longamp  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    LongAmp Taq DNA Polymerase
    Description:
    LongAmp Taq DNA Polymerase 2 500 units
    Catalog Number:
    m0323l
    Price:
    342
    Size:
    2 500 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs longamp
    LongAmp Taq DNA Polymerase
    LongAmp Taq DNA Polymerase 2 500 units
    https://www.bioz.com/result/longamp/product/New England Biolabs
    Average 95 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    longamp - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Identification of on-target mutagenesis during correction of a beta-thalassemia splice mutation in iPS cells with optimised CRISPR/Cas9-double nickase reveals potential safety concerns
    Article Snippet: .. PCR reactions were performed using the following: (1) Phusion high-fidelity DNA polymerase (New England Biolabs) for sequencing of the HBB locus; (2) Herculase II fusion polymerase (Agilent Technologies) for sequencing of the targeted clones, HMA, and for the Surveyor assay (Surveyor Mutation Detection Kits); and (3) LongAmp Taq DNA polymerase (New England Biolabs) for the PCR-based screening for the targeted integration of the selection cassette and for screening of the reintegration of the selection cassette. .. Touchdown PCR was mostly used to amplify the specified locus (25–30 cycles) using cycling parameters and protocols specified by each manufacturer (depending on the Taq polymerase used).

    Article Title: Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange
    Article Snippet: For sequencing of the entire H2-K locus, fragments of ~8 kb in size were PCR-amplified from the genome with primers p37 and p38 using LongAmp Taq DNA polymerase (NEB). .. Gibson cloning was used to clone these fragments into pUC19 storage plasmids (amplified with p39 and p40), and Sanger sequenced performed using primers p41, p42, p43, p44, p45 and p46.

    Article Title: Haemonchus contortus P-Glycoproteins Interact with Host Eosinophil Granules: A Novel Insight into the Role of ABC Transporters in Host-Parasite Interaction
    Article Snippet: 3′ RACE experiments were carried out in a final volume of 25 µl containing 15 ng of first-strand cDNA, 0.5 units of LongAmp™ Taq polymerase (New England Biolabs, Ipswich, United Kingdom), 200 µM of each dNTP and 0.4 µM of each primer. .. A final extension step was performed at 72°C for 7 min. Amplification products were cloned in PGEM-T vector (Promega, charbonnieres, France) and sequenced by GATC biotech (Konstanz, Germany).

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ).

    Amplification:

    Article Title: Identification of on-target mutagenesis during correction of a beta-thalassemia splice mutation in iPS cells with optimised CRISPR/Cas9-double nickase reveals potential safety concerns
    Article Snippet: Paragraph title: PCR amplification and sequence verification ... PCR reactions were performed using the following: (1) Phusion high-fidelity DNA polymerase (New England Biolabs) for sequencing of the HBB locus; (2) Herculase II fusion polymerase (Agilent Technologies) for sequencing of the targeted clones, HMA, and for the Surveyor assay (Surveyor Mutation Detection Kits); and (3) LongAmp Taq DNA polymerase (New England Biolabs) for the PCR-based screening for the targeted integration of the selection cassette and for screening of the reintegration of the selection cassette.

    Article Title: Introduction of Large Sequence Inserts by CRISPR-Cas9 To Create Pathogenicity Mutants in the Multinucleate Filamentous Pathogen Sclerotinia sclerotiorum
    Article Snippet: .. LongAmp Taq DNA polymerase (NEB) was used for PCR amplification across insertion sites in ascospore progeny. .. To characterize the hph cassette deletion, three different pairs of primers were used to test amplification of the entire hph cassette from promoter to terminator (Hyg-P-F and Hyg-T-R), the promoter and coding sequence (Hyg-P-F and Hyg-C-R), and only the hph coding sequence (Hyg-C-F and Hyg-C-R).

    Article Title: Breaking the speed limit with multimode fast scanning of DNA by Endonuclease V
    Article Snippet: This DNA substrate was prepared by PCR amplification of λ-DNA using primers modified with 5′ biotin (5′-bio-ACTTCGCCTTCTTCCCATTT-3′) and 5′ digoxigenin (5′-dig-ATCTCGCTTTCCACTCCAGA-3′) (Eurofins MWG/Operon). .. The PCR reaction was performed in a 1× LongAmp Taq Reaction Buffer, with a final volume of 50 μl, 300 µM of each dNTP, 0.4 µM of each primer, 2 units LongAmp Taq DNA polymerase (New England Biolabs) and 0.1 ng µl−1 of λ-DNA template.

    Article Title: Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange
    Article Snippet: For sequencing of the entire H2-K locus, fragments of ~8 kb in size were PCR-amplified from the genome with primers p37 and p38 using LongAmp Taq DNA polymerase (NEB). .. Gibson cloning was used to clone these fragments into pUC19 storage plasmids (amplified with p39 and p40), and Sanger sequenced performed using primers p41, p42, p43, p44, p45 and p46.

    Article Title: Haemonchus contortus P-Glycoproteins Interact with Host Eosinophil Granules: A Novel Insight into the Role of ABC Transporters in Host-Parasite Interaction
    Article Snippet: 3′ RACE experiments were carried out in a final volume of 25 µl containing 15 ng of first-strand cDNA, 0.5 units of LongAmp™ Taq polymerase (New England Biolabs, Ipswich, United Kingdom), 200 µM of each dNTP and 0.4 µM of each primer. .. The reaction mixture was denatured by heating to 94°C for 30 sec, followed by 32 cycles at 94°C for 30 sec, 54–60°C (depending on specific melting temperature of primers) for 30 sec, 72°C for 30–240 sec (depending on the amplicon size).

    Article Title: Rapid Identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) Using Ribosomal RNA Internal Transcribed Spacer 1
    Article Snippet: Amplification reactions containing the lowest ratios of H. armigera (i.e., 1:19 and 1:24 H. armigera: H. zea ) produced the best results with the ready-to use 2X master mix (e.g., KAPA Biosystems). .. LongAmp Taq polymerase and reaction buffer with 2.5 mM MgCl2 (New England Biolabs) produced dissociation curves with lower intensity than ready-to-use master mixes but sufficient to detect H. armigera in 1:24 ratio of H. armigera : H. zea tissue lysate ( a and b).

