terminal regions  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Terminal Transferase
    Description:
    Terminal Transferase 2 500 units
    Catalog Number:
    M0315L
    Price:
    288
    Category:
    Transferases
    Size:
    2 500 units
    Buy from Supplier


    Structured Review

    New England Biolabs terminal regions
    Terminal Transferase
    Terminal Transferase 2 500 units
    https://www.bioz.com/result/terminal regions/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    terminal regions - by Bioz Stars, 2021-06
    99/100 stars

    Images

    1) Product Images from "Complete Genome Sequences of Two Rat Pegivirus Strains in Indonesia"

    Article Title: Complete Genome Sequences of Two Rat Pegivirus Strains in Indonesia

    Journal: Microbiology Resource Announcements

    doi: 10.1128/MRA.00049-21

    (A) Strategies for determining the complete genome sequences of the two rat pegivirus strains (RPgV-IND079 and RPgV-IND038) obtained in the present study. The light-gray boxes (S1 to S6) with nucleotide positions at both ends below the schematic organization of the rat pegivirus genome indicate the genomic areas amplified using the SISPA method ( 6 ), which includes reverse transcription using a random primer tagged with a known sequence, FR20RV-N6 (5′- GCCGGAGCTCTGCAGATATCNNNNNN -3′) with Superscript III (Thermo Fisher Scientific, Inc.) followed by amplification with Ex Taq polymerase (TaKaRa Bio, Inc., Shiga, Japan) using a primer with the underlined sequence of FR20RV-N6 (FR20RV, 5′- GCCGGAGCTCTGCAGATATC -3′). The dark-gray boxes (RP-1 to RP-5 and RP-1-1 to RP-1-3) with nucleotide positions at both ends depict the genomic areas amplified by nRT-PCR with primers ( Table 1 ) and Ex Taq polymerase following reverse transcription with primers ( Table 1 ) highlighted with triangles and Superscript III. Open boxes (5′RA-1-1, 5′RA-1-2, 5′RA-2, 3′RA-1, and 3′RA-2) with nucleotide positions at both ends indicate the genomic areas amplified by the 5′-RACE and 3′-RACE methods ( 7 , 8 ). (Top) From the IND079 serum, four DNA fragments (S1 to S4) with nucleotide sequences similar to those of a rat pegivirus genome (DDBJ accession number MT085182 ) were obtained using the SISPA method. Using four pairs of primers (one pair for first-round PCR and three pairs for second-round PCR) generated based on the SISPA-derived sequences ( Table 1 ), one DNA fragment (RP-1) and three DNA fragments (RP-1-1 to RP-1-3) were amplified by first-round PCR and second-round PCR, respectively, with Ex Taq polymerase following reverse transcription with Superscript III. The sequences of the 5′- and 3′-terminal regions (5′RA-1-1, 5′RA-1-2, and 3′RA-1) were amplified by the 5′-RACE and 3′-RACE methods with the primers synthesized based on the RP-1-1 or RP-1-3 sequences, respectively. The RP-2 fragment was amplified to confirm the 5′-terminal region sequence (nt 23 to 1355) since it was determined based on two consecutive RACE reactions. (Bottom) From the IND038 serum, two DNA fragments (S5 and S6) with nucleotide sequences similar to those of a rat pegivirus genome ( MT085182 ) were obtained using the SISPA method. Using three pairs of primers ( Table 1 ), three DNA fragments (RP-3 to RP-5) were amplified by nRT-PCR as described above. The 5′-RACE (5′RA-2) and 3′-RACE (3′RA-2) products were amplified with primers ( Table 1 ) generated based on the RPgV-IND079 sequence. In the present study, all amplification products were sequenced two or more times on both strands directly or after cloning into pMD20 T-Vector (TaKaRa Bio, Inc.) (with the bidirectional primer-walking method, when needed) using an Applied Biosystems 3130xl genetic analyzer (Thermo Fisher Scientific, Inc.) with a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific, Inc.). All reads were assembled using the Genetyx software program v13.0.1 (Genetyx Corp., Tokyo, Japan) to determine the complete genome sequences. (B) A phylogenetic tree of the nucleotide sequences of the entire coding region of the two strains (RPgV-IND038 and RPgV-IND079, highlighted with filled circles) obtained in the present study with 28 reported reference isolates of Pegivirus A to K and Pegivirus L proposed by Smith et al. ( 3 ) and Rodrigues et al. ( 4 ), respectively. The tree was constructed using the maximum likelihood method with the MEGA7 software program v7.02.26 ( 11 ) after alignment using the MUSCLE software program v3.5 ( 12 ). Each reference sequence is shown with the accession number, the strain name, and the name of the country. The bootstrap values (≥70%) for the nodes are indicated as a percentage of the data obtained from resampling 1,000 times. The scale bar represents the number of nucleotide substitutions per site. Asterisks indicate that countries where nonhuman primates were captured are not specified.
