endonuclease viii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Endonuclease VIII
    Description:
    Endonuclease VIII 5 000 units
    Catalog Number:
    m0299l
    Price:
    300
    Size:
    5 000 units
    Category:
    Other Endonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs endonuclease viii
    Endonuclease VIII
    Endonuclease VIII 5 000 units
    https://www.bioz.com/result/endonuclease viii/product/New England Biolabs
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    endonuclease viii - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: To analyze DNA-dC deamination, the 59 bp DNA fragment 5'-AGCT GGCAGGCTAGCAAGTTGGTTGGCAAGCAGGTAAGCAGGCAAGCTGGCTGAATTCC-3' ( ) was cloned into pCR-Blunt II-TOPO® vector. .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: Clones were blue-white screened and validated by DNA sequencing. .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Centrifugation:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: The lower centrifugation speed was chosen based on our previous experience that the binding apparatus can break during centrifugation at higher speeds. .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Amplification:

    Article Title: Population genomics of Mesolithic Scandinavia: Investigating early postglacial migration routes and high-latitude adaptation
    Article Snippet: .. Libraries were built as above, except a DNA repair step in which UDG and endonuclease VIII or USER enzyme (NEB) treatment was included in order to remove deaminated cytosines [ ]. qPCR was performed in order to quantify the number of molecules and the optimal number of PCR cycles prior to amplification for each DNA library. .. Furthermore, this step included extraction blanks, library blanks, and amplification blanks to monitor potential contamination.

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. A quantitative PCR (qPCR) experiment was carried out using 0.2% of the unamplified library to estimate relative library complexities (Additional file : Table S1), and to determine the optimal number of cycles for subsequent indexing PCR, representing the inflection point of the respective library amplification curves, corrected for reaction volume and template amount. qPCR was performed on a PikoReal 96 Real-Time PCR machine (Thermo Fisher Scientific TCR0096) with 3 replicates for each library, involving an initial 10 min denaturation at 95 °C, followed by 40 cycles of: 15 s at 95 °C, 30 s at 60 °C, and 1 min at 72 °C.

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Targets were initially amplified by PCR containing 1 μg human genomic DNA, 50 nM each of 94 forward PCR primers, 50 nM each of 94 reverse PCR primers, 5 U of AmpliTaq Polyermase Stoffel Fragment (Applied Biosystems), 200 μM each dNTP, 2 mM MgCl2 , 20 mM Tris-HCl (pH 8.4), and 50 mM KCl in a total volume of 10 μL. .. Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: Telomere Trimming and DNA Damage as Signatures of High Risk Neuroblastoma
    Article Snippet: An alternative set of STELA amplification reactions (based on ) were carried out in 15 μl containing 1× Taq buffer (Thermo Fisher), 0.3 mM of each dNTP, 0.4 μM of forward and reverse primers, and 1 U of Pwo:Taq (10:1) polymerase mix. .. In some of STELA assays, 50 ng of genomic DNA was digested with 5 U of Endonuclease VIII (NEB) and 4 U of Fpg (NEB) in 1× CutSmart buffer (NEB) at 37 °C for 2 h. Both glycosylases were inactivated at 75 °C for 20 min. Digested DNAs were applied to the ligation reaction for STELA analysis.

    Article Title: Selective enrichment of damaged DNA molecules for ancient genome sequencing
    Article Snippet: A fill-in reaction mix was prepared by combining 42.5 μL water, 5 μL 10× Isothermal amplification buffer (New England Biolabs), 0.5 μL 25 mM dNTP, and 2 μL 8 U/μL Bst DNA polymerase 2.0 (New England Biolabs). .. After washing the beads with 200 μL wash buffer A and 200 μL wash buffer B (see for wash buffer recipes), they were resuspended in an excision reaction mix comprised of the following components: 34.25 μL water, 5 μL 10× GeneAmp PCR buffer II (Life Technologies), 4 μL 25 mM MgCl2 , 1.25 μL 1% Tween-20, 0.5 μL 25 mM dNTP, 0.75 μL 10 U/μL endonuclease VIII, and 0.25 μL 1 U/μL E. coli UDG (both New England Biolabs).

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: SAP and Antarctic Phosphatase catalyze the release of 5'-phosphates, yielding non-phosphorylated DNA ends, which cannot be amplified by LM-PCR. .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. Double-indexing and subsequent library amplification steps were carried out as mentioned in the previous section “Illumina library preparation and sequencing”.

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: In-solution Y. pestis capture and deep-shotgun sequencing Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. Double-indexing and subsequent library amplification steps were carried out as mentioned in the previous section “Illumina library preparation and sequencing”.

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: The 5′ and 3′ halves of the DENV genome were amplified using TaKaRa Ex Taq polymerase and inserted into the pSC-A vector between SacI and XbaI sites with the StrataClone PCR cloning kit (Stratagene). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Synthesized:

    Article Title: A systematic comparison of error correction enzymes by next-generation sequencing
    Article Snippet: Reagents All the oligos were synthesized by Integrated DNA Technologies (IDT). .. Endonuclease V, T7 Endonuclease I, and T7 DNA Ligase were all from New England Biolabs.

