m0290  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Alkaline Phosphatase Calf Intest CIP
    Description:
    Alkaline Phosphatase Calf Intest CIP 5 000 units
    Catalog Number:
    m0290l
    Price:
    342
    Size:
    5 000 units
    Category:
    Alkaline Phosphatases
    Buy from Supplier


    Structured Review

    New England Biolabs m0290
    Alkaline Phosphatase Calf Intest CIP
    Alkaline Phosphatase Calf Intest CIP 5 000 units
    https://www.bioz.com/result/m0290/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    m0290 - by Bioz Stars, 2020-02
    95/100 stars

    Related Products / Commonly Used Together

    calf intestinal -- cip
    alkaline phosphatase
    dephosphorylation

    Images

    Related Articles

    Transduction:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Amplification:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: .. Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Filtration:

    Article Title: Mechanism of BRAF Activation Through Biochemical Characterization of the Recombinant Full-Length Protein
    Article Snippet: Alkaline Phosphatase, Calf Intestinal (CIP) (M0290) was purchased from NEB. .. Gel filtration standard (#151–1901) was purchased from Bio-Rad.

    Phosphatase Assay:

    Article Title: The MAP kinase pathway coordinates crossover designation with disassembly of synaptonemal complex proteins during meiosis
    Article Snippet: Paragraph title: Calf intestinal phosphatase assay ... Thirty microliters of immunoprecipitate were incubated with 20 units of calf intestinal phosphatase (NEB catalog # M0290S) for 1 hr at 37°C.

    Electrophoresis:

    Article Title: RanBP1 governs spindle assembly by defining mitotic Ran-GTP production
    Article Snippet: Either buffer or 10 units of alkaline phosphatase (NEB, M0290S) were added to the anaphase XEE beads and incubated 30 °C for 30 minutes to allow dephosphorylation of the phosphatase-treated sample. .. The eluted samples were separated by 2D gel electrophoresis.

    Ex Vivo:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Incubation:

    Article Title: RanBP1 governs spindle assembly by defining mitotic Ran-GTP production
    Article Snippet: .. Either buffer or 10 units of alkaline phosphatase (NEB, M0290S) were added to the anaphase XEE beads and incubated 30 °C for 30 minutes to allow dephosphorylation of the phosphatase-treated sample. .. After incubation, beads were washed three times with 1× NEBuffer 3 and eluted with DeStreak Rehydration Solution (GE Healthcare).

    Article Title: Afferent Regulation of Chicken Auditory Brainstem Neurons: Rapid Changes in Phosphorylation of Elongation Factor 2
    Article Snippet: .. For phosphatase treatment, HEK293 cells were incubated in a lysis buffer with Calf Intestinal Phosphatase (CIP; # M0290S; New England Biolabs, Ipswich, MA) at 1 unit CIP per 1 μg protein for 30 minutes at 37ºC before harvest. ..

    Article Title: Whole genome variant association across 100 dogs identifies a frame shift mutation in DISHEVELLED 2 which contributes to Robinow-like syndrome in Bulldogs and related screw tail dog breeds
    Article Snippet: For WNT stimulation, cells were incubated for 6 hours with Wnt5a (R & D, catalog #645WN010, 200ng/mL final concentration) or Wnt3a (R & D, catalog #1324-WN-002 100ng/mL final concentration). .. For phosphatase treatment, 17.3μg of protein from cell lysates were treated with 7 U of CIP (NEB, catalog #M0290S; final concentration of 350U/mL) at 37C for 30 minutes.

    Article Title: The MAP kinase pathway coordinates crossover designation with disassembly of synaptonemal complex proteins during meiosis
    Article Snippet: .. Thirty microliters of immunoprecipitate were incubated with 20 units of calf intestinal phosphatase (NEB catalog # M0290S) for 1 hr at 37°C. ..

    Gel Extraction:

    Article Title: Protein and Antibody Engineering by Phage Display
    Article Snippet: .. 3,3′,5,5′-Tetramethylbenzidine (TMB) (Sigma, St. Louis, MO, catalog #: T0440) 0.5 M H2 SO4 Anti-M13-HRP conjugated antibody (GE Healthcare, Marlborough, MA, catalog #: GE27-9421-01) T7 DNA Polymerase (NEB, Ipswich, MA, catalog #: M0274L) T4 DNA Ligase (Invitrogen, Carlsbad, CA, catalog #: 15224-017) 25 m M dNTPs (Fisher, Hampton, NH, catalog #: FERR1121) 25 mg/mL Uridine (Sigma, St. Louis, MO, catalog #: U3750-100G) BugBuster 10X Protein Extraction Reagent (Millipore, Billerica, MA, catalog #: 70921) QIAquick PCR Purification Kit (Qiagen, Hilden, Germany, catalog #: 28104) QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany, catalog #: 28704) QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany, catalog #: 27104) NucleoBond Xtra Maxi Plus (Macherey-Nagel, Düren, Germany, catalog #: 740416.50) Ni-NTA Agarose (Qiagen, Hilden, Germany, catalog #: 30210) DNaseI (Invitrogen, Carlsbad, CA, catalog #: 18047-019) SIGMAFast EDTA-free protease cocktail inhibitor (Sigma, St. Louis, MO, catalog #: S8830) Precision Plus Protein Dual Color Standards (BioRad, Hercules, CA, catalog #: 161-03741) Anti-His (C-term)-HRP antibody (Invitrogen, Carlsbad, CA, catalog #: 46-0707) Protein A Agarose (Pierce, Thermo Fisher Scientific, Waltham, MA, catalog #: 15918-014) Phusion High Fidelity PCR Master Mix with HF Buffer (NEB, Ipswich, MA, catalog #: M0531S) Restriction enzymes: BssHII, BsiWI, NheI, NsiI, FseI (NEB, Ipswich, MA, catalog #s: R0199S, R0553S, R0131S, R0127S, R0558S, respectively) Alkaline Phosphatase, Calf Intestinal (NEB, Ipswich, MA, catalog #: M0290S) Quick Ligation Kit (NEB, Ipswich, MA, catalog #: M2200S) Polyethylenimine (PEI) Linear, 25,000 MW (Polysciences, Warrington, PA, catalog #: 23966) FreeStyle™ 293 Expression Medium (ThermoFisher; Invitrogen, Carlsbad, CA, catalog #: 12338-018) M2 antibody (Sigma-Aldrich, St. Louis, MO, catalog #: F1804) Protein A-HRP conjugate (Invitrogen, Carlsbad, CA, catalog #: 101023) ..

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: .. Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Expressing:

    Article Title: Protein and Antibody Engineering by Phage Display
    Article Snippet: .. 3,3′,5,5′-Tetramethylbenzidine (TMB) (Sigma, St. Louis, MO, catalog #: T0440) 0.5 M H2 SO4 Anti-M13-HRP conjugated antibody (GE Healthcare, Marlborough, MA, catalog #: GE27-9421-01) T7 DNA Polymerase (NEB, Ipswich, MA, catalog #: M0274L) T4 DNA Ligase (Invitrogen, Carlsbad, CA, catalog #: 15224-017) 25 m M dNTPs (Fisher, Hampton, NH, catalog #: FERR1121) 25 mg/mL Uridine (Sigma, St. Louis, MO, catalog #: U3750-100G) BugBuster 10X Protein Extraction Reagent (Millipore, Billerica, MA, catalog #: 70921) QIAquick PCR Purification Kit (Qiagen, Hilden, Germany, catalog #: 28104) QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany, catalog #: 28704) QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany, catalog #: 27104) NucleoBond Xtra Maxi Plus (Macherey-Nagel, Düren, Germany, catalog #: 740416.50) Ni-NTA Agarose (Qiagen, Hilden, Germany, catalog #: 30210) DNaseI (Invitrogen, Carlsbad, CA, catalog #: 18047-019) SIGMAFast EDTA-free protease cocktail inhibitor (Sigma, St. Louis, MO, catalog #: S8830) Precision Plus Protein Dual Color Standards (BioRad, Hercules, CA, catalog #: 161-03741) Anti-His (C-term)-HRP antibody (Invitrogen, Carlsbad, CA, catalog #: 46-0707) Protein A Agarose (Pierce, Thermo Fisher Scientific, Waltham, MA, catalog #: 15918-014) Phusion High Fidelity PCR Master Mix with HF Buffer (NEB, Ipswich, MA, catalog #: M0531S) Restriction enzymes: BssHII, BsiWI, NheI, NsiI, FseI (NEB, Ipswich, MA, catalog #s: R0199S, R0553S, R0131S, R0127S, R0558S, respectively) Alkaline Phosphatase, Calf Intestinal (NEB, Ipswich, MA, catalog #: M0290S) Quick Ligation Kit (NEB, Ipswich, MA, catalog #: M2200S) Polyethylenimine (PEI) Linear, 25,000 MW (Polysciences, Warrington, PA, catalog #: 23966) FreeStyle™ 293 Expression Medium (ThermoFisher; Invitrogen, Carlsbad, CA, catalog #: 12338-018) M2 antibody (Sigma-Aldrich, St. Louis, MO, catalog #: F1804) Protein A-HRP conjugate (Invitrogen, Carlsbad, CA, catalog #: 101023) ..

