murine rnase inhibitor  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RNase Inhibitor Murine
    Description:
    RNase Inhibitor Murine 15 000 units
    Catalog Number:
    M0314L
    Price:
    280
    Size:
    15 000 units
    Category:
    Enzyme Inhibitors
    Buy from Supplier


    Structured Review

    New England Biolabs murine rnase inhibitor
    RNase Inhibitor Murine
    RNase Inhibitor Murine 15 000 units
    https://www.bioz.com/result/murine rnase inhibitor/product/New England Biolabs
    Average 99 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    murine rnase inhibitor - by Bioz Stars, 2019-09
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Amplification:

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: DNA templates for RNA probe synthesis were obtained by PCR amplification of 312–412 bp fragments. .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB).

    Synthesized:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: Unmethylated and methylated model RNA oligonucleotides were synthesized (Thermo Scientific) to replicate each of the reported native RNA conditions ( , ). .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl.

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Total RNA was prepared with the Thermo Scientific GeneJET RNA Purification Kit according to the manufacturer’s protocol. .. The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation. .. Generated cDNA was used for subsequent RT-qPCR assays.

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Total RNA concentrations were analyzed via Nanodrop 1000 (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized by incubating approximately 1 μg RNA with 0.06 μg random primers (Invitrogen) for 10 minutes at 70°C followed by rapid cooling on ice. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Quantitative RT-PCR:

    Article Title: Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progression
    Article Snippet: Paragraph title: qRT-PCR ... Total RNA was extracted from flash frozen mammary tumours and lung lesions using a Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Inc., Toronto, ON, Canada; #80204). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs).

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation. .. Generated cDNA was used for subsequent RT-qPCR assays.

    Article Title: nc886 is induced by TGF-β and suppresses the microRNA pathway in ovarian cancer
    Article Snippet: The binding assays were done at 4 °C for 10 min in the same reaction mixture as the in vitro Dicer processing assay, except that 0.001% Nonidet P-40, 3.2 mM Ribonucleoside-Vanadyl Complex (New England Biolabs), and 0.24 unit µl−1 of RNase Inhibitor (New England Biolabs) were included, but ATP, creatine phosphate, and creatine kinase were excluded. .. The binding assays were done at 4 °C for 10 min in the same reaction mixture as the in vitro Dicer processing assay, except that 0.001% Nonidet P-40, 3.2 mM Ribonucleoside-Vanadyl Complex (New England Biolabs), and 0.24 unit µl−1 of RNase Inhibitor (New England Biolabs) were included, but ATP, creatine phosphate, and creatine kinase were excluded.

    Article Title: Groucho related gene 5 (GRG5) is involved in embryonic and neural stem cell state decisions
    Article Snippet: Paragraph title: Quantitative RT-PCR ... 2 μg RNA was reversely transcribed to cDNA by M-MuLV Reverse Transcriptase (NEBiolabs) supplemented with RNase inhibitor (NEBiolabs) according to the manufacturer’s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr. .. 4 microliters 5× buffer (250 mM Tris-HCl pH 8, 125 mM KCl, 15 mM MgCl_2), 1 microliter murine Ribonuclease Inhibitor (40 units/microliter), and 1 microliter Superscript III (LIfe Technologies) were added; this cDNA reaction was incubated at 25 deg C 10 min, 50 deg C 50 min, 55 deg C 10 min, 85 deg C 5 min, 4 deg C hold.

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: Samples (1–2 mL) from exponential phase (OD660 = 1) were centrifuged to pellet cells; cell pellets were resuspended in 1 mL TRIzol® (Ambion) and stored at −80 °C until extraction (no longer than 10 days). .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. Primers for mRNAs were unified to amplify regions homologous among the different ABZ1 and ABZ2 genes respectively, the sequences are listed in Table .

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Paragraph title: RNA isolation and qPCR ... The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation.

    Article Title: Endothelial cell activation by antiphospholipid antibodies is modulated by Kr?ppel-like transcription factors
    Article Snippet: DNAse I and all quantitative PCR primers were obtained from Invitrogen. .. Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs.

    Random Hexamer Labeling:

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Total RNA was prepared with the Thermo Scientific GeneJET RNA Purification Kit according to the manufacturer’s protocol. .. The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation. .. Generated cDNA was used for subsequent RT-qPCR assays.