    Article Title: Palindromic sequence-targeted (PST) PCR: a rapid and efficient method for high-throughput gene characterization and genome walking
    Article Snippet: Example protocol for first-round PCR The first-round PCR was performed in a 30-µL reaction mixture consisting of 30 ng template DNA, 1X LongAmp Taq reaction buffer, and 1 U LongAmp Taq DNA Polymerase (NEB). .. The first round used the following thermal profile: initial denaturation (95 °C for 2 min), then 18 cycles of linear amplification (95 °C for 15 s, 68 °C for 10 s, 72 °C for 60 s), then 18 cycles of exponential amplification (95 °C for 15 s, 52 or 55 °C for 10 s, 72 °C for 60 s. The final extension step was at 72 °C for 2 min.

    Article Title: Polymyxin Susceptibility in Pseudomonas aeruginosa Linked to the MexXY-OprM Multidrug Efflux System
    Article Snippet: For the Δ cbrA deletion, the upstream and downstream fragments were amplified using the primers cbrA Up-F (5′-CGAT GAATTC GCGCTACGGCTTCGAATGG-3′; the EcoRI site is underlined) and cbrA Up-R (5′-CGAT GGATCC CTGGGTCAGGCTAAAGCTCG-3′; the BamHI site is underlined) and the primers cbrA Down-F (5′-CTAG GGATCC CAGATAACCATCGAGAGCCCG-3′; the BamHI site is underlined) and cbrA Down-F (5′-CGAT AAGCTT GCTTCAGCGAGATCACATGC-3′; the HindIII site is underlined), respectively. .. For colony PCR, the primers cbrA colony-F (5′-TCCTGGTCGTGGGCATCTAT-3′) and cbrA colony-R (5′-TTCTCCTGGCGGTCCTTGA-3′) and LongAmp Taq polymerase (New England BioLabs; 1 U) were used in a buffer containing 300 μM concentrations of each dNTP and 0.4 μM concentrations of each primer, with samples heated as described above for the Δ parR deletion except for an extension time of 3.5 min at 75°C.

    Article Title: 5-HTTLPR Expression Outside the Skin: An Experimental Test of the Emotional Reactivity Hypothesis in Children
    Article Snippet: The region of interest from the 5-HTT gene was amplified by PCR using the following primers: a FAM-labelled primer 5’-TCCTCCGCTTTGGCGCCTCTTCC-3’, and a reverse primer 5’-TGGGGGTTGCAGGGGAGATCCTG-3’. .. PCR was carried out in the presence of 5% DMSO, 5x buffer supplied with the enzyme and with 1.25U of LongAmp Taq DNA Polymerase (NEB) in a total volume of 30 μl using the following cycling conditions: initial denaturation step of 10 min at 95° C, followed by 26 cycles of 30 sec 95° C, 30 sec 69° C, 60 sec 65° C and a final extension step of 10 min 65° C. After PCR 10 μl of the sample is subjected to restriction digestion with the enzyme HpaII in a total volume of 20 μl.

    Article Title: Public antibodies to malaria antigens generated by two LAIR1insertion modalities
    Article Snippet: Switch region PCRs on memory B cell gDNA were performed using LongAmp Taq Polymerase (New England Biolabs) in 50 µl reaction volumes with incubation for 3 min at 95°C, followed by 30 cycles of 95°C for 40 s, 60°C for 30 s, 65°C for 3 min and a final extension for 10 min at 65°C. .. IgG-switched B cell DNA was amplified using S-γ-REV (cctgcctcccagtgtcctgcattacttctg) , which binds 3’ of switch-γ-regions, or CH2-γ-REV1, which binds in the IgG-CH2 constant region, to allow amplification of alleles carrying a CH1 deletion.

    Article Title: MicroRNAs-103/107 coordinately regulate macropinocytosis and autophagy
    Article Snippet: .. Luciferase reporter assay The 3′ UTRs of targets, which were predicted by TargetScan, were amplified by PCR using human genomic DNA as a template and a LongAmp Taq DNA Polymerase (New England BioLabs, Inc.). .. PCR products were digested with XhoI (or AsiSI) and NotI, gel purified, and ligated into the psiCHECK-2 vector (Promega).

    Article Title: Nucleotide-resolution analysis of structural variants using BreakSeq and a breakpoint library
    Article Snippet: .. Some of the reactions that failed with the SequalPrep enzyme were amplified with the LongAmp Taq DNA Polymerase (NEB, Frankfurt am Main, Germany) or the iProof High Fidelity DNA Polymerase (Biorad). .. PCR products were analyzed on a 1% agarose gel stained with Sybr Safe Dye (Invitrogen).

    Reporter Assay:

    Article Title: MicroRNAs-103/107 coordinately regulate macropinocytosis and autophagy
    Article Snippet: .. Luciferase reporter assay The 3′ UTRs of targets, which were predicted by TargetScan, were amplified by PCR using human genomic DNA as a template and a LongAmp Taq DNA Polymerase (New England BioLabs, Inc.). .. PCR products were digested with XhoI (or AsiSI) and NotI, gel purified, and ligated into the psiCHECK-2 vector (Promega).

    Positive Control:

    Article Title: Introduction of Large Sequence Inserts by CRISPR-Cas9 To Create Pathogenicity Mutants in the Multinucleate Filamentous Pathogen Sclerotinia sclerotiorum
    Article Snippet: LongAmp Taq DNA polymerase (NEB) was used for PCR amplification across insertion sites in ascospore progeny. .. Primers Pycf and PycR designed to amplify Sspyc1 (GenBank accession no. ) were used as a positive control to verify PCR amplification template quality.

    Quantitative RT-PCR:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ). .. The phenotype of this strain was confirmed by abrB quantitative reverse transcriptase PCR (qRT-PCR) analysis, as described below.

    Incubation:

    Article Title: Public antibodies to malaria antigens generated by two LAIR1insertion modalities
    Article Snippet: .. Switch region PCRs on memory B cell gDNA were performed using LongAmp Taq Polymerase (New England Biolabs) in 50 µl reaction volumes with incubation for 3 min at 95°C, followed by 30 cycles of 95°C for 40 s, 60°C for 30 s, 65°C for 3 min and a final extension for 10 min at 65°C. ..