    Figure Legend Snippet: (A) Strategies for determining the complete genome sequences of the two rat pegivirus strains (RPgV-IND079 and RPgV-IND038) obtained in the present study. The light-gray boxes (S1 to S6) with nucleotide positions at both ends below the schematic organization of the rat pegivirus genome indicate the genomic areas amplified using the SISPA method ( 6 ), which includes reverse transcription using a random primer tagged with a known sequence, FR20RV-N6 (5′- GCCGGAGCTCTGCAGATATCNNNNNN -3′) with Superscript III (Thermo Fisher Scientific, Inc.) followed by amplification with Ex Taq polymerase (TaKaRa Bio, Inc., Shiga, Japan) using a primer with the underlined sequence of FR20RV-N6 (FR20RV, 5′- GCCGGAGCTCTGCAGATATC -3′). The dark-gray boxes (RP-1 to RP-5 and RP-1-1 to RP-1-3) with nucleotide positions at both ends depict the genomic areas amplified by nRT-PCR with primers ( Table 1 ) and Ex Taq polymerase following reverse transcription with primers ( Table 1 ) highlighted with triangles and Superscript III. Open boxes (5′RA-1-1, 5′RA-1-2, 5′RA-2, 3′RA-1, and 3′RA-2) with nucleotide positions at both ends indicate the genomic areas amplified by the 5′-RACE and 3′-RACE methods ( 7 , 8 ). (Top) From the IND079 serum, four DNA fragments (S1 to S4) with nucleotide sequences similar to those of a rat pegivirus genome (DDBJ accession number MT085182 ) were obtained using the SISPA method. Using four pairs of primers (one pair for first-round PCR and three pairs for second-round PCR) generated based on the SISPA-derived sequences ( Table 1 ), one DNA fragment (RP-1) and three DNA fragments (RP-1-1 to RP-1-3) were amplified by first-round PCR and second-round PCR, respectively, with Ex Taq polymerase following reverse transcription with Superscript III. The sequences of the 5′- and 3′-terminal regions (5′RA-1-1, 5′RA-1-2, and 3′RA-1) were amplified by the 5′-RACE and 3′-RACE methods with the primers synthesized based on the RP-1-1 or RP-1-3 sequences, respectively. The RP-2 fragment was amplified to confirm the 5′-terminal region sequence (nt 23 to 1355) since it was determined based on two consecutive RACE reactions. (Bottom) From the IND038 serum, two DNA fragments (S5 and S6) with nucleotide sequences similar to those of a rat pegivirus genome ( MT085182 ) were obtained using the SISPA method. Using three pairs of primers ( Table 1 ), three DNA fragments (RP-3 to RP-5) were amplified by nRT-PCR as described above. The 5′-RACE (5′RA-2) and 3′-RACE (3′RA-2) products were amplified with primers ( Table 1 ) generated based on the RPgV-IND079 sequence. In the present study, all amplification products were sequenced two or more times on both strands directly or after cloning into pMD20 T-Vector (TaKaRa Bio, Inc.) (with the bidirectional primer-walking method, when needed) using an Applied Biosystems 3130xl genetic analyzer (Thermo Fisher Scientific, Inc.) with a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific, Inc.). All reads were assembled using the Genetyx software program v13.0.1 (Genetyx Corp., Tokyo, Japan) to determine the complete genome sequences. (B) A phylogenetic tree of the nucleotide sequences of the entire coding region of the two strains (RPgV-IND038 and RPgV-IND079, highlighted with filled circles) obtained in the present study with 28 reported reference isolates of Pegivirus A to K and Pegivirus L proposed by Smith et al. ( 3 ) and Rodrigues et al. ( 4 ), respectively. The tree was constructed using the maximum likelihood method with the MEGA7 software program v7.02.26 ( 11 ) after alignment using the MUSCLE software program v3.5 ( 12 ). Each reference sequence is shown with the accession number, the strain name, and the name of the country. The bootstrap values (≥70%) for the nodes are indicated as a percentage of the data obtained from resampling 1,000 times. The scale bar represents the number of nucleotide substitutions per site. Asterisks indicate that countries where nonhuman primates were captured are not specified.

