gene encoding cre recombinase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Cre Recombinase
    Description:
    Cre Recombinase 250 units
    Catalog Number:
    m0298l
    Price:
    281
    Size:
    250 units
    Category:
    Topoisomerases
    Buy from Supplier


    Structured Review

    New England Biolabs gene encoding cre recombinase
    Cre Recombinase
    Cre Recombinase 250 units
    https://www.bioz.com/result/gene encoding cre recombinase/product/New England Biolabs
    Average 90 stars, based on 150 article reviews
    Price from $9.99 to $1999.99
    gene encoding cre recombinase - by Bioz Stars, 2020-03
    90/100 stars

    Images

    1) Product Images from "Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †"

    Article Title: Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †

    Journal: Infection and Immunity

    doi: 10.1128/IAI.01059-09

    Deletion of loxP -flanked regions of lp54 after introduction of Cre recombinase. (A and B) Schematic diagrams showing the excision of the intervening DNA between loxP sites (filled arrowheads) present in the lp54 loci bba07 and bba01 (A) or bba07 and
    Figure Legend Snippet: Deletion of loxP -flanked regions of lp54 after introduction of Cre recombinase. (A and B) Schematic diagrams showing the excision of the intervening DNA between loxP sites (filled arrowheads) present in the lp54 loci bba07 and bba01 (A) or bba07 and

    Techniques Used:

    Loss of fluorescence by B. burgdorferi carrying loxP -flanked GFP after introduction of Cre recombinase. Strain B31-A34 was first transformed with shuttle vector pBSV2G- loxP - flaB p- gfp (Fig. ) and subsequently transformed with the compatible
    Figure Legend Snippet: Loss of fluorescence by B. burgdorferi carrying loxP -flanked GFP after introduction of Cre recombinase. Strain B31-A34 was first transformed with shuttle vector pBSV2G- loxP - flaB p- gfp (Fig. ) and subsequently transformed with the compatible

    Techniques Used: Fluorescence, Transformation Assay, Plasmid Preparation

    Schematic diagram illustrating the loxP /Cre-mediated deletion of the gene encoding GFP. The introduction of Cre recombinase into B. burgdorferi containing flaB p- gfp flanked by loxP sites should result in recombination between loxP sites, the excision
    Figure Legend Snippet: Schematic diagram illustrating the loxP /Cre-mediated deletion of the gene encoding GFP. The introduction of Cre recombinase into B. burgdorferi containing flaB p- gfp flanked by loxP sites should result in recombination between loxP sites, the excision

    Techniques Used:

    2) Product Images from "Fluorescence ImmunoPrecipitation (FLIP): a Novel Assay for High-Throughput IP"

    Article Title: Fluorescence ImmunoPrecipitation (FLIP): a Novel Assay for High-Throughput IP

    Journal: Biological Procedures Online

    doi: 10.1186/s12575-016-0046-x

    Mini FLIP. a Decreasing amounts of a YFP-tagged protein (HES-1) expressed in HeLa cells transfected with a HuEV-A construct were used for FLIP analysis in just 100 ml of total volume (images show one of the two pictures used for the analysis). IgG antibodies were used as for previous experiments as control, while FLAG antibodies were used to IP the YFP-tagged target protein. b Comparison of the FLIP signal obtained using control IgG antibodies and FLAG antibodies that specifically IP the target protein shows a FLIP signal higher than background, even when using the lower amount of YFP-protein (6.7 ng YFP/5 ml of lysate). The values reported in the tables are graphed in the histogram. The linear correlation R 2 value between the amount of YFP used for IP and the FLIP signal is reported
    Figure Legend Snippet: Mini FLIP. a Decreasing amounts of a YFP-tagged protein (HES-1) expressed in HeLa cells transfected with a HuEV-A construct were used for FLIP analysis in just 100 ml of total volume (images show one of the two pictures used for the analysis). IgG antibodies were used as for previous experiments as control, while FLAG antibodies were used to IP the YFP-tagged target protein. b Comparison of the FLIP signal obtained using control IgG antibodies and FLAG antibodies that specifically IP the target protein shows a FLIP signal higher than background, even when using the lower amount of YFP-protein (6.7 ng YFP/5 ml of lysate). The values reported in the tables are graphed in the histogram. The linear correlation R 2 value between the amount of YFP used for IP and the FLIP signal is reported