    Expressing:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent.

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Paragraph title: Expression analyses by In Situ Hybridization ... Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Modification:

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Then 30 μL of ∼300 μM encoding probes and 3.3 μM of poly(dT) LNA anchor probe (a 20-nt sequence of alternating dT and thymidine-locked nucleic acid (dT+) with a 20-nt reverse complement of a readout sequence and a 5′-acrydite modification (Integrated DNA Technologies)) in encoding hybridization buffer was added to the surface of Parafilm (Bemis) and was covered with a cell-containing coverslip. .. Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma).

    Hybridization:

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Then 30 μL of ∼300 μM encoding probes and 3.3 μM of poly(dT) LNA anchor probe (a 20-nt sequence of alternating dT and thymidine-locked nucleic acid (dT+) with a 20-nt reverse complement of a readout sequence and a 5′-acrydite modification (Integrated DNA Technologies)) in encoding hybridization buffer was added to the surface of Parafilm (Bemis) and was covered with a cell-containing coverslip. .. Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma). .. Samples were incubated in a humid chamber inside a hybridization oven at 37 °C for 40 h. Cells then were washed with encoding wash buffer and incubated at 47 °C for 30 min; this washing step was repeated once.

    High Performance Liquid Chromatography:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl. .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl.

    Transfection:

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: To identify A3G-binding RNA, A3G and mutants were transfected into 293T cells. .. At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min. .. Cell lysates were clarified by centrifugation at 10,000 × g for 30 min at 4°C.

    Gas Chromatography:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: To determine the relative mRNA levels of the different over-expressed ABZ1 and ABZ2 genes, PABA strains were cultivated in shake-flask experiments on CDM + GLC, as described earlier. .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent.

    Ligation:

    Article Title: In vitro nanobody discovery for integral membrane protein targets
    Article Snippet: Paragraph title: mRNA-puromycin linker ligation ... Following annealing, 1 mM ATP, 1 µL murine RNase inhibitor (New England Biolabs, NEB), 3 µL T4 ssRNA Ligase were added and the reaction was incubated at room temperature overnight.

    Article Title: TSS-EMOTE, a refined protocol for a more complete and less biased global mapping of transcription start sites in bacterial pathogens
    Article Snippet: Paragraph title: Ligation step ... The “-RppH mix” consisted of 3.5 μl water, 2 μl RNA ligase buffer, 2 μl 10 mM ATP, 1 μl Murine RNase inhibitor (New England Biolabs), and 2 μl RNA ligase 1 (New England Biolabs).

    Protease Inhibitor:

    Article Title: Bacopa monniera (CDRI-08) Upregulates the Expression of Neuronal and Glial Plasticity Markers in the Brain of Scopolamine Induced Amnesic Mice
    Article Snippet: Thereafter, molecular investigations were performed by examining the effect of CDRI-08 on the mRNA and protein expression of BDNF, Arc, and GFAP in the cerebrum of scopolamine injected amnesic mice. .. Random hexanucleotides, dNTPs, enhanced chemiluminescence (ECL) reagents, Taq polymerase, RNase inhibitor, and reverse-transcriptase enzymes were obtained from the New England Biolabs (USA); DTNB, acetyl thiocholine iodide, TRI reagent, monoclonal anti-β -actin-peroxidase (A3854) and rabbit polyclonal GFAP antibody (G4546), and mini protease inhibitor cocktail were purchased from Sigma-Aldrich (USA). .. Mouse monoclonal Arc antibody (sc-17839) and goat polyclonal BDNF antibody (sc-33904) were purchased from Santa Cruz Biotechnology, USA.

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: To identify A3G-binding RNA, A3G and mutants were transfected into 293T cells. .. At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min. .. Cell lysates were clarified by centrifugation at 10,000 × g for 30 min at 4°C.

    Northern Blot:

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP. .. In cleavage assays, approximately 100 ng purified Dicer was incubated with 1 pmol pre-miRNA in 10 μl dicing buffer (20 mM Tris–HCl pH 6.5, 25 mM NaCl, 1% glycerol, 1.5 mM MgCl2 and 1 mM DTT) for 30 min to 1 h at 37°C as previously described ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: Total RNA from NSC34 cells was obtained using Trizol reagent (Invitrogen). .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris buffer pH 8.4, 50 mM KCl, 1.6 mM MgCl2, 0.4 mM dNTPs, and 0.04 U Taq polymerase (Kapabiosystems, Boston, MA, US) was incubated 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles.

    other:

    Article Title: Characterization of human plasma-derived exosomal RNAs by deep sequencing
    Article Snippet: The RNase A digestion was terminated by adding 150 units/mL of murine RNase inhibitor.