    Techniques Used: Amplification, Sequencing, Polymerase Chain Reaction, Generated, Derivative Assay, Synthesized, Clone Assay, Plasmid Preparation, Chromosome Walking, Software, Construct

    Related Articles

    Incubation:

    Article Title: Antibodies targeting hepatoma-derived growth factor as a novel strategy in treating lung cancer
    Article Snippet: The grids with CD31 staining was counted as positive and total positive grids divided by the total grids measured was used to calculate percentage of positive grids for each sample. .. Tissue sections were incubated with TdT reaction buffer containing 0.2 unit/μl terminal transferase (New England Biolabs, Ipswich, MA) and 20 μM biotin-16-dUTP (Roche Applied Science) in a humidify chamber. .. ABC complex (Vector Labs) was used for signal development.

    Article Title: Chromosomal landscape of UV damage formation and repair at single-nucleotide resolution
    Article Snippet: Ligation was performed at 16 °C for 16 h, using NEBNext Quick Ligation Module. .. DNA was purified with AMpure XP beads and subsequently incubated with Terminal Transferase (TdT, New England Biolabs) and dideoxy ATP (Roche) for 2 h at 37 °C to block all free 3′ ends. ..

    Article Title: An Integrated Approach for Analysis of the DNA Damage Response in Mammalian Cells
    Article Snippet: After centrifugation, the pellets were washed with 70% ethanol, resuspended in TE buffer, and then subjected to labeling with terminal deoxynucleotidyl transferase and the nucleotide analog biotin-11-dUTP as described previously with a few modifications ( ). .. Briefly, the extracted DNA was incubated with 20 units of terminal deoxynucleotidyl transferase (New England Biolabs), 10 μ m of biotin-11-dUTP (Biotium, Inc.), and 0.25 m m CoCl2 in 50 μl of 1× Terminal Transferase Reaction Buffer (New England Biolabs) for 30 min at 37 °C. .. The reactions were stopped by addition of 10 m m EDTA, incubated with RNase A (10–20 μg/ml)/RNase T1 (30–50 units/ml) for 20 min at 37 °C, and then treated with 0.4 mg/ml of proteinase K in the presence of 0.4% SDS.

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: Sperm nuclei were tested for absence of DNA breaks with TUNEL assay as previously described ( ). .. Briefly, 20 μL of different sperm nuclei preparations (4000 n/μl) were incubated at 37°C for 4 hr in 170 μL H2 O supplemented with 20 μL 10 x TdT buffer (NEB), 90 U Terminal transferase (NEB) and 1 μL 32 P-dCTP. ..

    Purification:

    Article Title: The Arabidopsis RNA Binding Protein with K Homology Motifs, SHINY1, Interacts with the C-terminal Domain Phosphatase-like 1 (CPL1) to Repress Stress-Inducible Gene Expression
    Article Snippet: Briefly, 2 µg of total RNA isolated with RNeasy Plant Mini Kit (Qiagen) was reverse transcribed using the avian myeloblastosis virus (AMV) reverse transcriptase (Promega) following the manufacture's instruction. .. The first strand cDNA purified with the PCR purification kit (Qiagen) was added with a Poly (dA) tail using terminal transferase (New England Biolabs). .. The cDNA having a poly (A) tail was amplified with a primer ctgatctagaggtaccggatcc -dT(17) and the luciferase gene specific primer gtttcatagcttctgccaacc for 5′RACE using GoTaq DNA Polymerase (Promega).