    Techniques Used: Transfection, Construct

    a Schematic of HuEV-A expression. ColE1 ori = bacterial origin of replication; Amp. = Ampicillin resistance cassette; EBNA-1 = Epstein-Barr nuclear antigen 1; OriP = origin of plasmid replication; Gateway = Gateway cloning cassette; Tet-CMV prom. = Doxycycline inducible promoter; FRT = flippase recognition target; FLP = flippase recombinase; LoxP = Lox sequence; Cre = Cre recombinase; TEV = TEV protease cleavage site. Note that treatment with Cre recombinase or FLP recombinase can produce a “short tag” or untagged derivative of the originally cloned ORF, respectively. b Immunoblot of cell lysates from HeLa cells expressing and empty HuEV-A vector or HES1, URI, or Art-27 proteins expressed from the HuEV-A expression vector. A version of the HuEV-A expression vectors not containing YFP in the tag (after Cre treatment of the vector) was also used for each of the proteins and for the empty vector. The proteins were detected with a FLAG-M2 antibody shown in green. Tubulin (shown in red) was used as loading control
    Figure Legend Snippet: a Schematic of HuEV-A expression. ColE1 ori = bacterial origin of replication; Amp. = Ampicillin resistance cassette; EBNA-1 = Epstein-Barr nuclear antigen 1; OriP = origin of plasmid replication; Gateway = Gateway cloning cassette; Tet-CMV prom. = Doxycycline inducible promoter; FRT = flippase recognition target; FLP = flippase recombinase; LoxP = Lox sequence; Cre = Cre recombinase; TEV = TEV protease cleavage site. Note that treatment with Cre recombinase or FLP recombinase can produce a “short tag” or untagged derivative of the originally cloned ORF, respectively. b Immunoblot of cell lysates from HeLa cells expressing and empty HuEV-A vector or HES1, URI, or Art-27 proteins expressed from the HuEV-A expression vector. A version of the HuEV-A expression vectors not containing YFP in the tag (after Cre treatment of the vector) was also used for each of the proteins and for the empty vector. The proteins were detected with a FLAG-M2 antibody shown in green. Tubulin (shown in red) was used as loading control

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Sequencing

    3) Product Images from "Fluorescence ImmunoPrecipitation (FLIP): a Novel Assay for High-Throughput IP"

    Article Title: Fluorescence ImmunoPrecipitation (FLIP): a Novel Assay for High-Throughput IP

    Journal: Biological Procedures Online

    doi: 10.1186/s12575-016-0046-x

    a Schematic of HuEV-A expression. ColE1 ori = bacterial origin of replication; Amp. = Ampicillin resistance cassette; EBNA-1 = Epstein-Barr nuclear antigen 1; OriP = origin of plasmid replication; Gateway = Gateway cloning cassette; Tet-CMV prom. = Doxycycline inducible promoter; FRT = flippase recognition target; FLP = flippase recombinase; LoxP = Lox sequence; Cre = Cre recombinase; TEV = TEV protease cleavage site. Note that treatment with Cre recombinase or FLP recombinase can produce a “short tag” or untagged derivative of the originally cloned ORF, respectively. b Immunoblot of cell lysates from HeLa cells expressing and empty HuEV-A vector or HES1, URI, or Art-27 proteins expressed from the HuEV-A expression vector. A version of the HuEV-A expression vectors not containing YFP in the tag (after Cre treatment of the vector) was also used for each of the proteins and for the empty vector. The proteins were detected with a FLAG-M2 antibody shown in green. Tubulin (shown in red) was used as loading control
    Figure Legend Snippet: a Schematic of HuEV-A expression. ColE1 ori = bacterial origin of replication; Amp. = Ampicillin resistance cassette; EBNA-1 = Epstein-Barr nuclear antigen 1; OriP = origin of plasmid replication; Gateway = Gateway cloning cassette; Tet-CMV prom. = Doxycycline inducible promoter; FRT = flippase recognition target; FLP = flippase recombinase; LoxP = Lox sequence; Cre = Cre recombinase; TEV = TEV protease cleavage site. Note that treatment with Cre recombinase or FLP recombinase can produce a “short tag” or untagged derivative of the originally cloned ORF, respectively. b Immunoblot of cell lysates from HeLa cells expressing and empty HuEV-A vector or HES1, URI, or Art-27 proteins expressed from the HuEV-A expression vector. A version of the HuEV-A expression vectors not containing YFP in the tag (after Cre treatment of the vector) was also used for each of the proteins and for the empty vector. The proteins were detected with a FLAG-M2 antibody shown in green. Tubulin (shown in red) was used as loading control