    Luciferase:

    Article Title: MicroRNAs-103/107 coordinately regulate macropinocytosis and autophagy
    Article Snippet: .. Luciferase reporter assay The 3′ UTRs of targets, which were predicted by TargetScan, were amplified by PCR using human genomic DNA as a template and a LongAmp Taq DNA Polymerase (New England BioLabs, Inc.). .. PCR products were digested with XhoI (or AsiSI) and NotI, gel purified, and ligated into the psiCHECK-2 vector (Promega).

    Touchdown PCR:

    Article Title: Identification of on-target mutagenesis during correction of a beta-thalassemia splice mutation in iPS cells with optimised CRISPR/Cas9-double nickase reveals potential safety concerns
    Article Snippet: PCR reactions were performed using the following: (1) Phusion high-fidelity DNA polymerase (New England Biolabs) for sequencing of the HBB locus; (2) Herculase II fusion polymerase (Agilent Technologies) for sequencing of the targeted clones, HMA, and for the Surveyor assay (Surveyor Mutation Detection Kits); and (3) LongAmp Taq DNA polymerase (New England Biolabs) for the PCR-based screening for the targeted integration of the selection cassette and for screening of the reintegration of the selection cassette. .. Touchdown PCR was mostly used to amplify the specified locus (25–30 cycles) using cycling parameters and protocols specified by each manufacturer (depending on the Taq polymerase used).

    Modification:

    Article Title: Breaking the speed limit with multimode fast scanning of DNA by Endonuclease V
    Article Snippet: This DNA substrate was prepared by PCR amplification of λ-DNA using primers modified with 5′ biotin (5′-bio-ACTTCGCCTTCTTCCCATTT-3′) and 5′ digoxigenin (5′-dig-ATCTCGCTTTCCACTCCAGA-3′) (Eurofins MWG/Operon). .. The PCR reaction was performed in a 1× LongAmp Taq Reaction Buffer, with a final volume of 50 μl, 300 µM of each dNTP, 0.4 µM of each primer, 2 units LongAmp Taq DNA polymerase (New England Biolabs) and 0.1 ng µl−1 of λ-DNA template.

    Transformation Assay:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol.

    Electroporation:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol.

    Ligation:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ). .. After ligation of the digested vector and PCR product using an instant sticky-end ligase master mix (New England BioLabs), the vector was directly transformed into wild-type strain SM101 by electroporation, and the AbrB-overexpressing strain, named SM101(pJIR750-abrB), was then selected on BHI agar plates containing 15 mg/liter of chloramphenicol.

    Polymerase Chain Reaction:

    Article Title: Identification of on-target mutagenesis during correction of a beta-thalassemia splice mutation in iPS cells with optimised CRISPR/Cas9-double nickase reveals potential safety concerns
    Article Snippet: .. PCR reactions were performed using the following: (1) Phusion high-fidelity DNA polymerase (New England Biolabs) for sequencing of the HBB locus; (2) Herculase II fusion polymerase (Agilent Technologies) for sequencing of the targeted clones, HMA, and for the Surveyor assay (Surveyor Mutation Detection Kits); and (3) LongAmp Taq DNA polymerase (New England Biolabs) for the PCR-based screening for the targeted integration of the selection cassette and for screening of the reintegration of the selection cassette. .. Touchdown PCR was mostly used to amplify the specified locus (25–30 cycles) using cycling parameters and protocols specified by each manufacturer (depending on the Taq polymerase used).

    Article Title: Introduction of Large Sequence Inserts by CRISPR-Cas9 To Create Pathogenicity Mutants in the Multinucleate Filamentous Pathogen Sclerotinia sclerotiorum
    Article Snippet: .. LongAmp Taq DNA polymerase (NEB) was used for PCR amplification across insertion sites in ascospore progeny. .. To characterize the hph cassette deletion, three different pairs of primers were used to test amplification of the entire hph cassette from promoter to terminator (Hyg-P-F and Hyg-T-R), the promoter and coding sequence (Hyg-P-F and Hyg-C-R), and only the hph coding sequence (Hyg-C-F and Hyg-C-R).

    Article Title: Single Molecule PCR Reveals Similar Patterns of Non-Homologous DSB Repair in Tobacco and Arabidopsis
    Article Snippet: .. Single molecule PCR was performed using LongAmp taq DNA polymerase and HincII digested DNA as template. ..

    Article Title: Breaking the speed limit with multimode fast scanning of DNA by Endonuclease V
    Article Snippet: .. The PCR reaction was performed in a 1× LongAmp Taq Reaction Buffer, with a final volume of 50 μl, 300 µM of each dNTP, 0.4 µM of each primer, 2 units LongAmp Taq DNA polymerase (New England Biolabs) and 0.1 ng µl−1 of λ-DNA template. .. The PCR included an initial denaturation step at 94 °C for 3 min, 35 cycles of denaturation (94 °C for 15 s), annealing (60 °C for 60 s) and primer extension (65 °C for 16 min), followed by a final extension step at 65 °C for 10 min.

    Article Title: Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange
    Article Snippet: .. For sequencing of the entire H2-K locus, fragments of ~8 kb in size were PCR-amplified from the genome with primers p37 and p38 using LongAmp Taq DNA polymerase (NEB). ..

    Article Title: Haemonchus contortus P-Glycoproteins Interact with Host Eosinophil Granules: A Novel Insight into the Role of ABC Transporters in Host-Parasite Interaction
    Article Snippet: All PCR reactions were performed with a programmable thermocycler (Biometra, Gottingen, Germany). .. 3′ RACE experiments were carried out in a final volume of 25 µl containing 15 ng of first-strand cDNA, 0.5 units of LongAmp™ Taq polymerase (New England Biolabs, Ipswich, United Kingdom), 200 µM of each dNTP and 0.4 µM of each primer.

    Article Title: Palindromic sequence-targeted (PST) PCR: a rapid and efficient method for high-throughput gene characterization and genome walking
    Article Snippet: .. Example protocol for first-round PCR The first-round PCR was performed in a 30-µL reaction mixture consisting of 30 ng template DNA, 1X LongAmp Taq reaction buffer, and 1 U LongAmp Taq DNA Polymerase (NEB). ..