    Article Title: Chromosomal landscape of UV damage formation and repair at single-nucleotide resolution
    Article Snippet: Ligation was performed at 16 °C for 16 h, using NEBNext Quick Ligation Module. .. DNA was purified with AMpure XP beads and subsequently incubated with Terminal Transferase (TdT, New England Biolabs) and dideoxy ATP (Roche) for 2 h at 37 °C to block all free 3′ ends. ..

    Polymerase Chain Reaction:

    Article Title: The Arabidopsis RNA Binding Protein with K Homology Motifs, SHINY1, Interacts with the C-terminal Domain Phosphatase-like 1 (CPL1) to Repress Stress-Inducible Gene Expression
    Article Snippet: Briefly, 2 µg of total RNA isolated with RNeasy Plant Mini Kit (Qiagen) was reverse transcribed using the avian myeloblastosis virus (AMV) reverse transcriptase (Promega) following the manufacture's instruction. .. The first strand cDNA purified with the PCR purification kit (Qiagen) was added with a Poly (dA) tail using terminal transferase (New England Biolabs). .. The cDNA having a poly (A) tail was amplified with a primer ctgatctagaggtaccggatcc -dT(17) and the luciferase gene specific primer gtttcatagcttctgccaacc for 5′RACE using GoTaq DNA Polymerase (Promega).

    Blocking Assay:

    Article Title: Chromosomal landscape of UV damage formation and repair at single-nucleotide resolution
    Article Snippet: Ligation was performed at 16 °C for 16 h, using NEBNext Quick Ligation Module. .. DNA was purified with AMpure XP beads and subsequently incubated with Terminal Transferase (TdT, New England Biolabs) and dideoxy ATP (Roche) for 2 h at 37 °C to block all free 3′ ends. ..

    Sequencing:

    Article Title: Complete Genome Sequences of Two Rat Pegivirus Strains in Indonesia
    Article Snippet: From the IND079 serum, three partially overlapping DNA fragments were amplified by nested reverse transcription-PCR (nRT-PCR) using four primer pairs generated based on the SISPA-derived sequences , and the near-entire coding region sequence of the RPgV-IND079 genome was determined. .. Nucleotide sequencing of both the 5′- and 3′-terminal regions was carried out using the rapid amplification of cDNA ends (RACE) method ( , top) using homopolymer tailing of dATP or dGTP with terminal deoxytidyl transferase and ATP with poly(A) polymerase (New England Biolabs, Ipswich, MA), respectively ( , ). .. To confirm the 5′-terminal sequence, additional seminested RT-PCR (RP-2; , top) was performed and subjected to sequence analyses.

    Rapid Amplification of cDNA Ends:

    Article Title: Complete Genome Sequences of Two Rat Pegivirus Strains in Indonesia
    Article Snippet: From the IND079 serum, three partially overlapping DNA fragments were amplified by nested reverse transcription-PCR (nRT-PCR) using four primer pairs generated based on the SISPA-derived sequences , and the near-entire coding region sequence of the RPgV-IND079 genome was determined. .. Nucleotide sequencing of both the 5′- and 3′-terminal regions was carried out using the rapid amplification of cDNA ends (RACE) method ( , top) using homopolymer tailing of dATP or dGTP with terminal deoxytidyl transferase and ATP with poly(A) polymerase (New England Biolabs, Ipswich, MA), respectively ( , ). .. To confirm the 5′-terminal sequence, additional seminested RT-PCR (RP-2; , top) was performed and subjected to sequence analyses.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Comprehensive characterization of erythroid-specific enhancers in the genomic regions of human Kr?ppel-like factors
    Article Snippet: Conserved motifs embedded in erythroid-specific KLF enhancers were analyzed using the MEME software ( http://meme.ebi.edu.au/meme/cgi-bin/meme.cgi ), and these de novo discovered motifs were searched against the ENCODE-motifs database ( http://www.broadinstitute.org/~pouyak/motif-disc/human/ ) using TOMTOM algorithm ( http://meme.ebi.edu.au/meme/cgi-bin/tomtom.cgi ) [ ]. .. EMSA Bio-11-dUTP (Ambion, AM8450) and TdT (New England Biolabs, M0315s) were used to label the 3′-OH of single-stranded oligos (5′-AGC ATG AAG TAG GAG AGT GAT GAT GAC AGT GCT GCT TTG CAC AGA TAA GCC TGG CGG A-3′, 5′-TCC GCC AGG CTT ATC TGT GCA AAG CAG CAC TGT CAT CAT CAC TCT CCT ACT TCA TGC T-3′) and complementary oligos were annealed as per the manufacturer’s instructions. .. Nuclear proteins of K562, HeLa, and HEK293 cells were extracted using the rapid micro-preparation method (lysis buffer: 10 mM Hepes [pH7.9], 10 mM KCl, 1.5 mM MgCl2 , 0.5 mM PMSF, 0.5 mM DTT; high-salt extraction buffer: 20 mM Hepes [pH7.9], 25% glycerol, 0.42 M NaCl, 1.5 mM MgCl2 , 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM DTT) [ ].

    Activated Clotting Time Assay:

    Article Title: Comprehensive characterization of erythroid-specific enhancers in the genomic regions of human Kr?ppel-like factors
    Article Snippet: Conserved motifs embedded in erythroid-specific KLF enhancers were analyzed using the MEME software ( http://meme.ebi.edu.au/meme/cgi-bin/meme.cgi ), and these de novo discovered motifs were searched against the ENCODE-motifs database ( http://www.broadinstitute.org/~pouyak/motif-disc/human/ ) using TOMTOM algorithm ( http://meme.ebi.edu.au/meme/cgi-bin/tomtom.cgi ) [ ]. .. EMSA Bio-11-dUTP (Ambion, AM8450) and TdT (New England Biolabs, M0315s) were used to label the 3′-OH of single-stranded oligos (5′-AGC ATG AAG TAG GAG AGT GAT GAT GAC AGT GCT GCT TTG CAC AGA TAA GCC TGG CGG A-3′, 5′-TCC GCC AGG CTT ATC TGT GCA AAG CAG CAC TGT CAT CAT CAC TCT CCT ACT TCA TGC T-3′) and complementary oligos were annealed as per the manufacturer’s instructions. .. Nuclear proteins of K562, HeLa, and HEK293 cells were extracted using the rapid micro-preparation method (lysis buffer: 10 mM Hepes [pH7.9], 10 mM KCl, 1.5 mM MgCl2 , 0.5 mM PMSF, 0.5 mM DTT; high-salt extraction buffer: 20 mM Hepes [pH7.9], 25% glycerol, 0.42 M NaCl, 1.5 mM MgCl2 , 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM DTT) [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs terminal regions
    (A) Strategies for determining the complete genome sequences of the two rat pegivirus strains (RPgV-IND079 and RPgV-IND038) obtained in the present study. The light-gray boxes (S1 to S6) with nucleotide positions at both ends below the schematic organization of the rat pegivirus genome indicate the genomic areas amplified using the SISPA method ( 6 ), which includes reverse transcription using a random primer tagged with a known sequence, FR20RV-N6 (5′- GCCGGAGCTCTGCAGATATCNNNNNN -3′) with Superscript III (Thermo Fisher Scientific, Inc.) followed by amplification with Ex Taq polymerase (TaKaRa Bio, Inc., Shiga, Japan) using a primer with the underlined sequence of FR20RV-N6 (FR20RV, 5′- GCCGGAGCTCTGCAGATATC -3′). The dark-gray boxes (RP-1 to RP-5 and RP-1-1 to RP-1-3) with nucleotide positions at both ends depict the genomic areas amplified by nRT-PCR with primers ( Table 1 ) and Ex Taq polymerase following reverse transcription with primers ( Table 1 ) highlighted with triangles and Superscript III. Open boxes (5′RA-1-1, 5′RA-1-2, 5′RA-2, 3′RA-1, and 3′RA-2) with nucleotide positions at both ends indicate the genomic areas amplified by the 5′-RACE and 3′-RACE methods ( 7 , 8 ). (Top) From the IND079 serum, four DNA fragments (S1 to S4) with nucleotide sequences similar to those of a rat pegivirus genome (DDBJ accession number MT085182 ) were obtained using the SISPA method. Using four pairs of primers (one pair for first-round PCR and three pairs for second-round PCR) generated based on the SISPA-derived sequences ( Table 1 ), one DNA fragment (RP-1) and three DNA fragments (RP-1-1 to RP-1-3) were amplified by first-round PCR and second-round PCR, respectively, with Ex Taq polymerase following reverse transcription with Superscript III. The sequences of the 5′- and <t>3′-terminal</t> regions (5′RA-1-1, 5′RA-1-2, and 3′RA-1) were amplified by the 5′-RACE and 3′-RACE methods with the primers synthesized based on the RP-1-1 or RP-1-3 sequences, respectively. The RP-2 fragment was amplified to confirm the 5′-terminal region sequence (nt 23 to 1355) since it was determined based on two consecutive RACE reactions. (Bottom) From the IND038 serum, two DNA fragments (S5 and S6) with nucleotide sequences similar to those of a rat pegivirus genome ( MT085182 ) were obtained using the SISPA method. Using three pairs of primers ( Table 1 ), three DNA fragments (RP-3 to RP-5) were amplified by nRT-PCR as described above. The 5′-RACE (5′RA-2) and 3′-RACE (3′RA-2) products were amplified with primers ( Table 1 ) generated based on the RPgV-IND079 sequence. In the present study, all amplification products were sequenced two or more times on both strands directly or after cloning into pMD20 T-Vector (TaKaRa Bio, Inc.) (with the bidirectional primer-walking method, when needed) using an Applied Biosystems 3130xl genetic analyzer (Thermo Fisher Scientific, Inc.) with a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific, Inc.). All reads were assembled using the Genetyx software program v13.0.1 (Genetyx Corp., Tokyo, Japan) to determine the complete genome sequences. (B) A phylogenetic tree of the nucleotide sequences of the entire coding region of the two strains (RPgV-IND038 and RPgV-IND079, highlighted with filled circles) obtained in the present study with 28 reported reference isolates of Pegivirus A to K and Pegivirus L proposed by Smith et al. ( 3 ) and Rodrigues et al. ( 4 ), respectively. The tree was constructed using the maximum likelihood method with the MEGA7 software program v7.02.26 ( 11 ) after alignment using the MUSCLE software program v3.5 ( 12 ). Each reference sequence is shown with the accession number, the strain name, and the name of the country. The bootstrap values (≥70%) for the nodes are indicated as a percentage of the data obtained from resampling 1,000 times. The scale bar represents the number of nucleotide substitutions per site. Asterisks indicate that countries where nonhuman primates were captured are not specified.
    Terminal Regions, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/terminal regions/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    terminal regions - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    Image Search Results