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Materials Oligonucleotides were synthesized by Sigma-Genosys (Haverhill, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Real-time Polymerase Chain Reaction:

    Article Title: Population genomics of Mesolithic Scandinavia: Investigating early postglacial migration routes and high-latitude adaptation
    Article Snippet: .. Libraries were built as above, except a DNA repair step in which UDG and endonuclease VIII or USER enzyme (NEB) treatment was included in order to remove deaminated cytosines [ ]. qPCR was performed in order to quantify the number of molecules and the optimal number of PCR cycles prior to amplification for each DNA library. .. Furthermore, this step included extraction blanks, library blanks, and amplification blanks to monitor potential contamination.

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. A quantitative PCR (qPCR) experiment was carried out using 0.2% of the unamplified library to estimate relative library complexities (Additional file : Table S1), and to determine the optimal number of cycles for subsequent indexing PCR, representing the inflection point of the respective library amplification curves, corrected for reaction volume and template amount. qPCR was performed on a PikoReal 96 Real-Time PCR machine (Thermo Fisher Scientific TCR0096) with 3 replicates for each library, involving an initial 10 min denaturation at 95 °C, followed by 40 cycles of: 15 s at 95 °C, 30 s at 60 °C, and 1 min at 72 °C.

    Incubation:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C. .. DNA strands were separated by incubation at 55°C in loading buffer containing 3% Ficoll (type 400) and 300mM NaOH.

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB). .. This mix was incubated for 2 h at 37°C followed by heat inactivation for 20 min at 95°C and was held at 4°C.

    Article Title: Defective base excision repair in the response to DNA damaging agents in triple negative breast cancer
    Article Snippet: .. After permeabilization, cells were incubated with uracil DNA glycosylase (UDG) to remove uracil (NEB #M0304S), formamidopyrimidine [Fapy]-DNA glycosylase (Fapy-DNA glycosylase NEB #M0240S) to remove Fapy lesions, T4 Pyrimidine dimer glycosylase (T4PDG NEB #M-308S) to remove pyrimidine dimer lesions, endonuclease IV (Endo IV NEB #M0304S) to process oxidative damage, AP sites and modifies 3’ phosphates to 3’ OH, and endonuclease VIII (Endo VIII NEB #M0299S) to remove damaged pyrimidines diluted in 1X Thermpol buffer and incubated at 37°C for 1 h. Damage sites are labeled by DNA polymerase I Klenow large fragment (lacking 5’ to 3’ exonuclease activity) incubated with Digoxigenin-11-dUTP, alkali-labile (Dig) (Sigma-Aldrich #DIUTP-RO) at 37°C for 1 h. The Dig-dUTP is covalently incorporated into the DNA for detection of damage sites. .. Cells were then washed in PBS, blocked using 2% BSA in PBS and Dig was then detected using an anti-Dig antibody (abcam #ab420 clone 21H8) at a dilution of 1:250 in 2% BSA in PBS for 1 h at RT.

    Article Title: Selective enrichment of damaged DNA molecules for ancient genome sequencing
    Article Snippet: The wash buffer was discarded and the beads were resuspended in the fill-in reaction mix and incubated for 15 min at 37°C. .. After washing the beads with 200 μL wash buffer A and 200 μL wash buffer B (see for wash buffer recipes), they were resuspended in an excision reaction mix comprised of the following components: 34.25 μL water, 5 μL 10× GeneAmp PCR buffer II (Life Technologies), 4 μL 25 mM MgCl2 , 1.25 μL 1% Tween-20, 0.5 μL 25 mM dNTP, 0.75 μL 10 U/μL endonuclease VIII, and 0.25 μL 1 U/μL E. coli UDG (both New England Biolabs).

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: The linearized DNA substrate (100 fmol) was incubated with 50 ng of purified recombinant GST-mouse AID fusion protein, a gift from Dr. Michael R. Lieber (University of Southern California, Los Angeles, CA), under conditions similar to those used by this investigator , followed by treatment with Shrimp Alkaline Phosphatase (SAP) and Antarctic Phosphatase (New England Biolabs Inc.). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Article Title: Selective enrichment of damaged DNA molecules for ancient genome sequencing
    Article Snippet: The first steps of U selection were performed exactly following steps 1–15 of the protocol described in with two modifications: (1) In step 1, endonuclease VIII and Afu UDG were replaced by 0.5 μL of 1 U/μL USER enzyme mix (New England Biolabs) where applicable. (2) In step 8, the volume of streptavidine beads was increased to 100 μL per reaction. .. The beads were then resuspended in the blunt-end reaction mix, incubated for 15 min at 25°C, and washed exactly as described in step 19 of .