    Article Title: Polymyxin Susceptibility in Pseudomonas aeruginosa Linked to the MexXY-OprM Multidrug Efflux System
    Article Snippet: .. For colony PCR, the primers cbrA colony-F (5′-TCCTGGTCGTGGGCATCTAT-3′) and cbrA colony-R (5′-TTCTCCTGGCGGTCCTTGA-3′) and LongAmp Taq polymerase (New England BioLabs; 1 U) were used in a buffer containing 300 μM concentrations of each dNTP and 0.4 μM concentrations of each primer, with samples heated as described above for the Δ parR deletion except for an extension time of 3.5 min at 75°C. .. For the ΔPA2572 deletion, the upstream and downstream fragments were amplified using the primers PA2572Up-F (5′-CGAT GAATTC CGACGCGGGAGAAGTTCTTC-3′; the EcoRI site is underlined) and PA2572Up-R (5′-GATC GGATCC GTTCATGAGTGTCTGTCCACC-3′; the BamHI site is underlined) and the primers PA2572Down-F (5′-GATC GGATCC GAAGCGATCGAAGGCGCAC-3′; the BamHI site is underlined) and PA2572Down-R (5′-CGAT TCTAGA CGCTGCGCAAACTGGTCTC-3′; the XbaI site is underlined).

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: .. PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ). .. The resultant 1,130-bp, gel-purified PCR product and the pJIR750 vector ( ) ( ) were each then cut with EcoRI/PstI at 37°C for 1 h, according to the manufacturer's instructions (New England BioLabs).

    Article Title: 5-HTTLPR Expression Outside the Skin: An Experimental Test of the Emotional Reactivity Hypothesis in Children
    Article Snippet: .. PCR was carried out in the presence of 5% DMSO, 5x buffer supplied with the enzyme and with 1.25U of LongAmp Taq DNA Polymerase (NEB) in a total volume of 30 μl using the following cycling conditions: initial denaturation step of 10 min at 95° C, followed by 26 cycles of 30 sec 95° C, 30 sec 69° C, 60 sec 65° C and a final extension step of 10 min 65° C. After PCR 10 μl of the sample is subjected to restriction digestion with the enzyme HpaII in a total volume of 20 μl. .. One microliter of PCR product before and after restriction was mixed separately with 0.3 μl LIZ-500 size standard (Applied Biosystems) and 11.7 μl formamide (Applied Biosystems) and run on an AB 3730 genetic analyser set up for fragment analyses with 50 cm capillaries.

    Article Title: Public antibodies to malaria antigens generated by two LAIR1insertion modalities
    Article Snippet: Paragraph title: Switch region PCR and Illumina sequencing ... Switch region PCRs on memory B cell gDNA were performed using LongAmp Taq Polymerase (New England Biolabs) in 50 µl reaction volumes with incubation for 3 min at 95°C, followed by 30 cycles of 95°C for 40 s, 60°C for 30 s, 65°C for 3 min and a final extension for 10 min at 65°C.

    Article Title: MicroRNAs-103/107 coordinately regulate macropinocytosis and autophagy
    Article Snippet: .. Luciferase reporter assay The 3′ UTRs of targets, which were predicted by TargetScan, were amplified by PCR using human genomic DNA as a template and a LongAmp Taq DNA Polymerase (New England BioLabs, Inc.). .. PCR products were digested with XhoI (or AsiSI) and NotI, gel purified, and ligated into the psiCHECK-2 vector (Promega).

    Article Title: Nucleotide-resolution analysis of structural variants using BreakSeq and a breakpoint library
    Article Snippet: Paragraph title: PCR Validation ... Some of the reactions that failed with the SequalPrep enzyme were amplified with the LongAmp Taq DNA Polymerase (NEB, Frankfurt am Main, Germany) or the iProof High Fidelity DNA Polymerase (Biorad).

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: .. Materials Spore suspension (Basic Protocol ) Primers (5 µM each, forward and reverse; experiment specific) LongAmp Taq DNA polymerase with 5× reaction buffer (New England Biolabs; M0323) dNTP mix (5 mM of each dNTP) Sterile, molecular‐grade water For agarose gel electrophoresis (also see Current Protocols article: Voytas, ): 6× DNA loading dye 1× TAE buffer (see recipe) Ethidium bromide or other DNA gel stain 0.2‐ml PCR tubes, 0.2‐ml/well 96‐well PCR plates, or 150 µl/well 384 well PCR plates with tight (preferably aluminum) seals Thermal cycler Centrifuge UV transilluminator Additional reagents and equipment for agarose gel electrophoresis (see Current Protocols article: Voytas, ) .. 1 Transfer 30 µl of previously prepared spore suspension (see Basic Protocol ) to 0.2‐ml PCR tubes or PCR plates and seal tightly (preferably using aluminum seals).

    DNA Extraction:

    Article Title: Rapid Identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) Using Ribosomal RNA Internal Transcribed Spacer 1
    Article Snippet: Paragraph title: Evaluation of Detection Limits and DNA Isolation Methods ... LongAmp Taq polymerase and reaction buffer with 2.5 mM MgCl2 (New England Biolabs) produced dissociation curves with lower intensity than ready-to-use master mixes but sufficient to detect H. armigera in 1:24 ratio of H. armigera : H. zea tissue lysate ( a and b).

    Mutagenesis:

    Article Title: Identification of on-target mutagenesis during correction of a beta-thalassemia splice mutation in iPS cells with optimised CRISPR/Cas9-double nickase reveals potential safety concerns
    Article Snippet: .. PCR reactions were performed using the following: (1) Phusion high-fidelity DNA polymerase (New England Biolabs) for sequencing of the HBB locus; (2) Herculase II fusion polymerase (Agilent Technologies) for sequencing of the targeted clones, HMA, and for the Surveyor assay (Surveyor Mutation Detection Kits); and (3) LongAmp Taq DNA polymerase (New England Biolabs) for the PCR-based screening for the targeted integration of the selection cassette and for screening of the reintegration of the selection cassette. .. Touchdown PCR was mostly used to amplify the specified locus (25–30 cycles) using cycling parameters and protocols specified by each manufacturer (depending on the Taq polymerase used).