    (A) Strategies for determining the complete genome sequences of the two rat pegivirus strains (RPgV-IND079 and RPgV-IND038) obtained in the present study. The light-gray boxes (S1 to S6) with nucleotide positions at both ends below the schematic organization of the rat pegivirus genome indicate the genomic areas amplified using the SISPA method ( 6 ), which includes reverse transcription using a random primer tagged with a known sequence, FR20RV-N6 (5′- GCCGGAGCTCTGCAGATATCNNNNNN -3′) with Superscript III (Thermo Fisher Scientific, Inc.) followed by amplification with Ex Taq polymerase (TaKaRa Bio, Inc., Shiga, Japan) using a primer with the underlined sequence of FR20RV-N6 (FR20RV, 5′- GCCGGAGCTCTGCAGATATC -3′). The dark-gray boxes (RP-1 to RP-5 and RP-1-1 to RP-1-3) with nucleotide positions at both ends depict the genomic areas amplified by nRT-PCR with primers ( Table 1 ) and Ex Taq polymerase following reverse transcription with primers ( Table 1 ) highlighted with triangles and Superscript III. Open boxes (5′RA-1-1, 5′RA-1-2, 5′RA-2, 3′RA-1, and 3′RA-2) with nucleotide positions at both ends indicate the genomic areas amplified by the 5′-RACE and 3′-RACE methods ( 7 , 8 ). (Top) From the IND079 serum, four DNA fragments (S1 to S4) with nucleotide sequences similar to those of a rat pegivirus genome (DDBJ accession number MT085182 ) were obtained using the SISPA method. Using four pairs of primers (one pair for first-round PCR and three pairs for second-round PCR) generated based on the SISPA-derived sequences ( Table 1 ), one DNA fragment (RP-1) and three DNA fragments (RP-1-1 to RP-1-3) were amplified by first-round PCR and second-round PCR, respectively, with Ex Taq polymerase following reverse transcription with Superscript III. The sequences of the 5′- and 3′-terminal regions (5′RA-1-1, 5′RA-1-2, and 3′RA-1) were amplified by the 5′-RACE and 3′-RACE methods with the primers synthesized based on the RP-1-1 or RP-1-3 sequences, respectively. The RP-2 fragment was amplified to confirm the 5′-terminal region sequence (nt 23 to 1355) since it was determined based on two consecutive RACE reactions. (Bottom) From the IND038 serum, two DNA fragments (S5 and S6) with nucleotide sequences similar to those of a rat pegivirus genome ( MT085182 ) were obtained using the SISPA method. Using three pairs of primers ( Table 1 ), three DNA fragments (RP-3 to RP-5) were amplified by nRT-PCR as described above. The 5′-RACE (5′RA-2) and 3′-RACE (3′RA-2) products were amplified with primers ( Table 1 ) generated based on the RPgV-IND079 sequence. In the present study, all amplification products were sequenced two or more times on both strands directly or after cloning into pMD20 T-Vector (TaKaRa Bio, Inc.) (with the bidirectional primer-walking method, when needed) using an Applied Biosystems 3130xl genetic analyzer (Thermo Fisher Scientific, Inc.) with a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific, Inc.). All reads were assembled using the Genetyx software program v13.0.1 (Genetyx Corp., Tokyo, Japan) to determine the complete genome sequences. (B) A phylogenetic tree of the nucleotide sequences of the entire coding region of the two strains (RPgV-IND038 and RPgV-IND079, highlighted with filled circles) obtained in the present study with 28 reported reference isolates of Pegivirus A to K and Pegivirus L proposed by Smith et al. ( 3 ) and Rodrigues et al. ( 4 ), respectively. The tree was constructed using the maximum likelihood method with the MEGA7 software program v7.02.26 ( 11 ) after alignment using the MUSCLE software program v3.5 ( 12 ). Each reference sequence is shown with the accession number, the strain name, and the name of the country. The bootstrap values (≥70%) for the nodes are indicated as a percentage of the data obtained from resampling 1,000 times. The scale bar represents the number of nucleotide substitutions per site. Asterisks indicate that countries where nonhuman primates were captured are not specified.

    Journal: Microbiology Resource Announcements

    Article Title: Complete Genome Sequences of Two Rat Pegivirus Strains in Indonesia