    Activity Assay:

    Article Title: Defective base excision repair in the response to DNA damaging agents in triple negative breast cancer
    Article Snippet: .. After permeabilization, cells were incubated with uracil DNA glycosylase (UDG) to remove uracil (NEB #M0304S), formamidopyrimidine [Fapy]-DNA glycosylase (Fapy-DNA glycosylase NEB #M0240S) to remove Fapy lesions, T4 Pyrimidine dimer glycosylase (T4PDG NEB #M-308S) to remove pyrimidine dimer lesions, endonuclease IV (Endo IV NEB #M0304S) to process oxidative damage, AP sites and modifies 3’ phosphates to 3’ OH, and endonuclease VIII (Endo VIII NEB #M0299S) to remove damaged pyrimidines diluted in 1X Thermpol buffer and incubated at 37°C for 1 h. Damage sites are labeled by DNA polymerase I Klenow large fragment (lacking 5’ to 3’ exonuclease activity) incubated with Digoxigenin-11-dUTP, alkali-labile (Dig) (Sigma-Aldrich #DIUTP-RO) at 37°C for 1 h. The Dig-dUTP is covalently incorporated into the DNA for detection of damage sites. .. Cells were then washed in PBS, blocked using 2% BSA in PBS and Dig was then detected using an anti-Dig antibody (abcam #ab420 clone 21H8) at a dilution of 1:250 in 2% BSA in PBS for 1 h at RT.

    Mass Spectrometry:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: Samples were loaded onto a ZIC-pHILIC column using a Dionex RSLCnano HPLC and the eluate was applied to a Q Exactive mass spectrometer in negative mode. .. For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C.

    Modification:

    Article Title: Defective base excision repair in the response to DNA damaging agents in triple negative breast cancer
    Article Snippet: The Repair Assisted Damage Detection (RADD) assay detects DNA base lesions and strand breaks using an enzymatic cocktail specific for these lesions that removes the lesion and tags the resulting gap or strand break with a modified base for fluorescent detection [ ]. .. After permeabilization, cells were incubated with uracil DNA glycosylase (UDG) to remove uracil (NEB #M0304S), formamidopyrimidine [Fapy]-DNA glycosylase (Fapy-DNA glycosylase NEB #M0240S) to remove Fapy lesions, T4 Pyrimidine dimer glycosylase (T4PDG NEB #M-308S) to remove pyrimidine dimer lesions, endonuclease IV (Endo IV NEB #M0304S) to process oxidative damage, AP sites and modifies 3’ phosphates to 3’ OH, and endonuclease VIII (Endo VIII NEB #M0299S) to remove damaged pyrimidines diluted in 1X Thermpol buffer and incubated at 37°C for 1 h. Damage sites are labeled by DNA polymerase I Klenow large fragment (lacking 5’ to 3’ exonuclease activity) incubated with Digoxigenin-11-dUTP, alkali-labile (Dig) (Sigma-Aldrich #DIUTP-RO) at 37°C for 1 h. The Dig-dUTP is covalently incorporated into the DNA for detection of damage sites.

    High Performance Liquid Chromatography:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: Samples were loaded onto a ZIC-pHILIC column using a Dionex RSLCnano HPLC and the eluate was applied to a Q Exactive mass spectrometer in negative mode. .. For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C.

    Ligation:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. 2.5 U/μL of Circligase II (Biozym 131406) was used and the ligation reaction carried out overnight.

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB). .. Nested Patch driven ligation of the universal primers to correct amplicons is performed by addition of more reactants to the initial tube to result in the following final concentrations: 20 nM each Nested Patch oligo, 40 nM universal primer 1, 40 nM universal primer 2 with 5′ phosphate and 3′ three carbon spacer, 5 U of Ampligase (Epicentre), and 1× Ampligase reaction buffer (Epicentre) in a total volume of 25 μL.

    Article Title: Telomere Trimming and DNA Damage as Signatures of High Risk Neuroblastoma
    Article Snippet: .. In some of STELA assays, 50 ng of genomic DNA was digested with 5 U of Endonuclease VIII (NEB) and 4 U of Fpg (NEB) in 1× CutSmart buffer (NEB) at 37 °C for 2 h. Both glycosylases were inactivated at 75 °C for 20 min. Digested DNAs were applied to the ligation reaction for STELA analysis. .. In-Gel Hybridization Analysis of ssDNA on Telomere G- and C-Strand The standard in-gel hybridization analysis was performed using a combination of established protocols with minor modification .

    Article Title: Selective enrichment of damaged DNA molecules for ancient genome sequencing
    Article Snippet: After discarding the wash buffer, the beads were resuspended in the ligation reaction mix and incubated for 1 h at 22°C. .. After washing the beads with 200 μL wash buffer A and 200 μL wash buffer B (see for wash buffer recipes), they were resuspended in an excision reaction mix comprised of the following components: 34.25 μL water, 5 μL 10× GeneAmp PCR buffer II (Life Technologies), 4 μL 25 mM MgCl2 , 1.25 μL 1% Tween-20, 0.5 μL 25 mM dNTP, 0.75 μL 10 U/μL endonuclease VIII, and 0.25 μL 1 U/μL E. coli UDG (both New England Biolabs).