    Isolation:

    Article Title: Haemonchus contortus P-Glycoproteins Interact with Host Eosinophil Granules: A Novel Insight into the Role of ABC Transporters in Host-Parasite Interaction
    Article Snippet: Using first strand cDNA prepared from adult H. contortus , the 3′ ends of Pgp cDNAs were isolated by 3′RACE PCR using the GeneRacer kit (Invitrogen, Carlsbad, California, USA) according to the manufacturer's recommendations. .. 3′ RACE experiments were carried out in a final volume of 25 µl containing 15 ng of first-strand cDNA, 0.5 units of LongAmp™ Taq polymerase (New England Biolabs, Ipswich, United Kingdom), 200 µM of each dNTP and 0.4 µM of each primer.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Briefly, DNA was isolated from wild-type strain SM101 using a MasterPure Gram-positive bacterial DNA purification kit (Epicentre, Madison, WI). .. PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ).

    Article Title: 5-HTTLPR Expression Outside the Skin: An Experimental Test of the Emotional Reactivity Hypothesis in Children
    Article Snippet: Genomic DNA was isolated from the samples using the Chemagic buccal swab kit on a Chemagen Module I workstation (Chemagen Biopolymer-Technologie AG, Baesweiler, Germany). .. PCR was carried out in the presence of 5% DMSO, 5x buffer supplied with the enzyme and with 1.25U of LongAmp Taq DNA Polymerase (NEB) in a total volume of 30 μl using the following cycling conditions: initial denaturation step of 10 min at 95° C, followed by 26 cycles of 30 sec 95° C, 30 sec 69° C, 60 sec 65° C and a final extension step of 10 min 65° C. After PCR 10 μl of the sample is subjected to restriction digestion with the enzyme HpaII in a total volume of 20 μl.

    Size-exclusion Chromatography:

    Article Title: Haemonchus contortus P-Glycoproteins Interact with Host Eosinophil Granules: A Novel Insight into the Role of ABC Transporters in Host-Parasite Interaction
    Article Snippet: 3′ RACE experiments were carried out in a final volume of 25 µl containing 15 ng of first-strand cDNA, 0.5 units of LongAmp™ Taq polymerase (New England Biolabs, Ipswich, United Kingdom), 200 µM of each dNTP and 0.4 µM of each primer. .. The reaction mixture was denatured by heating to 94°C for 30 sec, followed by 32 cycles at 94°C for 30 sec, 54–60°C (depending on specific melting temperature of primers) for 30 sec, 72°C for 30–240 sec (depending on the amplicon size).

    Article Title: 5-HTTLPR Expression Outside the Skin: An Experimental Test of the Emotional Reactivity Hypothesis in Children
    Article Snippet: .. PCR was carried out in the presence of 5% DMSO, 5x buffer supplied with the enzyme and with 1.25U of LongAmp Taq DNA Polymerase (NEB) in a total volume of 30 μl using the following cycling conditions: initial denaturation step of 10 min at 95° C, followed by 26 cycles of 30 sec 95° C, 30 sec 69° C, 60 sec 65° C and a final extension step of 10 min 65° C. After PCR 10 μl of the sample is subjected to restriction digestion with the enzyme HpaII in a total volume of 20 μl. .. One microliter of PCR product before and after restriction was mixed separately with 0.3 μl LIZ-500 size standard (Applied Biosystems) and 11.7 μl formamide (Applied Biosystems) and run on an AB 3730 genetic analyser set up for fragment analyses with 50 cm capillaries.

    Article Title: Nucleotide-resolution analysis of structural variants using BreakSeq and a breakpoint library
    Article Snippet: For the PCR, 10ng of genomic DNA (Coriell Institute, Camden, NJ, USA) were used with the SequalPrep Long PCR Kit (Invitrogen, Karlsruhe, Germany) in 20ul volumes using the following PCR conditions in a C1000 thermocycler (Biorad, Munich, Germany): 94°C for 3 minutes, followed by 10 cycles of 94°C for 10 seconds, 60°C for 30 seconds and 68°C for 10 minutes and 25 cycles of 94°C for 10 seconds, 56°C for 30 seconds and 68°C for 10 minutes (+10 sec/cycle), followed by a final cycle of 72°C for 10 minutes. .. Some of the reactions that failed with the SequalPrep enzyme were amplified with the LongAmp Taq DNA Polymerase (NEB, Frankfurt am Main, Germany) or the iProof High Fidelity DNA Polymerase (Biorad).

    Purification:

    Article Title: MicroRNAs-103/107 coordinately regulate macropinocytosis and autophagy
    Article Snippet: Luciferase reporter assay The 3′ UTRs of targets, which were predicted by TargetScan, were amplified by PCR using human genomic DNA as a template and a LongAmp Taq DNA Polymerase (New England BioLabs, Inc.). .. PCR products were digested with XhoI (or AsiSI) and NotI, gel purified, and ligated into the psiCHECK-2 vector (Promega).

    Sequencing:

    Article Title: Identification of on-target mutagenesis during correction of a beta-thalassemia splice mutation in iPS cells with optimised CRISPR/Cas9-double nickase reveals potential safety concerns
    Article Snippet: .. PCR reactions were performed using the following: (1) Phusion high-fidelity DNA polymerase (New England Biolabs) for sequencing of the HBB locus; (2) Herculase II fusion polymerase (Agilent Technologies) for sequencing of the targeted clones, HMA, and for the Surveyor assay (Surveyor Mutation Detection Kits); and (3) LongAmp Taq DNA polymerase (New England Biolabs) for the PCR-based screening for the targeted integration of the selection cassette and for screening of the reintegration of the selection cassette. .. Touchdown PCR was mostly used to amplify the specified locus (25–30 cycles) using cycling parameters and protocols specified by each manufacturer (depending on the Taq polymerase used).

    Article Title: Introduction of Large Sequence Inserts by CRISPR-Cas9 To Create Pathogenicity Mutants in the Multinucleate Filamentous Pathogen Sclerotinia sclerotiorum
    Article Snippet: LongAmp Taq DNA polymerase (NEB) was used for PCR amplification across insertion sites in ascospore progeny. .. To characterize the hph cassette deletion, three different pairs of primers were used to test amplification of the entire hph cassette from promoter to terminator (Hyg-P-F and Hyg-T-R), the promoter and coding sequence (Hyg-P-F and Hyg-C-R), and only the hph coding sequence (Hyg-C-F and Hyg-C-R).