    Polymerase Chain Reaction:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA.

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: Paragraph title: RNA extraction, retro-transcription and polymerase chain reaction (PCR) ... The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Total RNA concentrations were analyzed via Nanodrop 1000 (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized by incubating approximately 1 μg RNA with 0.06 μg random primers (Invitrogen) for 10 minutes at 70°C followed by rapid cooling on ice. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. .. NCBI GenBank accession numbers for SCN viral sequences are HM849038 (ScNV), HM849039 (ScRV), HM849040 (ScPV), HM849041 (ScTV) and KF726084 (SbCNV-5).

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Fragments were cleaned using QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA). .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: To synthesize RNAs, PCR templates containing a T7 promoter sequence upstream of the RNA coding sequences were used in T7 run-off transcription reactions. .. Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB).

    Affinity Purification:

    Article Title: Endothelial cell activation by antiphospholipid antibodies is modulated by Kr?ppel-like transcription factors
    Article Snippet: Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs. .. Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs.

    Binding Assay:

    Article Title: nc886 is induced by TGF-β and suppresses the microRNA pathway in ovarian cancer
    Article Snippet: The reaction products were resolved in a 15% denaturing polyacrylamide gel and subjected to northern hybridization using probes for each precursor (for probe sequences, see Supplementary Data File ). .. The binding assays were done at 4 °C for 10 min in the same reaction mixture as the in vitro Dicer processing assay, except that 0.001% Nonidet P-40, 3.2 mM Ribonucleoside-Vanadyl Complex (New England Biolabs), and 0.24 unit µl−1 of RNase Inhibitor (New England Biolabs) were included, but ATP, creatine phosphate, and creatine kinase were excluded. .. After washing with buffer D (5 times), the bound RNA was eluted into RNase-free H2 O by heating the reaction at 75 °C for 5 min.

    Methylation:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: Unmethylated and methylated model RNA oligonucleotides were synthesized (Thermo Scientific) to replicate each of the reported native RNA conditions ( , ). .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl.

    Isolation:

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: HeLa total RNA was isolated by TRIZOL lysis followed by PureLink purification of the aqueous phase (Life Technologies). .. 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr.

    Article Title: Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progression
    Article Snippet: OCT-embedded sections of mammary tumours were processed and stained with X-gal as described previously [ ]. .. Total RNA was extracted from flash frozen mammary tumours and lung lesions using a Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Inc., Toronto, ON, Canada; #80204). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs). .. Real-time quantitative PCR was performed on the cDNA using LightCycler 480 SYBR Green I Master (Roche, Missisauga, ON, Canada; #04707516001) and run on a Roche LightCycler 480 instrument.

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Paragraph title: RNA isolation and qPCR ... The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: All samples were also analyzed for gapdh to exclude false-positive results. .. GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. DNase I was inactivated by increasing the temperature (72 °C for 3 min), and samples were then stored on ice.

    Labeling:

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Fragments were cleaned using QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA). .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol. .. RNA in situ hybridization was performed according to Ambrose et al. [ ] and Ferrándiz et al. [ ], optimized to hybridize overnight at 55 °C.

    Purification:

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: HeLa total RNA was isolated by TRIZOL lysis followed by PureLink purification of the aqueous phase (Life Technologies). .. 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr.

    Article Title: In vitro nanobody discovery for integral membrane protein targets
    Article Snippet: Purified mRNA was ligated to the puromycin linker, Nb_Disp_Puro using a DNA splint, Nb-GFP_Disp_Splint or HuSdL_Disp_Splint ( ). .. Following annealing, 1 mM ATP, 1 µL murine RNase inhibitor (New England Biolabs, NEB), 3 µL T4 ssRNA Ligase were added and the reaction was incubated at room temperature overnight.

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Total RNA was prepared with the Thermo Scientific GeneJET RNA Purification Kit according to the manufacturer’s protocol. .. The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation.