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: .. Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    BIA-KA:

    Article Title: Whole genome variant association across 100 dogs identifies a frame shift mutation in DISHEVELLED 2 which contributes to Robinow-like syndrome in Bulldogs and related screw tail dog breeds
    Article Snippet: BCA analyses were conducted to determine the absolute concentrations of protein in lysate samples. .. For phosphatase treatment, 17.3μg of protein from cell lysates were treated with 7 U of CIP (NEB, catalog #M0290S; final concentration of 350U/mL) at 37C for 30 minutes.

    Modification:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Western Blot:

    Article Title: Afferent Regulation of Chicken Auditory Brainstem Neurons: Rapid Changes in Phosphorylation of Elongation Factor 2
    Article Snippet: Paragraph title: Western blot ... For phosphatase treatment, HEK293 cells were incubated in a lysis buffer with Calf Intestinal Phosphatase (CIP; # M0290S; New England Biolabs, Ipswich, MA) at 1 unit CIP per 1 μg protein for 30 minutes at 37ºC before harvest.

    Article Title: Whole genome variant association across 100 dogs identifies a frame shift mutation in DISHEVELLED 2 which contributes to Robinow-like syndrome in Bulldogs and related screw tail dog breeds
    Article Snippet: Paragraph title: Western blotting ... For phosphatase treatment, 17.3μg of protein from cell lysates were treated with 7 U of CIP (NEB, catalog #M0290S; final concentration of 350U/mL) at 37C for 30 minutes.

    Article Title: K45A mutation of RIPK1 results in poor necroptosis and cytokine signaling in macrophages, which impacts inflammatory responses in vivo
    Article Snippet: Paragraph title: Western blotting ... Dephosphorylation of the total protein was performed with 50U of Alkaline Phosphatase, Calf Intestinal – CIP, (M0290, NEB, Ipswich, MA, USA) in RIPA-EDTA free, supplemented with protease inhibitors but not phosphatase inhibitors, and 1 × CutSmart NEB buffer.

    Transformation Assay:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Transfection:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Ligation:

    Article Title: Protein and Antibody Engineering by Phage Display
    Article Snippet: .. 3,3′,5,5′-Tetramethylbenzidine (TMB) (Sigma, St. Louis, MO, catalog #: T0440) 0.5 M H2 SO4 Anti-M13-HRP conjugated antibody (GE Healthcare, Marlborough, MA, catalog #: GE27-9421-01) T7 DNA Polymerase (NEB, Ipswich, MA, catalog #: M0274L) T4 DNA Ligase (Invitrogen, Carlsbad, CA, catalog #: 15224-017) 25 m M dNTPs (Fisher, Hampton, NH, catalog #: FERR1121) 25 mg/mL Uridine (Sigma, St. Louis, MO, catalog #: U3750-100G) BugBuster 10X Protein Extraction Reagent (Millipore, Billerica, MA, catalog #: 70921) QIAquick PCR Purification Kit (Qiagen, Hilden, Germany, catalog #: 28104) QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany, catalog #: 28704) QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany, catalog #: 27104) NucleoBond Xtra Maxi Plus (Macherey-Nagel, Düren, Germany, catalog #: 740416.50) Ni-NTA Agarose (Qiagen, Hilden, Germany, catalog #: 30210) DNaseI (Invitrogen, Carlsbad, CA, catalog #: 18047-019) SIGMAFast EDTA-free protease cocktail inhibitor (Sigma, St. Louis, MO, catalog #: S8830) Precision Plus Protein Dual Color Standards (BioRad, Hercules, CA, catalog #: 161-03741) Anti-His (C-term)-HRP antibody (Invitrogen, Carlsbad, CA, catalog #: 46-0707) Protein A Agarose (Pierce, Thermo Fisher Scientific, Waltham, MA, catalog #: 15918-014) Phusion High Fidelity PCR Master Mix with HF Buffer (NEB, Ipswich, MA, catalog #: M0531S) Restriction enzymes: BssHII, BsiWI, NheI, NsiI, FseI (NEB, Ipswich, MA, catalog #s: R0199S, R0553S, R0131S, R0127S, R0558S, respectively) Alkaline Phosphatase, Calf Intestinal (NEB, Ipswich, MA, catalog #: M0290S) Quick Ligation Kit (NEB, Ipswich, MA, catalog #: M2200S) Polyethylenimine (PEI) Linear, 25,000 MW (Polysciences, Warrington, PA, catalog #: 23966) FreeStyle™ 293 Expression Medium (ThermoFisher; Invitrogen, Carlsbad, CA, catalog #: 12338-018) M2 antibody (Sigma-Aldrich, St. Louis, MO, catalog #: F1804) Protein A-HRP conjugate (Invitrogen, Carlsbad, CA, catalog #: 101023) ..