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Sequencing

    Related Articles

    Clone Assay:

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: .. Effects of increasing concentrations of Cre enzyme on cloning efficiency Next, we tested whether we can further boost cloning efficiency by increasing the concentrations of cre recombinase. ..

    Article Title: Self-replication of circular DNA by a self-encoded DNA polymerase through rolling-circle replication and recombination
    Article Snippet: .. First, linearized DNA molecules (0.56 ng/μl) of the original or evolved clones were incubated in the TTcDR mixture without dNTPs to avoid DNA polymerization at 30 °C for 4 h in the absence or presence of Cre recombinase (30 mU/μl). .. Second, a 1/6 (v/v) volume solution containing a dNTP mixture (0.6 mM each), the original circular DNA (0.56 ng/μl), and streptomycin (30 ng/μl) were added, and the mixture was incubated at 30 °C for 16 h to conduct the DNA polymerization by each polymerase expressed in the first reaction.

    Article Title: Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †
    Article Snippet: .. The gene encoding Cre recombinase was kindly provided by Michael Culbertson (University of Wisconsin-Madison) and was amplified with Taq polymerase (New England Biolabs, Ipswich, MA) by using primers 3 and 4 (Table ) and cloned into pBSV2. .. The cre gene was digested from pBSV2 with NdeI and XbaI and cloned into pBSV2ex ( ) to create the cre expression construct pBSV2 ex - flgB p- cre .

    Amplification:

    Article Title: Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †
    Article Snippet: .. The gene encoding Cre recombinase was kindly provided by Michael Culbertson (University of Wisconsin-Madison) and was amplified with Taq polymerase (New England Biolabs, Ipswich, MA) by using primers 3 and 4 (Table ) and cloned into pBSV2. .. The cre gene was digested from pBSV2 with NdeI and XbaI and cloned into pBSV2ex ( ) to create the cre expression construct pBSV2 ex - flgB p- cre .

    Molecular Cloning:

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: Cre recombinase effectively inverted ORF in FLEX plasmid in vitro Although conventional molecular cloning approach can be taken to reverse the ORF in FLEX-based plasmids, this approach can be time consuming and labor intensive. .. Therefore we decided to test whether a more straightforward and efficient in vitro protocol could flip the ORF with commercially available Cre recombinase (New England Biolabs ).

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: Although conventional molecular cloning approach can be taken to reverse the ORF in FLEX-based plasmids, this approach can be time consuming and labor intensive. .. Therefore we decided to test whether a more straightforward and efficient in vitro protocol could flip the ORF with commercially available Cre recombinase ( New England Biolabs ).

    Construct:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: The Taok2tm1 targeting construct was generated using an approach similar to that reported by . .. Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site.

    Article Title: Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †
    Article Snippet: The gene encoding Cre recombinase was kindly provided by Michael Culbertson (University of Wisconsin-Madison) and was amplified with Taq polymerase (New England Biolabs, Ipswich, MA) by using primers 3 and 4 (Table ) and cloned into pBSV2. .. The cre gene was digested from pBSV2 with NdeI and XbaI and cloned into pBSV2ex ( ) to create the cre expression construct pBSV2 ex - flgB p- cre .

    Modification:

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: Cell culture and ex vivo characterization of cre-dependent Fyn knockdown by pLVX-FLEX-shFyn HEK293T cells were cultured in Dulbecco's Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1 × MEM non-essential amino acid solution in a 5% CO2 incubator. .. Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction.

    Incubation:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: .. Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site. .. To introduce a second lox P site into the construct, plasmid DNA from this clone was incubated with plasmid pGPS21loxFRTNeo ( ) in the presence of TnsABC transposase (New England Biolabs). pGPS21loxFRTNeo contains two Tn7-derived transposable elements flanking two lox P sites, two FRT sites and the neomycin phosphotransferase gene (Neo) placed downstream of the EM7 and PGK promotors to confer kanamycin and G418 resistance in E. coli and mouse embryonic stem (ES) cells, respectively.