    Article Title: Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange
    Article Snippet: .. For sequencing of the entire H2-K locus, fragments of ~8 kb in size were PCR-amplified from the genome with primers p37 and p38 using LongAmp Taq DNA polymerase (NEB). ..

    Article Title: Haemonchus contortus P-Glycoproteins Interact with Host Eosinophil Granules: A Novel Insight into the Role of ABC Transporters in Host-Parasite Interaction
    Article Snippet: 3'RACE PCR amplicons were obtained with forward primers designed upon H. contortus supercontig sequences (available at http://www.sanger.ac.uk/cgi-bin/blast/submitblast/h_contortus ) In order to extend sequence in their 5' ends, a new set of PCR experiments was performed using either the SL1 primer ( GGTTTAATTACCCAAGTTTGAG ) or forward primers designed from supercontig sequences. .. 3′ RACE experiments were carried out in a final volume of 25 µl containing 15 ng of first-strand cDNA, 0.5 units of LongAmp™ Taq polymerase (New England Biolabs, Ipswich, United Kingdom), 200 µM of each dNTP and 0.4 µM of each primer.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ).

    Article Title: Public antibodies to malaria antigens generated by two LAIR1insertion modalities
    Article Snippet: Paragraph title: Switch region PCR and Illumina sequencing ... Switch region PCRs on memory B cell gDNA were performed using LongAmp Taq Polymerase (New England Biolabs) in 50 µl reaction volumes with incubation for 3 min at 95°C, followed by 30 cycles of 95°C for 40 s, 60°C for 30 s, 65°C for 3 min and a final extension for 10 min at 65°C.

    Construct:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ).

    FACS:

    Article Title: Public antibodies to malaria antigens generated by two LAIR1insertion modalities
    Article Snippet: Switch region PCR and Illumina sequencing Genomic DNA (gDNA) was isolated from FACS-sorted human naïve (CD19+ CD27- IgM+ ) or memory B cells (CD19+ CD27+ IgG+ /IgA+ ) using a commercial kit (QIAGEN). .. Switch region PCRs on memory B cell gDNA were performed using LongAmp Taq Polymerase (New England Biolabs) in 50 µl reaction volumes with incubation for 3 min at 95°C, followed by 30 cycles of 95°C for 40 s, 60°C for 30 s, 65°C for 3 min and a final extension for 10 min at 65°C.

    Plasmid Preparation:

    Article Title: Introduction of Large Sequence Inserts by CRISPR-Cas9 To Create Pathogenicity Mutants in the Multinucleate Filamentous Pathogen Sclerotinia sclerotiorum
    Article Snippet: For HygB resistance tests, the wild type, the Ssoah1 disruption strains, and the empty vector transformants were grown on PDA medium with 100 mg/liter HygB. .. LongAmp Taq DNA polymerase (NEB) was used for PCR amplification across insertion sites in ascospore progeny.

    Article Title: Haemonchus contortus P-Glycoproteins Interact with Host Eosinophil Granules: A Novel Insight into the Role of ABC Transporters in Host-Parasite Interaction
    Article Snippet: 3′ RACE experiments were carried out in a final volume of 25 µl containing 15 ng of first-strand cDNA, 0.5 units of LongAmp™ Taq polymerase (New England Biolabs, Ipswich, United Kingdom), 200 µM of each dNTP and 0.4 µM of each primer. .. A final extension step was performed at 72°C for 7 min. Amplification products were cloned in PGEM-T vector (Promega, charbonnieres, France) and sequenced by GATC biotech (Konstanz, Germany).

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An AbrB-overexpressing strain was constructed by cloning the abrB ORF, flanked by ∼600 bp of upstream sequence and ∼250 bp of downstream sequence, into the pJIR750 C. perfringens - E. coli shuttle plasmid and then transforming this new plasmid into wild-type strain SM101. .. PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ).

    Article Title: MicroRNAs-103/107 coordinately regulate macropinocytosis and autophagy
    Article Snippet: Luciferase reporter assay The 3′ UTRs of targets, which were predicted by TargetScan, were amplified by PCR using human genomic DNA as a template and a LongAmp Taq DNA Polymerase (New England BioLabs, Inc.). .. PCR products were digested with XhoI (or AsiSI) and NotI, gel purified, and ligated into the psiCHECK-2 vector (Promega).

    Software:

    Article Title: 5-HTTLPR Expression Outside the Skin: An Experimental Test of the Emotional Reactivity Hypothesis in Children
    Article Snippet: PCR was carried out in the presence of 5% DMSO, 5x buffer supplied with the enzyme and with 1.25U of LongAmp Taq DNA Polymerase (NEB) in a total volume of 30 μl using the following cycling conditions: initial denaturation step of 10 min at 95° C, followed by 26 cycles of 30 sec 95° C, 30 sec 69° C, 60 sec 65° C and a final extension step of 10 min 65° C. After PCR 10 μl of the sample is subjected to restriction digestion with the enzyme HpaII in a total volume of 20 μl. .. Results were analysed using GeneMarker software (Softgenetics).

    Selection:

    Article Title: Identification of on-target mutagenesis during correction of a beta-thalassemia splice mutation in iPS cells with optimised CRISPR/Cas9-double nickase reveals potential safety concerns
    Article Snippet: .. PCR reactions were performed using the following: (1) Phusion high-fidelity DNA polymerase (New England Biolabs) for sequencing of the HBB locus; (2) Herculase II fusion polymerase (Agilent Technologies) for sequencing of the targeted clones, HMA, and for the Surveyor assay (Surveyor Mutation Detection Kits); and (3) LongAmp Taq DNA polymerase (New England Biolabs) for the PCR-based screening for the targeted integration of the selection cassette and for screening of the reintegration of the selection cassette. .. Touchdown PCR was mostly used to amplify the specified locus (25–30 cycles) using cycling parameters and protocols specified by each manufacturer (depending on the Taq polymerase used).