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C. .. The fragmented DNA pool was excised from 1.5% agarose gel and then blunted with 2 units of T4 DNA polymerase (New England Biolabs) at 12 °C for 30 min, followed by heat inactivation at 75 °C for 20 min. Ligation of fragments directly into a SmaI-digested and dephosphorylated pIIIA MS2 vector (9.1 kb) was found to be very inefficient.

    Generated:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. The Klenow Fragment of DNA polymerase I (Thermo Fisher Scientific EP0051) was used for the fill-in reaction [ ].

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    DNA Sequencing:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: Clones were blue-white screened and validated by DNA sequencing. .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Sequencing:

    Article Title: Population genomics of Mesolithic Scandinavia: Investigating early postglacial migration routes and high-latitude adaptation
    Article Snippet: From these 126 extracts, a total of 258 damage-repaired double-stranded libraries were built for Illumina sequencing platforms. .. Libraries were built as above, except a DNA repair step in which UDG and endonuclease VIII or USER enzyme (NEB) treatment was included in order to remove deaminated cytosines [ ]. qPCR was performed in order to quantify the number of molecules and the optimal number of PCR cycles prior to amplification for each DNA library.

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. The Klenow Fragment of DNA polymerase I (Thermo Fisher Scientific EP0051) was used for the fill-in reaction [ ].

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: .. Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. Double-indexing and subsequent library amplification steps were carried out as mentioned in the previous section “Illumina library preparation and sequencing”.

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: .. In-solution Y. pestis capture and deep-shotgun sequencing Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. Double-indexing and subsequent library amplification steps were carried out as mentioned in the previous section “Illumina library preparation and sequencing”.

    Binding Assay:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: The lower centrifugation speed was chosen based on our previous experience that the binding apparatus can break during centrifugation at higher speeds. .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Immunofluorescence:

    Article Title: Defective base excision repair in the response to DNA damaging agents in triple negative breast cancer
    Article Snippet: DNA damage analysis utilizing RADD Cells were plated in 8-well chambered coverglass, fixed, and permeabilized using the same procedure as for immunofluorescence. .. After permeabilization, cells were incubated with uracil DNA glycosylase (UDG) to remove uracil (NEB #M0304S), formamidopyrimidine [Fapy]-DNA glycosylase (Fapy-DNA glycosylase NEB #M0240S) to remove Fapy lesions, T4 Pyrimidine dimer glycosylase (T4PDG NEB #M-308S) to remove pyrimidine dimer lesions, endonuclease IV (Endo IV NEB #M0304S) to process oxidative damage, AP sites and modifies 3’ phosphates to 3’ OH, and endonuclease VIII (Endo VIII NEB #M0299S) to remove damaged pyrimidines diluted in 1X Thermpol buffer and incubated at 37°C for 1 h. Damage sites are labeled by DNA polymerase I Klenow large fragment (lacking 5’ to 3’ exonuclease activity) incubated with Digoxigenin-11-dUTP, alkali-labile (Dig) (Sigma-Aldrich #DIUTP-RO) at 37°C for 1 h. The Dig-dUTP is covalently incorporated into the DNA for detection of damage sites.

    DNA Extraction:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: DNA extraction was performed according to Dabney et al. [ ] with reduced bone powder input mass, and reduced centrifugation speed of the binding apparatus at approximately 450×g . .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Article Title: Selective enrichment of damaged DNA molecules for ancient genome sequencing
    Article Snippet: Paragraph title: DNA extraction and library preparation ... After washing the beads with 200 μL wash buffer A and 200 μL wash buffer B (see for wash buffer recipes), they were resuspended in an excision reaction mix comprised of the following components: 34.25 μL water, 5 μL 10× GeneAmp PCR buffer II (Life Technologies), 4 μL 25 mM MgCl2 , 1.25 μL 1% Tween-20, 0.5 μL 25 mM dNTP, 0.75 μL 10 U/μL endonuclease VIII, and 0.25 μL 1 U/μL E. coli UDG (both New England Biolabs).

    Molecular Cloning:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: Paragraph title: Molecular Cloning ... In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Mutagenesis:

    Article Title: A systematic comparison of error correction enzymes by next-generation sequencing
    Article Snippet: The Surveyor Mutation Detection Kit was from Transgenomic. .. Endonuclease V, T7 Endonuclease I, and T7 DNA Ligase were all from New England Biolabs.

