instant sticky end ligase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Instant Sticky end Ligase Master Mix
    Description:
    Instant Sticky end Ligase Master Mix 250 rxns
    Catalog Number:
    m0370l
    Price:
    384
    Size:
    250 rxns
    Category:
    DNA Ligases
    Buy from Supplier


    Structured Review

    New England Biolabs instant sticky end ligase
    Instant Sticky end Ligase Master Mix
    Instant Sticky end Ligase Master Mix 250 rxns
    https://www.bioz.com/result/instant sticky end ligase/product/New England Biolabs
    Average 99 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    instant sticky end ligase - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. A homologous direct repair (HDR) donor plasmid was prepared in order to introduce a puromycin cassette to repair the DNA double-strand break generated by Cas9 nuclease in RARα exon 7.

    Ligation:

    Article Title: RNA promotes the formation of spatial compartments in the nucleus
    Article Snippet: .. Ligation was performed as previously described using Instant Sticky End Mastermix (NEB) except that all ligations were supplemented with 1:40 RNAse inhibitor (ThermoFisher Ribolock or NEB Murine RNase Inhibitor) to prevent RNA degradation. .. Because T4 DNA Ligase only ligates to double-stranded DNA, the unique DPM sequence enables accurate identification of DNA molecules after sequencing.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: .. Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Ligation mix (1 µL) was added to 100 µL of just-thawed JM109 cells and the transformation procedure carried out according to the manufacturer’s instructions, and transformants grown overnight at 37 °C on LB ampicillin (0.1 mg/mL) agar.

    Article Title: A single-cell method to map higher-order 3D genome organization in thousands of individual cells reveals structural heterogeneity in mouse ES cells
    Article Snippet: .. Each well was then supplemented with 6.4 µL of ligation mix (220 µL of 2X Instant Sticky Master Mix (NEB, #M0370, Ispwich, MA), 352 µL 5X Quick Ligase Buffer (NEB, #B6058S, Ispwich, MA), and 132 µL 1,2-Propanediol (Sigma, #398039, St. Louis, MO)). .. The 96-well plate was sealed after loading ligation mix and was mixed on an Eppendorf ThermoMixer C at 20°C.

    Purification:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB). .. Ligation products were transformed into E. coli , plated on selective LB Agar.

    Article Title: MITF reprograms the extracellular matrix and focal adhesion in melanoma
    Article Snippet: .. Following this, the annealed primers and purified digested vector were ligated at a 15:1 insert to backbone molar ratio using Instant Sticky-end Ligase Master Mix (M0370S, NEB). .. A non-targeting control (miR-NTC) was used as a negative control.

    Polymerase Chain Reaction:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. The sequence of each construct was confirmed by DNA sequencing at the University of Pittsburgh Genomics and Proteomics Core Laboratories.

    Article Title: Identification and Structural Analysis of an l-Asparaginase Enzyme from Guinea Pig with Putative Tumor Cell Killing Properties *
    Article Snippet: .. The PCR product was digested with NdeI and BamHI-HF, gel-purified, and ultimately ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO ( s mall u biquitin mo difier) Smt3p tag of 101 residues) using Instant Sticky End DNA ligase (New England Biolabs). .. The ligation mixture was transformed into XL1 blue DH5α E. coli cells.

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB). .. Ligation products were transformed into E. coli , plated on selective LB Agar.

    Transformation Assay:

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. The sequence of each construct was confirmed by DNA sequencing at the University of Pittsburgh Genomics and Proteomics Core Laboratories.

    Article Title: RNA interference in the cat flea, Ctenocephalides felis: Approaches for sustained gene knockdown and evidence of involvement of Dicer-2 and Argonaute2
    Article Snippet: .. Insert (GSTσ or Dicer-2 ) and pL4440 DNA were ligated together by incubating 4 µL of digested insert DNA (≈400 ng) with 1 µL of digested pL4440 (≈80 ng) and 5 µL of Instant sticky-end ligase master mix (New England Biolabs, USA) at room temperature for 5 min. Ligation mixes were then chilled on ice for ≈15 min before transformation into E. coli JM109 (Promega). .. Ligation mix (1 µL) was added to 100 µL of just-thawed JM109 cells and the transformation procedure carried out according to the manufacturer’s instructions, and transformants grown overnight at 37 °C on LB ampicillin (0.1 mg/mL) agar.

    Plasmid Preparation:

    Article Title: A Bioluminescence Reporter Assay for Retinoic Acid Control of Translation of the GluR1 Subunit of the AMPA Glutamate Receptor
    Article Snippet: .. Oligonucleotides CACGCGGTACACGCCCGAGC and GCTCGGGCGTGTACCGCGTG were annealed in CutSmart® Buffer (NEB) and cloned into the BbsI cut pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene 42,230) using Instant Sticky-end Ligase Master Mix (NEB) to produce pTK3. .. A homologous direct repair (HDR) donor plasmid was prepared in order to introduce a puromycin cassette to repair the DNA double-strand break generated by Cas9 nuclease in RARα exon 7.

    Article Title: Proteolytic Processing and Activation of Clostridium perfringens Epsilon Toxin by Caprine Small Intestinal Contents
    Article Snippet: .. The PCR products and vector pMAL-c2x (New England Biolabs) were digested with EcoRI and BamHI (New England Biolabs), the PCR products were ligated into pMAL-c2x using Instant Sticky-end master mix (New England Biolabs), and the plasmids were transformed into Escherichia coli chi1776 (ATCC) in a manner that met E. coli 2 (EK2) plasmid system standards for biological containment. .. The sequence of each construct was confirmed by DNA sequencing at the University of Pittsburgh Genomics and Proteomics Core Laboratories.

    Article Title: Identification and Structural Analysis of an l-Asparaginase Enzyme from Guinea Pig with Putative Tumor Cell Killing Properties *
    Article Snippet: .. The PCR product was digested with NdeI and BamHI-HF, gel-purified, and ultimately ligated into a His6 -SUMO-pET14b vector (where the His6 tag is followed by the yeast protein SUMO ( s mall u biquitin mo difier) Smt3p tag of 101 residues) using Instant Sticky End DNA ligase (New England Biolabs). .. The ligation mixture was transformed into XL1 blue DH5α E. coli cells.

    Article Title: MITF reprograms the extracellular matrix and focal adhesion in melanoma
    Article Snippet: .. Following this, the annealed primers and purified digested vector were ligated at a 15:1 insert to backbone molar ratio using Instant Sticky-end Ligase Master Mix (M0370S, NEB). .. A non-targeting control (miR-NTC) was used as a negative control.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs instant sticky end ligase
    Instant Sticky End Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/instant sticky end ligase/product/New England Biolabs
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    instant sticky end ligase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results