    Article Title: Self-replication of circular DNA by a self-encoded DNA polymerase through rolling-circle replication and recombination
    Article Snippet: .. First, linearized DNA molecules (0.56 ng/μl) of the original or evolved clones were incubated in the TTcDR mixture without dNTPs to avoid DNA polymerization at 30 °C for 4 h in the absence or presence of Cre recombinase (30 mU/μl). .. Second, a 1/6 (v/v) volume solution containing a dNTP mixture (0.6 mM each), the original circular DNA (0.56 ng/μl), and streptomycin (30 ng/μl) were added, and the mixture was incubated at 30 °C for 16 h to conduct the DNA polymerization by each polymerase expressed in the first reaction.

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: .. We incubated 250 ng of plasmid DNA with 1 μl (1 unit/μl) of Cre recombinase for 30 min at 37 ° C. The Cre recombinase was then heat inactivated (10 min at 70 °C) and the whole reaction volume (15 μl) was used to transform Stbl3 competent cells. .. From the agar plate we picked 12 colonies which were further expanded before isolation of the plasmid using a standard mini-prep protocol.

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: .. Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction. .. The plasmids were then co-transfected with pUSE-Fyn into HEK293T cells at the ratio of 1.5 μg pLVX-FLEX to 0.5 μg pUSE-Fyn per well using Lipofectamine.

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs). .. FLP recombination For removal of flippase recognition target (FRT)-flanked kanamycin, chloramphenicol, and spectinomycin cassettes, plasmids were transformed into Arabinose-induced flippase (FLP) recombinase-expressing bacteria EL250, as previously described ( ).

    Introduce:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: DNA from insert-containing plasmids was incubated with plasmid pMODloxZeoΔamp3 ( ) in the presence of EZ:Tn transposase (Epicentre Biotechnologies, Madison, WI, USA) to introduce two lox P sites flanking a zeocin selectable marker. .. Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site.

    Expressing:

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Article Title: Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †
    Article Snippet: The gene encoding Cre recombinase was kindly provided by Michael Culbertson (University of Wisconsin-Madison) and was amplified with Taq polymerase (New England Biolabs, Ipswich, MA) by using primers 3 and 4 (Table ) and cloned into pBSV2. .. The cre gene was digested from pBSV2 with NdeI and XbaI and cloned into pBSV2ex ( ) to create the cre expression construct pBSV2 ex - flgB p- cre .

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction. .. Cells were imaged for GFP expression and harvested 48 or 72 h after transfection for PCR or western blot analyses, respectively.

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs). .. FLP recombination For removal of flippase recognition target (FRT)-flanked kanamycin, chloramphenicol, and spectinomycin cassettes, plasmids were transformed into Arabinose-induced flippase (FLP) recombinase-expressing bacteria EL250, as previously described ( ).

    Ex Vivo:

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: Paragraph title: Cell culture and ex vivo characterization of cre-dependent Fyn knockdown by pLVX-FLEX-shFyn ... Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction.

    Western Blot:

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction. .. Cells were imaged for GFP expression and harvested 48 or 72 h after transfection for PCR or western blot analyses, respectively.

    Transformation Assay:

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs). .. FLP recombination For removal of flippase recognition target (FRT)-flanked kanamycin, chloramphenicol, and spectinomycin cassettes, plasmids were transformed into Arabinose-induced flippase (FLP) recombinase-expressing bacteria EL250, as previously described ( ).

    Transfection:

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction. .. Cells were imaged for GFP expression and harvested 48 or 72 h after transfection for PCR or western blot analyses, respectively.

    Ligation:

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Cell Culture:

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: Paragraph title: Cell culture and ex vivo characterization of cre-dependent Fyn knockdown by pLVX-FLEX-shFyn ... Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction.

    Generated:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: The Taok2tm1 targeting construct was generated using an approach similar to that reported by . .. Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site.

    other:

    Article Title: Self-replication of circular DNA by a self-encoded DNA polymerase through rolling-circle replication and recombination
    Article Snippet: In some experiments, the indicated concentrations of Cre recombinase were added in the mixture.