    Isolation:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: Viral RNA was isolated from DENV-2 strain 16681 and used to generate full-length cDNA according to the SuperScript III procedure (Life Technologies, Inc.). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Size-exclusion Chromatography:

    Article Title: Telomere Trimming and DNA Damage as Signatures of High Risk Neuroblastoma
    Article Snippet: Twenty-nine cycles of 15 sec at 94 °C, 30 sec at 64 °C and 10 min at 68 °C were used for the alternative STELA. .. In some of STELA assays, 50 ng of genomic DNA was digested with 5 U of Endonuclease VIII (NEB) and 4 U of Fpg (NEB) in 1× CutSmart buffer (NEB) at 37 °C for 2 h. Both glycosylases were inactivated at 75 °C for 20 min. Digested DNAs were applied to the ligation reaction for STELA analysis.

    Labeling:

    Article Title: Defective base excision repair in the response to DNA damaging agents in triple negative breast cancer
    Article Snippet: .. After permeabilization, cells were incubated with uracil DNA glycosylase (UDG) to remove uracil (NEB #M0304S), formamidopyrimidine [Fapy]-DNA glycosylase (Fapy-DNA glycosylase NEB #M0240S) to remove Fapy lesions, T4 Pyrimidine dimer glycosylase (T4PDG NEB #M-308S) to remove pyrimidine dimer lesions, endonuclease IV (Endo IV NEB #M0304S) to process oxidative damage, AP sites and modifies 3’ phosphates to 3’ OH, and endonuclease VIII (Endo VIII NEB #M0299S) to remove damaged pyrimidines diluted in 1X Thermpol buffer and incubated at 37°C for 1 h. Damage sites are labeled by DNA polymerase I Klenow large fragment (lacking 5’ to 3’ exonuclease activity) incubated with Digoxigenin-11-dUTP, alkali-labile (Dig) (Sigma-Aldrich #DIUTP-RO) at 37°C for 1 h. The Dig-dUTP is covalently incorporated into the DNA for detection of damage sites. .. Cells were then washed in PBS, blocked using 2% BSA in PBS and Dig was then detected using an anti-Dig antibody (abcam #ab420 clone 21H8) at a dilution of 1:250 in 2% BSA in PBS for 1 h at RT.

    Purification:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: Both purification and digestion was carried out in the presence of a 20μM concentration of the adenosine deaminase (ADA) inhibitor deoxycoformycin (DCF)(Sigma). .. For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C.

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Plasmid, gel extraction and PCR purification kits were purchased from Qiagen (Crawley, UK).

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: The linearized DNA substrate (100 fmol) was incubated with 50 ng of purified recombinant GST-mouse AID fusion protein, a gift from Dr. Michael R. Lieber (University of Southern California, Los Angeles, CA), under conditions similar to those used by this investigator , followed by treatment with Shrimp Alkaline Phosphatase (SAP) and Antarctic Phosphatase (New England Biolabs Inc.). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Polymerase Chain Reaction:

    Article Title: Population genomics of Mesolithic Scandinavia: Investigating early postglacial migration routes and high-latitude adaptation
    Article Snippet: .. Libraries were built as above, except a DNA repair step in which UDG and endonuclease VIII or USER enzyme (NEB) treatment was included in order to remove deaminated cytosines [ ]. qPCR was performed in order to quantify the number of molecules and the optimal number of PCR cycles prior to amplification for each DNA library. .. Furthermore, this step included extraction blanks, library blanks, and amplification blanks to monitor potential contamination.

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Plasmid, gel extraction and PCR purification kits were purchased from Qiagen (Crawley, UK).

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. A quantitative PCR (qPCR) experiment was carried out using 0.2% of the unamplified library to estimate relative library complexities (Additional file : Table S1), and to determine the optimal number of cycles for subsequent indexing PCR, representing the inflection point of the respective library amplification curves, corrected for reaction volume and template amount. qPCR was performed on a PikoReal 96 Real-Time PCR machine (Thermo Fisher Scientific TCR0096) with 3 replicates for each library, involving an initial 10 min denaturation at 95 °C, followed by 40 cycles of: 15 s at 95 °C, 30 s at 60 °C, and 1 min at 72 °C.

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Paragraph title: Nested Patch PCR ... Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: Telomere Trimming and DNA Damage as Signatures of High Risk Neuroblastoma
    Article Snippet: To ensure adequate coverage of the telomere size distribution, we performed 3 to 6 parallel PCR reactions for each ligated DNA sample. .. In some of STELA assays, 50 ng of genomic DNA was digested with 5 U of Endonuclease VIII (NEB) and 4 U of Fpg (NEB) in 1× CutSmart buffer (NEB) at 37 °C for 2 h. Both glycosylases were inactivated at 75 °C for 20 min. Digested DNAs were applied to the ligation reaction for STELA analysis.