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Fragments were cleaned using QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA). .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP. .. To test Dicer cleavage in vitro , various recombinant human Dicers were expressed in HEK 293T cells and purified by α-Flag antibodies.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. A mixture of 1 mL of SMARTscribe reverse transcriptase (Clontech Laboratories), 1 mL of custom-designed TS oligo (12 mM, Integrated DNA Technologies , 0.3 mL of MgCl2 (200 mM, Sigma), 0.5 mL of RNase inhibitor (Neb), 1 mL of dNTP (10 mM each, Thermo), and 0.25 mL DTT (100 mM, Invitrogen) were incubated at 42 °C for 90 min, which was followed by enzyme inactivation at 70 °C for 10 min. A mixture of 29 mL of water, 5 mL of Advantage2 taq polymerase buffer, 2 mL of dNTP (10 mM each, Thermo), 2 mL of custom-designed PCR primer (12 mM, Integrated DNA Technologies , and 2 mL of Advantage2 taq polymerase was directly added to the reverse transcription product, and the amplification was performed for 19 cycles.

    Article Title: Endothelial cell activation by antiphospholipid antibodies is modulated by Kr?ppel-like transcription factors
    Article Snippet: Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs. .. Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs.

    Sequencing:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl. .. The 38-bp, HPLC-purified, 5′ Ned-labelled DNA primer used was 5′ ACATCATCATCATCATCATCATTCGGTTCGTCCAAGTG 3′.

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: To ensure specificity, the probe templates were designed to amplify the 3′ sequence flanking the bHLH domain (Additional file : Figure S1; Additional file : Table S2). .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Then 30 μL of ∼300 μM encoding probes and 3.3 μM of poly(dT) LNA anchor probe (a 20-nt sequence of alternating dT and thymidine-locked nucleic acid (dT+) with a 20-nt reverse complement of a readout sequence and a 5′-acrydite modification (Integrated DNA Technologies)) in encoding hybridization buffer was added to the surface of Parafilm (Bemis) and was covered with a cell-containing coverslip. .. Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma).

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: To synthesize RNAs, PCR templates containing a T7 promoter sequence upstream of the RNA coding sequences were used in T7 run-off transcription reactions. .. Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: Paragraph title: Library preparation and sequencing ... GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB).

    Microscopy:

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol. .. In situ hybridized sections were subsequently dehydrated and permanently mounted in Permount (Fisher, Waltham, MA, USA).

    Lysis:

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: HeLa total RNA was isolated by TRIZOL lysis followed by PureLink purification of the aqueous phase (Life Technologies). .. 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr.

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: To identify A3G-binding RNA, A3G and mutants were transfected into 293T cells. .. At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min. .. Cell lysates were clarified by centrifugation at 10,000 × g for 30 min at 4°C.

    In Situ Hybridization:

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Paragraph title: Expression analyses by In Situ Hybridization ... Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Software:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl. .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl.

    SYBR Green Assay:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: Samples (1–2 mL) from exponential phase (OD660 = 1) were centrifuged to pellet cells; cell pellets were resuspended in 1 mL TRIzol® (Ambion) and stored at −80 °C until extraction (no longer than 10 days). .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. Primers for mRNAs were unified to amplify regions homologous among the different ABZ1 and ABZ2 genes respectively, the sequences are listed in Table .

    RNA Extraction:

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: Paragraph title: RNA extraction, retro-transcription and polymerase chain reaction (PCR) ... The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Paragraph title: RNA extraction and cDNA synthesis ... Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Agarose Gel Electrophoresis:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA.

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    In Vitro:

    Article Title: nc886 is induced by TGF-β and suppresses the microRNA pathway in ovarian cancer
    Article Snippet: The reaction products were resolved in a 15% denaturing polyacrylamide gel and subjected to northern hybridization using probes for each precursor (for probe sequences, see Supplementary Data File ). .. The binding assays were done at 4 °C for 10 min in the same reaction mixture as the in vitro Dicer processing assay, except that 0.001% Nonidet P-40, 3.2 mM Ribonucleoside-Vanadyl Complex (New England Biolabs), and 0.24 unit µl−1 of RNase Inhibitor (New England Biolabs) were included, but ATP, creatine phosphate, and creatine kinase were excluded. .. After washing with buffer D (5 times), the bound RNA was eluted into RNase-free H2 O by heating the reaction at 75 °C for 5 min.