    Polymerase Chain Reaction:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: Plasmid-transformed E.coli colonies were screened by PCR using the following primers: forward: 5’GCTGAGGCTACCTCCTCCTT, reverse: 5’TGCTGCTTATGCAGTTGGAC to identify an 8.7 Kb genomic clone containing exons 1–7 of Taok2 and flanking intronic sequence. .. Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site.

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction. .. Cells were imaged for GFP expression and harvested 48 or 72 h after transfection for PCR or western blot analyses, respectively.

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Nucleic Acid Electrophoresis:

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: Standard DNA electrophoresis was performed to capture patterns of restriction digest of different plasmids. .. Restriction endonuclease and Cre recombinase at cost of $68 for 50 units in one vial were purchased from New England Biolab (Beverly, MA).

    Mouse Assay:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: Paragraph title: Generation of Taok2tm1fl mice ... Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site.

    Sequencing:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: Plasmid-transformed E.coli colonies were screened by PCR using the following primers: forward: 5’GCTGAGGCTACCTCCTCCTT, reverse: 5’TGCTGCTTATGCAGTTGGAC to identify an 8.7 Kb genomic clone containing exons 1–7 of Taok2 and flanking intronic sequence. .. Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site.

    Purification:

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Plasmid Preparation:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: .. Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site. .. To introduce a second lox P site into the construct, plasmid DNA from this clone was incubated with plasmid pGPS21loxFRTNeo ( ) in the presence of TnsABC transposase (New England Biolabs). pGPS21loxFRTNeo contains two Tn7-derived transposable elements flanking two lox P sites, two FRT sites and the neomycin phosphotransferase gene (Neo) placed downstream of the EM7 and PGK promotors to confer kanamycin and G418 resistance in E. coli and mouse embryonic stem (ES) cells, respectively.

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: .. We incubated 250 ng of plasmid DNA with 1 μl (1 unit/μl) of Cre recombinase for 30 min at 37 ° C. The Cre recombinase was then heat inactivated (10 min at 70 °C) and the whole reaction volume (15 μl) was used to transform Stbl3 competent cells. .. From the agar plate we picked 12 colonies which were further expanded before isolation of the plasmid using a standard mini-prep protocol.

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: Paragraph title: Cre recombinase effectively inverted ORF in FLEX plasmid in vitro ... Therefore we decided to test whether a more straightforward and efficient in vitro protocol could flip the ORF with commercially available Cre recombinase (New England Biolabs ).

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: Molecular biology methods Plasmid DNA mini-preparations were performed using QIAGEN kits (QIAGEN). .. Restriction endonuclease and Cre recombinase at cost of $68 for 50 units in one vial were purchased from New England Biolab (Beverly, MA).

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre recombinase retrofitting Removal of shuttle vector ColE was performed by using 10 µg of plasmid cut with 20 units of I-SceI (New England BioLabs) at 37°C for 2 h in a total volume of 400 µL followed by heat inactivation at 65°C for 20 min. Forty-four microliters of 10× T4 ligation buffer and 4 µL of T4 ligase was then added and incubated at 16°C for 1 h. Self-ligated shuttle vector was then purified using QIAquick PCR Purification Kit (Qiagen). .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs).

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum
    Article Snippet: .. Cells were plated at 4 × 105 cells per well on a 12-well plate. pLVX-FLEX-shFyn or pLVX-FLEX-SCR were incubated with Cre recombinase (New England Biolabs, Ipswich, MA) at the ratio of 1 μg plasmid to 4 units of Cre according to manufacturer's instruction. .. The plasmids were then co-transfected with pUSE-Fyn into HEK293T cells at the ratio of 1.5 μg pLVX-FLEX to 0.5 μg pUSE-Fyn per well using Lipofectamine.