    Article Title: Selective enrichment of damaged DNA molecules for ancient genome sequencing
    Article Snippet: .. After washing the beads with 200 μL wash buffer A and 200 μL wash buffer B (see for wash buffer recipes), they were resuspended in an excision reaction mix comprised of the following components: 34.25 μL water, 5 μL 10× GeneAmp PCR buffer II (Life Technologies), 4 μL 25 mM MgCl2 , 1.25 μL 1% Tween-20, 0.5 μL 25 mM dNTP, 0.75 μL 10 U/μL endonuclease VIII, and 0.25 μL 1 U/μL E. coli UDG (both New England Biolabs). ..

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C. .. The fragmented DNA pool was excised from 1.5% agarose gel and then blunted with 2 units of T4 DNA polymerase (New England Biolabs) at 12 °C for 30 min, followed by heat inactivation at 75 °C for 20 min. Ligation of fragments directly into a SmaI-digested and dephosphorylated pIIIA MS2 vector (9.1 kb) was found to be very inefficient.

    Selection:

    Article Title: Selective enrichment of damaged DNA molecules for ancient genome sequencing
    Article Snippet: .. The first steps of U selection were performed exactly following steps 1–15 of the protocol described in with two modifications: (1) In step 1, endonuclease VIII and Afu UDG were replaced by 0.5 μL of 1 U/μL USER enzyme mix (New England Biolabs) where applicable. (2) In step 8, the volume of streptavidine beads was increased to 100 μL per reaction. .. U selection was then continued as follows: A blunt-end reaction mix was prepared by combining 83.1 μL water, 10 μL 10× Tango buffer (Thermo Scientific), 2.5 μL 1% Tween 20, 0.4 μL 25 mM dNTP, 1 μL 100 mM ATP, 1 μL 5 U/μL T4 DNA polymerase and 2 μL 10 U/μL T4 polynucleotide kinase (both Thermo Scientific).

    Recombinant:

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.). .. Endo VIII possesses both N-glycosylase and APE activities, thereby cleaving 3′ and 5′ to the abasic site generated by Ung or by itself and leaving a 5′-phosphate and a 3′-phosphate.

    Gel Extraction:

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Plasmid, gel extraction and PCR purification kits were purchased from Qiagen (Crawley, UK).

    Plasmid Preparation:

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Plasmid, gel extraction and PCR purification kits were purchased from Qiagen (Crawley, UK).

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. In addition, 1–2 μg of samples RT5 and RT6 were in-solution captured as described previously , where a combination of the following Y. pestis and Y. pseudotuberculosis genomes were used as templates for probe design: CO92 chromosome , CO92 plasmid pMT1 , CO92 plasmid pCD1 , KIM 10 chromosome , Pestoides F chromosome ( ) and Y. pseudotuberculosis IP32953 chromosome ( ).

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: In-solution Y. pestis capture and deep-shotgun sequencing Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. In addition, 1–2 μg of samples RT5 and RT6 were in-solution captured as described previously , where a combination of the following Y. pestis and Y. pseudotuberculosis genomes were used as templates for probe design: CO92 chromosome (NC_003143.1), CO92 plasmid pMT1 (NC_003134.1), CO92 plasmid pCD1 (NC_003131.1), KIM 10 chromosome (NC_004088.1), Pestoides F chromosome (NC_009381.1) and Y. pseudotuberculosis IP32953 chromosome (NC_006155.1).

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: The 5′ and 3′ halves of the DENV genome were amplified using TaKaRa Ex Taq polymerase and inserted into the pSC-A vector between SacI and XbaI sites with the StrataClone PCR cloning kit (Stratagene). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Software:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: The instrument was operated in tSIM mode and data were quantified using XCalibur 2.0 software. .. For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C.

    Article Title: Telomere Trimming and DNA Damage as Signatures of High Risk Neuroblastoma
    Article Snippet: Following PhosphorImager scanning (GE Healthcare), the sizes of individual telomeres were determined using TESLA software , and the results analyzed and plotted using Prism (GraphPad Software). .. In some of STELA assays, 50 ng of genomic DNA was digested with 5 U of Endonuclease VIII (NEB) and 4 U of Fpg (NEB) in 1× CutSmart buffer (NEB) at 37 °C for 2 h. Both glycosylases were inactivated at 75 °C for 20 min. Digested DNAs were applied to the ligation reaction for STELA analysis.

    Electrophoresis:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: .. For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C. .. DNA strands were separated by incubation at 55°C in loading buffer containing 3% Ficoll (type 400) and 300mM NaOH.

    Article Title: Telomere Trimming and DNA Damage as Signatures of High Risk Neuroblastoma
    Article Snippet: The reaction products were analyzed by electrophoresis in 0.8% agarose gels and subjected to Southern using the appropriate subtelomeric probes or a telomere repeat probe ((TTAGGG)82 ). .. In some of STELA assays, 50 ng of genomic DNA was digested with 5 U of Endonuclease VIII (NEB) and 4 U of Fpg (NEB) in 1× CutSmart buffer (NEB) at 37 °C for 2 h. Both glycosylases were inactivated at 75 °C for 20 min. Digested DNAs were applied to the ligation reaction for STELA analysis.