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: Paragraph title: In vitro synthesis of RNAs and Dicer cleavage assays ... Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP.

    Electrophoresis:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA.

    Homogenization:

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Samples were prepared for total RNA extraction by homogenization with three 3-mm glass beads in a 1.5 ml tube on a Silamat S6 (Ivoclar Vivadent, Amherst, NY). .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Incubation:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: Total RNA from NSC34 cells was obtained using Trizol reagent (Invitrogen). .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris buffer pH 8.4, 50 mM KCl, 1.6 mM MgCl2, 0.4 mM dNTPs, and 0.04 U Taq polymerase (Kapabiosystems, Boston, MA, US) was incubated 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles.

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: HeLa total RNA was isolated by TRIZOL lysis followed by PureLink purification of the aqueous phase (Life Technologies). .. 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr. .. 1 microliter 1 mM EDTA, 1 microliter 10 mM each dNTP, and 1 microliter 100 microM random hexamer were added and the RNA denatured at 65DEGC for 5 min and placed on ice.

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: Briefly, cells we re resuspended in Trizol, and following 5-min incubation at room temperature (RT), 200 μl of chloroform (#BP1145-1, Fisher Scientific, Pittsburgh, PA) was added. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: In vitro nanobody discovery for integral membrane protein targets
    Article Snippet: For each 60 µL reaction, 5 µg mRNA was first annealed to 2.67 µM splint and 2.67 µM puromycin linker in the presence of 1× T4 ssRNA ligase buffer. .. Following annealing, 1 mM ATP, 1 µL murine RNase inhibitor (New England Biolabs, NEB), 3 µL T4 ssRNA Ligase were added and the reaction was incubated at room temperature overnight. .. Unligated linker and splint were cleaved using 5 µL lambda exonuclease (NEB) in a total volume of 240 µL, containing 24 µL of lambda exonuclease buffer, and subsequent incubation at 37°C for 45 mins.

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: Unmethylated and methylated model RNA oligonucleotides were synthesized (Thermo Scientific) to replicate each of the reported native RNA conditions ( , ). .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl. .. One microliter was mixed with 8.95 µl Hi-Di Formamide (Applied Biosystems) and 0.05 µl GeneScan Rox size standard (Applied Biosystems) and run on an ABI3130 Genetic Analyser (Applied Biosystems).

    Article Title: TSS-EMOTE, a refined protocol for a more complete and less biased global mapping of transcription start sites in bacterial pathogens
    Article Snippet: To each tube was added 10 μl of either “-RppH mix” or “+RppH mix”, which were then incubated at 37 °C. .. The “-RppH mix” consisted of 3.5 μl water, 2 μl RNA ligase buffer, 2 μl 10 mM ATP, 1 μl Murine RNase inhibitor (New England Biolabs), and 2 μl RNA ligase 1 (New England Biolabs).

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Permeabilized cells were incubated for 5 min in encoding wash buffer comprising 2× saline-sodium citrate (SSC) (Ambion) and 30% (vol/vol) formamide (Ambion). .. Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma).

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: To synthesize RNAs, PCR templates containing a T7 promoter sequence upstream of the RNA coding sequences were used in T7 run-off transcription reactions. .. Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP. .. To test Dicer cleavage in vitro , various recombinant human Dicers were expressed in HEK 293T cells and purified by α-Flag antibodies.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB).

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min. .. Cell lysates were clarified by centrifugation at 10,000 × g for 30 min at 4°C.

    Sampling:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent.

    Immunoprecipitation:

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: Paragraph title: Immunoprecipitation. ... At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min.

    In Situ:

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol. .. RNA in situ hybridization was performed according to Ambrose et al. [ ] and Ferrándiz et al. [ ], optimized to hybridize overnight at 55 °C.

    Standard Deviation:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent.

    Staining:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA.

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Paragraph title: Encoding probe staining ... Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    RNase Inhibitor Murine 15 000 units
      Buy from Supplier

    99
    New England Biolabs murine rnase inhibitor
    Murine Rnase Inhibitor, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/murine rnase inhibitor/product/New England Biolabs
    Average 99 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    murine rnase inhibitor - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    Image Search Results