pair 5-CCGCTCGAGAGCAGTGTGTCCACACCTAAAACATC-3 (restriction site Xho I) and 5-CCCAAGCTTCAGCTGTTCTATGTACAGAGGCCCTC-3 (restriction site Hin dIII). .. The amplified product was purified by use of the PCR Clean-Up kit (Qiagen), digested with Xho I and Hin dIII, and ligated in pGL3 basic vector (Promega) by use of the Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated ( Sequencing:Article Title: Application of droplet digital PCR in the analysis of genome integration and organization of the transgene in BAC transgenic mice Article Snippet: .. iPCR and sequencing Extracted genomic DNA was also digested with Sau 3AI, Mse I or Nla III at 37 °C for 2 h. The digested DNA was then heat-inactivated at 65 °C for 20 min, and circularized by self-ligation with an equal volume of Ligation:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an Article Title: The COPII components Sec23 and Sec24 form isoform specific subcomplexes with Sec23D/E and Sec24C/D essential for tip growth Article Snippet: Protospacers were synthesized as oligonucleotides (Table S4) and annealed as described ( ). .. Annealed protospacer fragments were transferred to vectors using Polymerase Chain Reaction:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an Article Title: Distinct role of FoxO1 in M-CSF- and GM-CSF-differentiated macrophages contributes LPS-mediated IL-10: implication in hyperglycemia Article Snippet: A 1.2 kb of mIL-10 was amplified by PCR from the genomic DNA isolated from the mBMDM by use of the primer pair 5-CCGCTCGAGAGCAGTGTGTCCACACCTAAAACATC-3 (restriction site Xho I) and 5-CCCAAGCTTCAGCTGTTCTATGTACAGAGGCCCTC-3 (restriction site Hin dIII). .. The amplified product was purified by use of the PCR Clean-Up kit (Qiagen), digested with Xho I and Hin dIII, and ligated in pGL3 basic vector (Promega) by use of the Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated ( Transformation Assay:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated ( Electroporation:Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 Article Snippet: The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs). .. After ligation of the digested vector and PCR product using an Amplification:Article Title: Distinct role of FoxO1 in M-CSF- and GM-CSF-differentiated macrophages contributes LPS-mediated IL-10: implication in hyperglycemia Article Snippet: A 1.2 kb of mIL-10 was amplified by PCR from the genomic DNA isolated from the mBMDM by use of the primer pair 5-CCGCTCGAGAGCAGTGTGTCCACACCTAAAACATC-3 (restriction site Xho I) and 5-CCCAAGCTTCAGCTGTTCTATGTACAGAGGCCCTC-3 (restriction site Hin dIII). .. The amplified product was purified by use of the PCR Clean-Up kit (Qiagen), digested with Xho I and Hin dIII, and ligated in pGL3 basic vector (Promega) by use of the Purification:Article Title: Distinct role of FoxO1 in M-CSF- and GM-CSF-differentiated macrophages contributes LPS-mediated IL-10: implication in hyperglycemia Article Snippet: A 1.2 kb of mIL-10 was amplified by PCR from the genomic DNA isolated from the mBMDM by use of the primer pair 5-CCGCTCGAGAGCAGTGTGTCCACACCTAAAACATC-3 (restriction site Xho I) and 5-CCCAAGCTTCAGCTGTTCTATGTACAGAGGCCCTC-3 (restriction site Hin dIII). .. The amplified product was purified by use of the PCR Clean-Up kit (Qiagen), digested with Xho I and Hin dIII, and ligated in pGL3 basic vector (Promega) by use of the Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated ( Expressing:Article Title: Variant proteins stimulate more IgM+ GC B-cells revealing a mechanism of cross-reactive recognition by antibody memory Article Snippet: Briefly, second round PCRs of in-frame VH and VK sequences were repeated with V-gene specific primers that included a restriction site for sub cloning ( ). .. These PCR products were purified (Qiagen), restriction digested, purified (Qiagen) and ligated ( |