    Agarose Gel Electrophoresis:

    Article Title: Nucleotide-resolution analysis of structural variants using BreakSeq and a breakpoint library
    Article Snippet: Some of the reactions that failed with the SequalPrep enzyme were amplified with the LongAmp Taq DNA Polymerase (NEB, Frankfurt am Main, Germany) or the iProof High Fidelity DNA Polymerase (Biorad). .. PCR products were analyzed on a 1% agarose gel stained with Sybr Safe Dye (Invitrogen).

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: .. Materials Spore suspension (Basic Protocol ) Primers (5 µM each, forward and reverse; experiment specific) LongAmp Taq DNA polymerase with 5× reaction buffer (New England Biolabs; M0323) dNTP mix (5 mM of each dNTP) Sterile, molecular‐grade water For agarose gel electrophoresis (also see Current Protocols article: Voytas, ): 6× DNA loading dye 1× TAE buffer (see recipe) Ethidium bromide or other DNA gel stain 0.2‐ml PCR tubes, 0.2‐ml/well 96‐well PCR plates, or 150 µl/well 384 well PCR plates with tight (preferably aluminum) seals Thermal cycler Centrifuge UV transilluminator Additional reagents and equipment for agarose gel electrophoresis (see Current Protocols article: Voytas, ) .. 1 Transfer 30 µl of previously prepared spore suspension (see Basic Protocol ) to 0.2‐ml PCR tubes or PCR plates and seal tightly (preferably using aluminum seals).

    Spectrophotometry:

    Article Title: Haemonchus contortus P-Glycoproteins Interact with Host Eosinophil Granules: A Novel Insight into the Role of ABC Transporters in Host-Parasite Interaction
    Article Snippet: The RNA concentrations were measured using a nanodrop spectrophotometer (Thermo Scientific, Waltham, Massachusetts, USA) and adjusted to 100 ng/µl. .. 3′ RACE experiments were carried out in a final volume of 25 µl containing 15 ng of first-strand cDNA, 0.5 units of LongAmp™ Taq polymerase (New England Biolabs, Ipswich, United Kingdom), 200 µM of each dNTP and 0.4 µM of each primer.

    Produced:

    Article Title: Rapid Identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) Using Ribosomal RNA Internal Transcribed Spacer 1
    Article Snippet: .. LongAmp Taq polymerase and reaction buffer with 2.5 mM MgCl2 (New England Biolabs) produced dissociation curves with lower intensity than ready-to-use master mixes but sufficient to detect H. armigera in 1:24 ratio of H. armigera : H. zea tissue lysate ( a and b). ..

    Concentration Assay:

    Article Title: Rapid Identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) Using Ribosomal RNA Internal Transcribed Spacer 1
    Article Snippet: LongAmp Taq polymerase and reaction buffer with 2.5 mM MgCl2 (New England Biolabs) produced dissociation curves with lower intensity than ready-to-use master mixes but sufficient to detect H. armigera in 1:24 ratio of H. armigera : H. zea tissue lysate ( a and b). .. Although fluorescent signal was much lower (most likely due to low amplification efficiency) in assays with standard Taq polymerase, the DNA concentration could be increased to produce better results either by using less squish buffer volume when homogenizing the samples or increasing the volume of lysate added to the reaction.

    DNA Purification:

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Briefly, DNA was isolated from wild-type strain SM101 using a MasterPure Gram-positive bacterial DNA purification kit (Epicentre, Madison, WI). .. PCR was then performed using LongAmp Taq DNA polymerase (New England BioLabs) and primers abrBcompF and abrBcompR ( ).

    Marker:

    Article Title: Nucleotide-resolution analysis of structural variants using BreakSeq and a breakpoint library
    Article Snippet: Some of the reactions that failed with the SequalPrep enzyme were amplified with the LongAmp Taq DNA Polymerase (NEB, Frankfurt am Main, Germany) or the iProof High Fidelity DNA Polymerase (Biorad). .. Marker M1 was a 100bp ladder whereas M2 corresponded to a 1kb ladder (500, 1000, 1500, 2000, 3000, etc) (NEB).

    Staining:

    Article Title: Nucleotide-resolution analysis of structural variants using BreakSeq and a breakpoint library
    Article Snippet: Some of the reactions that failed with the SequalPrep enzyme were amplified with the LongAmp Taq DNA Polymerase (NEB, Frankfurt am Main, Germany) or the iProof High Fidelity DNA Polymerase (Biorad). .. PCR products were analyzed on a 1% agarose gel stained with Sybr Safe Dye (Invitrogen).

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: .. Materials Spore suspension (Basic Protocol ) Primers (5 µM each, forward and reverse; experiment specific) LongAmp Taq DNA polymerase with 5× reaction buffer (New England Biolabs; M0323) dNTP mix (5 mM of each dNTP) Sterile, molecular‐grade water For agarose gel electrophoresis (also see Current Protocols article: Voytas, ): 6× DNA loading dye 1× TAE buffer (see recipe) Ethidium bromide or other DNA gel stain 0.2‐ml PCR tubes, 0.2‐ml/well 96‐well PCR plates, or 150 µl/well 384 well PCR plates with tight (preferably aluminum) seals Thermal cycler Centrifuge UV transilluminator Additional reagents and equipment for agarose gel electrophoresis (see Current Protocols article: Voytas, ) .. 1 Transfer 30 µl of previously prepared spore suspension (see Basic Protocol ) to 0.2‐ml PCR tubes or PCR plates and seal tightly (preferably using aluminum seals).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs longamp taq dna polymerase
    Thermal shock is crucial for successful PCR amplification from fungal spores. A. fumigatus spores at three different concentrations (8 × 10 8 /ml, 1 × 10 8 /ml, and 5 × 10 7 /ml) were prepared as described in Basic Protocol 1 . 3 µl of spore suspension were used as the <t>DNA</t> template for PCR. ( A ) PCR result from spore suspension subjected to thermal shock of 95°C for 15 min and −80°C for 10 min prior to PCR, as described in Basic Protocol 2 . No thermal shock was done for spore suspensions from Panels B and C . Subsequently, a PCR was run with an initial denaturation step of 95°C for 1 min (A), 5 min (B), or 15 min (C) with primers ITS1 and D2 (expected PCR product ∼1.2 kb) and <t>LongAmp</t> <t>Taq</t> DNA polymerase with PCR conditions described in Basic Protocol 2 . P: positive PCR control amplified from genomic DNA (50 ng) of the A. fumigatus wild‐type strain; N: negative control (no DNA).
    Longamp Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 123 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp taq dna polymerase/product/New England Biolabs
    Average 95 stars, based on 123 article reviews
    Price from $9.99 to $1999.99
    longamp taq dna polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Thermal shock is crucial for successful PCR amplification from fungal spores. A. fumigatus spores at three different concentrations (8 × 10 8 /ml, 1 × 10 8 /ml, and 5 × 10 7 /ml) were prepared as described in Basic Protocol 1 . 3 µl of spore suspension were used as the DNA template for PCR. ( A ) PCR result from spore suspension subjected to thermal shock of 95°C for 15 min and −80°C for 10 min prior to PCR, as described in Basic Protocol 2 . No thermal shock was done for spore suspensions from Panels B and C . Subsequently, a PCR was run with an initial denaturation step of 95°C for 1 min (A), 5 min (B), or 15 min (C) with primers ITS1 and D2 (expected PCR product ∼1.2 kb) and LongAmp Taq DNA polymerase with PCR conditions described in Basic Protocol 2 . P: positive PCR control amplified from genomic DNA (50 ng) of the A. fumigatus wild‐type strain; N: negative control (no DNA).