    Article Title: Modular assembly of transposon integratable multigene vectors using RecWay assembly
    Article Snippet: .. Cre-mediated retrofitting was performed using 100 ng of self-ligated shuttle vector and 100 ng of expression vector in a 20 µL of reaction using 1 Unit of Cre recombinase (New England BioLabs) incubated at 37°C for 1 h. Ten microliters of the Cre reaction was then transformed into top 10 bacteria (Invitrogen) or electroporated into 10-beta Electrocompetent Escherichia coli (New England BioLabs). .. FLP recombination For removal of flippase recognition target (FRT)-flanked kanamycin, chloramphenicol, and spectinomycin cassettes, plasmids were transformed into Arabinose-induced flippase (FLP) recombinase-expressing bacteria EL250, as previously described ( ).

    In Vitro:

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: .. Therefore we decided to test whether a more straightforward and efficient in vitro protocol could flip the ORF with commercially available Cre recombinase (New England Biolabs ). ..

    Article Title: A rapid in vitro method to flip back the double-floxed inverted open reading frame in a plasmid
    Article Snippet: .. Therefore we decided to test whether a more straightforward and efficient in vitro protocol could flip the ORF with commercially available Cre recombinase ( New England Biolabs ). ..

    Article Title: Digital switching in a biosensor circuit via programmable timing of gene availability
    Article Snippet: .. CAGop-Lox2272-DsRed-LoxP-FF4 (pNL75) In vitro recombination of 250 ng of CAGop-Lox2272-LoxP-DsRedRev -Lox2272-LoxP-FF4 (pNL53), using 1 unit of Cre recombinase (NEB) during 30 min at 37°C. .. TRE-LacI-T21-miR-FF4mut (pNL73) miR-FF4 in TRE-LacI-T21-miR-FF4 (pZ224 ) was replaced with mutant sequence (gBlock1 from IDT) using HindIII and SalI.

    Marker:

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: .. Plasmid DNA from this clone was incubated with Cre recombinase (New England Biolabs) to remove the zeocin selectable marker and combine the two lox P sites into a single site. .. To introduce a second lox P site into the construct, plasmid DNA from this clone was incubated with plasmid pGPS21loxFRTNeo ( ) in the presence of TnsABC transposase (New England Biolabs). pGPS21loxFRTNeo contains two Tn7-derived transposable elements flanking two lox P sites, two FRT sites and the neomycin phosphotransferase gene (Neo) placed downstream of the EM7 and PGK promotors to confer kanamycin and G418 resistance in E. coli and mouse embryonic stem (ES) cells, respectively.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs gene encoding cre recombinase
    Deletion of loxP -flanked regions of lp54 after introduction of Cre <t>recombinase.</t> (A and B) Schematic diagrams showing the excision of the intervening DNA between loxP sites (filled arrowheads) present in the lp54 loci bba07 and bba01 (A) or bba07 and
    Gene Encoding Cre Recombinase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene encoding cre recombinase/product/New England Biolabs
    Average 90 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    gene encoding cre recombinase - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    Deletion of loxP -flanked regions of lp54 after introduction of Cre recombinase. (A and B) Schematic diagrams showing the excision of the intervening DNA between loxP sites (filled arrowheads) present in the lp54 loci bba07 and bba01 (A) or bba07 and

    Journal: Infection and Immunity

    Article Title: Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †

    doi: 10.1128/IAI.01059-09

    Figure Lengend Snippet: Deletion of loxP -flanked regions of lp54 after introduction of Cre recombinase. (A and B) Schematic diagrams showing the excision of the intervening DNA between loxP sites (filled arrowheads) present in the lp54 loci bba07 and bba01 (A) or bba07 and

    Article Snippet: The gene encoding Cre recombinase was kindly provided by Michael Culbertson (University of Wisconsin-Madison) and was amplified with Taq polymerase (New England Biolabs, Ipswich, MA) by using primers 3 and 4 (Table ) and cloned into pBSV2.

    Techniques:

    Loss of fluorescence by B. burgdorferi carrying loxP -flanked GFP after introduction of Cre recombinase. Strain B31-A34 was first transformed with shuttle vector pBSV2G- loxP - flaB p- gfp (Fig. ) and subsequently transformed with the compatible

    Journal: Infection and Immunity

    Article Title: Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †

    doi: 10.1128/IAI.01059-09

    Figure Lengend Snippet: Loss of fluorescence by B. burgdorferi carrying loxP -flanked GFP after introduction of Cre recombinase. Strain B31-A34 was first transformed with shuttle vector pBSV2G- loxP - flaB p- gfp (Fig. ) and subsequently transformed with the compatible

    Article Snippet: The gene encoding Cre recombinase was kindly provided by Michael Culbertson (University of Wisconsin-Madison) and was amplified with Taq polymerase (New England Biolabs, Ipswich, MA) by using primers 3 and 4 (Table ) and cloned into pBSV2.