    doi: 10.1128/MRA.00049-21

    Figure Lengend Snippet: (A) Strategies for determining the complete genome sequences of the two rat pegivirus strains (RPgV-IND079 and RPgV-IND038) obtained in the present study. The light-gray boxes (S1 to S6) with nucleotide positions at both ends below the schematic organization of the rat pegivirus genome indicate the genomic areas amplified using the SISPA method ( 6 ), which includes reverse transcription using a random primer tagged with a known sequence, FR20RV-N6 (5′- GCCGGAGCTCTGCAGATATCNNNNNN -3′) with Superscript III (Thermo Fisher Scientific, Inc.) followed by amplification with Ex Taq polymerase (TaKaRa Bio, Inc., Shiga, Japan) using a primer with the underlined sequence of FR20RV-N6 (FR20RV, 5′- GCCGGAGCTCTGCAGATATC -3′). The dark-gray boxes (RP-1 to RP-5 and RP-1-1 to RP-1-3) with nucleotide positions at both ends depict the genomic areas amplified by nRT-PCR with primers ( Table 1 ) and Ex Taq polymerase following reverse transcription with primers ( Table 1 ) highlighted with triangles and Superscript III. Open boxes (5′RA-1-1, 5′RA-1-2, 5′RA-2, 3′RA-1, and 3′RA-2) with nucleotide positions at both ends indicate the genomic areas amplified by the 5′-RACE and 3′-RACE methods ( 7 , 8 ). (Top) From the IND079 serum, four DNA fragments (S1 to S4) with nucleotide sequences similar to those of a rat pegivirus genome (DDBJ accession number MT085182 ) were obtained using the SISPA method. Using four pairs of primers (one pair for first-round PCR and three pairs for second-round PCR) generated based on the SISPA-derived sequences ( Table 1 ), one DNA fragment (RP-1) and three DNA fragments (RP-1-1 to RP-1-3) were amplified by first-round PCR and second-round PCR, respectively, with Ex Taq polymerase following reverse transcription with Superscript III. The sequences of the 5′- and 3′-terminal regions (5′RA-1-1, 5′RA-1-2, and 3′RA-1) were amplified by the 5′-RACE and 3′-RACE methods with the primers synthesized based on the RP-1-1 or RP-1-3 sequences, respectively. The RP-2 fragment was amplified to confirm the 5′-terminal region sequence (nt 23 to 1355) since it was determined based on two consecutive RACE reactions. (Bottom) From the IND038 serum, two DNA fragments (S5 and S6) with nucleotide sequences similar to those of a rat pegivirus genome ( MT085182 ) were obtained using the SISPA method. Using three pairs of primers ( Table 1 ), three DNA fragments (RP-3 to RP-5) were amplified by nRT-PCR as described above. The 5′-RACE (5′RA-2) and 3′-RACE (3′RA-2) products were amplified with primers ( Table 1 ) generated based on the RPgV-IND079 sequence. In the present study, all amplification products were sequenced two or more times on both strands directly or after cloning into pMD20 T-Vector (TaKaRa Bio, Inc.) (with the bidirectional primer-walking method, when needed) using an Applied Biosystems 3130xl genetic analyzer (Thermo Fisher Scientific, Inc.) with a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific, Inc.). All reads were assembled using the Genetyx software program v13.0.1 (Genetyx Corp., Tokyo, Japan) to determine the complete genome sequences. (B) A phylogenetic tree of the nucleotide sequences of the entire coding region of the two strains (RPgV-IND038 and RPgV-IND079, highlighted with filled circles) obtained in the present study with 28 reported reference isolates of Pegivirus A to K and Pegivirus L proposed by Smith et al. ( 3 ) and Rodrigues et al. ( 4 ), respectively. The tree was constructed using the maximum likelihood method with the MEGA7 software program v7.02.26 ( 11 ) after alignment using the MUSCLE software program v3.5 ( 12 ). Each reference sequence is shown with the accession number, the strain name, and the name of the country. The bootstrap values (≥70%) for the nodes are indicated as a percentage of the data obtained from resampling 1,000 times. The scale bar represents the number of nucleotide substitutions per site. Asterisks indicate that countries where nonhuman primates were captured are not specified.

    Article Snippet: Nucleotide sequencing of both the 5′- and 3′-terminal regions was carried out using the rapid amplification of cDNA ends (RACE) method ( , top) using homopolymer tailing of dATP or dGTP with terminal deoxytidyl transferase and ATP with poly(A) polymerase (New England Biolabs, Ipswich, MA), respectively ( , ).

    Techniques: Amplification, Sequencing, Polymerase Chain Reaction, Generated, Derivative Assay, Synthesized, Clone Assay, Plasmid Preparation, Chromosome Walking, Software, Construct