    RNA Expression:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C. .. To this end, a 3.7-kbp compact entry vector was created by inserting the MS2-2 region (925 bp) of the standard Y3H pIIIA MS2-2 plasmid, necessary for RNA expression, into the pCR8/GW/TOPO vector (Invitrogen).

    Agarose Gel Electrophoresis:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication *
    Article Snippet: In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C. .. The fragmented DNA pool was excised from 1.5% agarose gel and then blunted with 2 units of T4 DNA polymerase (New England Biolabs) at 12 °C for 30 min, followed by heat inactivation at 75 °C for 20 min. Ligation of fragments directly into a SmaI-digested and dephosphorylated pIIIA MS2 vector (9.1 kb) was found to be very inefficient.

    Concentration Assay:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: Both purification and digestion was carried out in the presence of a 20μM concentration of the adenosine deaminase (ADA) inhibitor deoxycoformycin (DCF)(Sigma). .. For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C.

    Staining:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C. .. After electrophoresis, gels were neutralized and stained with SYBR Gold (Invitrogen).

    Article Title: Defective base excision repair in the response to DNA damaging agents in triple negative breast cancer
    Article Snippet: After permeabilization, cells were incubated with uracil DNA glycosylase (UDG) to remove uracil (NEB #M0304S), formamidopyrimidine [Fapy]-DNA glycosylase (Fapy-DNA glycosylase NEB #M0240S) to remove Fapy lesions, T4 Pyrimidine dimer glycosylase (T4PDG NEB #M-308S) to remove pyrimidine dimer lesions, endonuclease IV (Endo IV NEB #M0304S) to process oxidative damage, AP sites and modifies 3’ phosphates to 3’ OH, and endonuclease VIII (Endo VIII NEB #M0299S) to remove damaged pyrimidines diluted in 1X Thermpol buffer and incubated at 37°C for 1 h. Damage sites are labeled by DNA polymerase I Klenow large fragment (lacking 5’ to 3’ exonuclease activity) incubated with Digoxigenin-11-dUTP, alkali-labile (Dig) (Sigma-Aldrich #DIUTP-RO) at 37°C for 1 h. The Dig-dUTP is covalently incorporated into the DNA for detection of damage sites. .. Samples were then stained with goat anti-Mouse Alexa Fluor 546 at 1:400 in 2% BSA in PBS for 45 min at RT, and nuclei were stained as for immunofluorescence.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs endonuclease viii
    Inosine incorporation into nucleic acids in human and mouse cells lacking functional ITPase. (A) Bar chart showing a significantly increased inosine base content of RNA in lymphoblastoid cell lines (LCLs) derived from an affected individual (5196 III:3) as compared to that derived from her mother (5196 II:2) (B) Bar chart showing significantly increased inosine base content of RNA in Itpa -null mouse embryonic stem (ES) cells as compared to control ES cells. (C) Bar chart showing increased inosine base content of RNA derived from Itpa -null tissue as compared to controls. Inosine content is significantly higher in RNA derived from Itpa -null hearts than that stage-matched control hearts. There was no significant (ns) difference in IMP content in RNA derived from Itpa -null compared to control kidneys. Error bars ±SEM. (D) Alkaline-gel electrophoresis of total DNA and mtDNA extracted from mouse ES cells untreated or treated with bacterial <t>endonuclease</t> V (EndoV). All lanes shown are on the same gel, and these data are representative of three independent experiments. (E) Densitometry of gels shown in D does not identify any difference between control (green lines) and Itpa -null (red lines) cells for genomic DNA (top panel) but for mtDNA (bottom panel) there is a shift in the migration pattern in the Itpa -null cells suggestive of an increase EndoV digestion compared to the controls. (F) Long-range PCR (LR-PCR) of the mitochondrial genome shows no evidence for increased deletions in Itpa -null ES cells as compared to controls. The data shown are representative of three independent experiments. The primers used are listed in S2 Table . (G) Quantitative RT-PCR (qPCR) on total DNA shows that ratios of mtDNA to genomic DNA are comparable between control and Itpa -null cells. The data shown are derived from analysis of six individual DNA preparations per genotype, each analysed in triplicate. All the primers used are listed in S2 Table . (H,I) Alkaline comet assays on LCLs derived from an affected individual (5196 III:3) and her mother (5196 II:2) and null and parental mouse ESC respectively with cells exposed to hydrogen peroxide as a positive control. Neither cell type shows evidence for increase single or double strand breaks in genomic DNA. Quantitation of DNA damage is by Olive tail moment (the product of the tail length and the fraction of total DNA in the tail) and is a measure of both the extent of DNA fragmentation and size of fragmented DNA.
    Endonuclease Viii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/endonuclease viii/product/New England Biolabs
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    endonuclease viii - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    Inosine incorporation into nucleic acids in human and mouse cells lacking functional ITPase. (A) Bar chart showing a significantly increased inosine base content of RNA in lymphoblastoid cell lines (LCLs) derived from an affected individual (5196 III:3) as compared to that derived from her mother (5196 II:2) (B) Bar chart showing significantly increased inosine base content of RNA in Itpa -null mouse embryonic stem (ES) cells as compared to control ES cells. (C) Bar chart showing increased inosine base content of RNA derived from Itpa -null tissue as compared to controls. Inosine content is significantly higher in RNA derived from Itpa -null hearts than that stage-matched control hearts. There was no significant (ns) difference in IMP content in RNA derived from Itpa -null compared to control kidneys. Error bars ±SEM. (D) Alkaline-gel electrophoresis of total DNA and mtDNA extracted from mouse ES cells untreated or treated with bacterial endonuclease V (EndoV). All lanes shown are on the same gel, and these data are representative of three independent experiments. (E) Densitometry of gels shown in D does not identify any difference between control (green lines) and Itpa -null (red lines) cells for genomic DNA (top panel) but for mtDNA (bottom panel) there is a shift in the migration pattern in the Itpa -null cells suggestive of an increase EndoV digestion compared to the controls. (F) Long-range PCR (LR-PCR) of the mitochondrial genome shows no evidence for increased deletions in Itpa -null ES cells as compared to controls. The data shown are representative of three independent experiments. The primers used are listed in S2 Table . (G) Quantitative RT-PCR (qPCR) on total DNA shows that ratios of mtDNA to genomic DNA are comparable between control and Itpa -null cells. The data shown are derived from analysis of six individual DNA preparations per genotype, each analysed in triplicate. All the primers used are listed in S2 Table . (H,I) Alkaline comet assays on LCLs derived from an affected individual (5196 III:3) and her mother (5196 II:2) and null and parental mouse ESC respectively with cells exposed to hydrogen peroxide as a positive control. Neither cell type shows evidence for increase single or double strand breaks in genomic DNA. Quantitation of DNA damage is by Olive tail moment (the product of the tail length and the fraction of total DNA in the tail) and is a measure of both the extent of DNA fragmentation and size of fragmented DNA.