    Techniques: Fluorescence, Transformation Assay, Plasmid Preparation

    Schematic diagram illustrating the loxP /Cre-mediated deletion of the gene encoding GFP. The introduction of Cre recombinase into B. burgdorferi containing flaB p- gfp flanked by loxP sites should result in recombination between loxP sites, the excision

    Journal: Infection and Immunity

    Article Title: Use of the Cre-lox Recombination System To Investigate the lp54 Gene Requirement in the Infectious Cycle of Borrelia burgdorferi ▿ ▿ †

    doi: 10.1128/IAI.01059-09

    Figure Lengend Snippet: Schematic diagram illustrating the loxP /Cre-mediated deletion of the gene encoding GFP. The introduction of Cre recombinase into B. burgdorferi containing flaB p- gfp flanked by loxP sites should result in recombination between loxP sites, the excision

    Article Snippet: The gene encoding Cre recombinase was kindly provided by Michael Culbertson (University of Wisconsin-Madison) and was amplified with Taq polymerase (New England Biolabs, Ipswich, MA) by using primers 3 and 4 (Table ) and cloned into pBSV2.

    Techniques:

    a Schematic of HuEV-A expression. ColE1 ori = bacterial origin of replication; Amp. = Ampicillin resistance cassette; EBNA-1 = Epstein-Barr nuclear antigen 1; OriP = origin of plasmid replication; Gateway = Gateway cloning cassette; Tet-CMV prom. = Doxycycline inducible promoter; FRT = flippase recognition target; FLP = flippase recombinase; LoxP = Lox sequence; Cre = Cre recombinase; TEV = TEV protease cleavage site. Note that treatment with Cre recombinase or FLP recombinase can produce a “short tag” or untagged derivative of the originally cloned ORF, respectively. b Immunoblot of cell lysates from HeLa cells expressing and empty HuEV-A vector or HES1, URI, or Art-27 proteins expressed from the HuEV-A expression vector. A version of the HuEV-A expression vectors not containing YFP in the tag (after Cre treatment of the vector) was also used for each of the proteins and for the empty vector. The proteins were detected with a FLAG-M2 antibody shown in green. Tubulin (shown in red) was used as loading control

    Journal: Biological Procedures Online

    Article Title: Fluorescence ImmunoPrecipitation (FLIP): a Novel Assay for High-Throughput IP

    doi: 10.1186/s12575-016-0046-x

    Figure Lengend Snippet: a Schematic of HuEV-A expression. ColE1 ori = bacterial origin of replication; Amp. = Ampicillin resistance cassette; EBNA-1 = Epstein-Barr nuclear antigen 1; OriP = origin of plasmid replication; Gateway = Gateway cloning cassette; Tet-CMV prom. = Doxycycline inducible promoter; FRT = flippase recognition target; FLP = flippase recombinase; LoxP = Lox sequence; Cre = Cre recombinase; TEV = TEV protease cleavage site. Note that treatment with Cre recombinase or FLP recombinase can produce a “short tag” or untagged derivative of the originally cloned ORF, respectively. b Immunoblot of cell lysates from HeLa cells expressing and empty HuEV-A vector or HES1, URI, or Art-27 proteins expressed from the HuEV-A expression vector. A version of the HuEV-A expression vectors not containing YFP in the tag (after Cre treatment of the vector) was also used for each of the proteins and for the empty vector. The proteins were detected with a FLAG-M2 antibody shown in green. Tubulin (shown in red) was used as loading control

    Article Snippet: One unit of Cre recombinase (New England Biolabs, M0298), 0.25 μg of HuEV-A plasmid with intact tag, was incubated in 50 μl of 1X Cre buffer (New England Biolabs, Beverley, MA) at 37 °C for 30 min. Cre recombinase was then inactivated for 10 min at 70 °C and the DNA purified on column (Qiagen, 28106).

    Techniques: Expressing, Plasmid Preparation, Clone Assay, Sequencing