    Journal: Current Protocols in Microbiology

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction

    doi: 10.1002/cpmc.89

    Figure Lengend Snippet: Thermal shock is crucial for successful PCR amplification from fungal spores. A. fumigatus spores at three different concentrations (8 × 10 8 /ml, 1 × 10 8 /ml, and 5 × 10 7 /ml) were prepared as described in Basic Protocol 1 . 3 µl of spore suspension were used as the DNA template for PCR. ( A ) PCR result from spore suspension subjected to thermal shock of 95°C for 15 min and −80°C for 10 min prior to PCR, as described in Basic Protocol 2 . No thermal shock was done for spore suspensions from Panels B and C . Subsequently, a PCR was run with an initial denaturation step of 95°C for 1 min (A), 5 min (B), or 15 min (C) with primers ITS1 and D2 (expected PCR product ∼1.2 kb) and LongAmp Taq DNA polymerase with PCR conditions described in Basic Protocol 2 . P: positive PCR control amplified from genomic DNA (50 ng) of the A. fumigatus wild‐type strain; N: negative control (no DNA).

    Article Snippet: Materials Spore suspension (Basic Protocol ) Primers (5 µM each, forward and reverse; experiment specific) LongAmp Taq DNA polymerase with 5× reaction buffer (New England Biolabs; M0323) dNTP mix (5 mM of each dNTP) Sterile, molecular‐grade water For agarose gel electrophoresis (also see Current Protocols article: Voytas, ): 6× DNA loading dye 1× TAE buffer (see recipe) Ethidium bromide or other DNA gel stain 0.2‐ml PCR tubes, 0.2‐ml/well 96‐well PCR plates, or 150 µl/well 384 well PCR plates with tight (preferably aluminum) seals Thermal cycler Centrifuge UV transilluminator Additional reagents and equipment for agarose gel electrophoresis (see Current Protocols article: Voytas, )

    Techniques: Polymerase Chain Reaction, Amplification, Negative Control

    Spore PCR using the supernatant from spore suspensions of different filamentous fungi with primers ITS1/D2 (expected PCR band size is ∼1.2 kb) and ITS1/ITS4 (expected PCR band size ∼600 bp). Two different spore concentrations were tested (i.e., 5 × 10 7 /ml and 1 × 10 7 /ml). 1 µl of the supernatant was used in the PCR reaction with the LongAmp Taq DNA polymerase. Positive PCR controls were amplified from DNA (50 ng) of the A. fumigatus wild‐type strain with primers ITS1/D2 (P1) and ITS1/ITS4 (P2). N: negative control (no DNA).

    Journal: Current Protocols in Microbiology

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction

    doi: 10.1002/cpmc.89

    Figure Lengend Snippet: Spore PCR using the supernatant from spore suspensions of different filamentous fungi with primers ITS1/D2 (expected PCR band size is ∼1.2 kb) and ITS1/ITS4 (expected PCR band size ∼600 bp). Two different spore concentrations were tested (i.e., 5 × 10 7 /ml and 1 × 10 7 /ml). 1 µl of the supernatant was used in the PCR reaction with the LongAmp Taq DNA polymerase. Positive PCR controls were amplified from DNA (50 ng) of the A. fumigatus wild‐type strain with primers ITS1/D2 (P1) and ITS1/ITS4 (P2). N: negative control (no DNA).

    Article Snippet: Materials Spore suspension (Basic Protocol ) Primers (5 µM each, forward and reverse; experiment specific) LongAmp Taq DNA polymerase with 5× reaction buffer (New England Biolabs; M0323) dNTP mix (5 mM of each dNTP) Sterile, molecular‐grade water For agarose gel electrophoresis (also see Current Protocols article: Voytas, ): 6× DNA loading dye 1× TAE buffer (see recipe) Ethidium bromide or other DNA gel stain 0.2‐ml PCR tubes, 0.2‐ml/well 96‐well PCR plates, or 150 µl/well 384 well PCR plates with tight (preferably aluminum) seals Thermal cycler Centrifuge UV transilluminator Additional reagents and equipment for agarose gel electrophoresis (see Current Protocols article: Voytas, )

    Techniques: Polymerase Chain Reaction, Amplification, Negative Control

    Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB LongAmp Taq polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.

    Journal: Journal of Insect Science

    Article Title: Rapid Identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) Using Ribosomal RNA Internal Transcribed Spacer 1

    doi: 10.1093/jisesa/iev137

    Figure Lengend Snippet: Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB LongAmp Taq polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.

    Article Snippet: LongAmp Taq polymerase and reaction buffer with 2.5 mM MgCl2 (New England Biolabs) produced dissociation curves with lower intensity than ready-to-use master mixes but sufficient to detect H. armigera in 1:24 ratio of H. armigera : H. zea tissue lysate ( a and b).

    Techniques: Produced, Modification, Amplification