    Journal: PLoS Genetics

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy

    doi: 10.1371/journal.pgen.1007605

    Figure Lengend Snippet: Inosine incorporation into nucleic acids in human and mouse cells lacking functional ITPase. (A) Bar chart showing a significantly increased inosine base content of RNA in lymphoblastoid cell lines (LCLs) derived from an affected individual (5196 III:3) as compared to that derived from her mother (5196 II:2) (B) Bar chart showing significantly increased inosine base content of RNA in Itpa -null mouse embryonic stem (ES) cells as compared to control ES cells. (C) Bar chart showing increased inosine base content of RNA derived from Itpa -null tissue as compared to controls. Inosine content is significantly higher in RNA derived from Itpa -null hearts than that stage-matched control hearts. There was no significant (ns) difference in IMP content in RNA derived from Itpa -null compared to control kidneys. Error bars ±SEM. (D) Alkaline-gel electrophoresis of total DNA and mtDNA extracted from mouse ES cells untreated or treated with bacterial endonuclease V (EndoV). All lanes shown are on the same gel, and these data are representative of three independent experiments. (E) Densitometry of gels shown in D does not identify any difference between control (green lines) and Itpa -null (red lines) cells for genomic DNA (top panel) but for mtDNA (bottom panel) there is a shift in the migration pattern in the Itpa -null cells suggestive of an increase EndoV digestion compared to the controls. (F) Long-range PCR (LR-PCR) of the mitochondrial genome shows no evidence for increased deletions in Itpa -null ES cells as compared to controls. The data shown are representative of three independent experiments. The primers used are listed in S2 Table . (G) Quantitative RT-PCR (qPCR) on total DNA shows that ratios of mtDNA to genomic DNA are comparable between control and Itpa -null cells. The data shown are derived from analysis of six individual DNA preparations per genotype, each analysed in triplicate. All the primers used are listed in S2 Table . (H,I) Alkaline comet assays on LCLs derived from an affected individual (5196 III:3) and her mother (5196 II:2) and null and parental mouse ESC respectively with cells exposed to hydrogen peroxide as a positive control. Neither cell type shows evidence for increase single or double strand breaks in genomic DNA. Quantitation of DNA damage is by Olive tail moment (the product of the tail length and the fraction of total DNA in the tail) and is a measure of both the extent of DNA fragmentation and size of fragmented DNA.

    Article Snippet: For analysis of genomic and mitochondrial DNA composition by Endov-digestion and alkaline-gel electrophoresis, DNA samples were treated with 10 U of Endonuclease V (NEB) with the supplied buffer for 2 hours at 37°C.

    Techniques: Functional Assay, Derivative Assay, Nucleic Acid Electrophoresis, Migration, Polymerase Chain Reaction, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Positive Control, Quantitation Assay