    Protease Inhibitor:

    Article Title: In vitro Reconstitution Assay of miRNA Biogenesis by Arabidopsis DCL1
    Article Snippet: .. Negative control plasmid: pBA] G-Tube® snap cap siliconized microcentrifuge tubes (VWR International, catalog number: 22179-004) Anti-FLAG® M2 magnetic beads (Sigma-Aldrich, catalog number: M8823) 3x Flag peptide (NH2-MDYKDHDGDYKDHDIDYKDDDDK-COOH) (Sigma-Aldrich, catalog number: F4799) DNase (Promega Corporation, catalog number: M6101) 3,000 Ci/mmol 10 mCi/ml [γ-32 P]-ATP (PerkinElmer, catalog number: BLU502A100UC) SuperaseIn RNase inhibitor (Ambion, catalog number: N8080119) T7 RNA polymerase (Ambion, catalog number: 18033019) Calf intestine alkaline phosphatase (NEB, catalog number: M0290S) Phenol: chloroform: isoamyl alcohol (25:24:1) (Life Technologies, Invitrogen™ , catalog number: 15593049) NaAc (Sigma-Aldrich, catalog number: S7670) 5 M ammonium acetate (Ambion, catalog: AM9071) GlycoBlue (Ambion, catalog number: AM9516) Decade marker (Ambion, catalog number: AM7778) Anti-c-Myc Agarose Affinity Gel (Sigma-Aldrich, catalog number: A7470) EDTA-free protease inhibitor cocktail (Roche Diagnostics, catalog number: 05892953001) Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P2714) HEPES (Sigma-Aldrich, catalog number: H3375) Spermidine (Sigma-Aldrich, catalog number: S2626) DTT (DL-Dithiothreitol) (Sigma-Aldrich, catalog number: 43817) MgCl2 (Sigma-Aldrich, catalog number: M8266) NTP (Thermo scientific, catalog number: R0481) Deionized formamide (Ambion, catalog number: AM9342) Bromophenol blue (Sigma-Aldrich, catalog number: B0126) Xylene cyanol (Sigma-Aldrich, catalog number: X4126) EDTA (Sigma-Aldrich, catalog number: V900106) SDS (Sigma-Aldrich, catalog number: L3771) DEPC (Sigma-Aldrich, catalog number: V900882) KCl (Sigma-Aldrich, catalog number: V900068) Tris-HCl (Sigma-Aldrich, catalog number: V900312) Triton X-100 (Sigma-Aldrich, catalog number: V900502) PMSF (Sigma-Aldrich, catalog number: 78830) NaCl (Sigma-Aldrich, catalog number: V900058) ATP (Thermo scientific, catalog number: R1441) GTP (Thermo scientific, catalog number: R1461) Glycerol (Sigma-Aldrich, catalog number: V900122) 0.1 M Glycine-HCl (Sigma-Aldrich, catalog number: 55097-5ML-F) 5x transcription buffer (see Recipes) RNA loading buffer (see Recipes) RNA elution buffer (see Recipes) DEPC H2 O (see Recipes) RNA dissolve buffer (see Recipes) Chloroform: isoamyl alcohol (24:1) (see Recipes) IP buffer (see Recipes) Protease inhibitor cocktail stock (see Recipes) TBS buffer (see Recipes) 3x Flag elution buffer stock (see Recipes) Washing buffer (see Recipes) Assay buffer (see Recipes) Fixing buffer (see Recipes) .. Compact UV lamp (UVP, model: UVGL-25) Fluor-Coated TLC Plate (10 × 10 cm) (Ambion, catalog number: AM10110) Geiger counter (Medcom, model: CRM-100) Vertical electrophoresis system (Whatman, model: V15.17) Thermomixer C (Eppendorf, model: 5382000023) Gel dryer (Bio-Rad Laboratories, model: 583) Gel analyzer Quantity One (Bio-Rad Laboratories, version: 4.6.9) DynaMag™ -2 (Life technologies, model: 12321D) Rugged Rotator (Glas-Col, model: 099A MR1512) PolyATtract® System 1000 Magnetic Separation Stand (Promega Corporation, model: Z541A) Phospho imager (PharosFX™ plus system)

    Article Title: Whole genome variant association across 100 dogs identifies a frame shift mutation in DISHEVELLED 2 which contributes to Robinow-like syndrome in Bulldogs and related screw tail dog breeds
    Article Snippet: Cells were washed in 1X cold PBS and lysed in 200μL RIPA buffer supplemented with Halt™ Protease Inhibitor Cocktail (100X) (Prod # 186127, Thermo Fisher Scientific). .. For phosphatase treatment, 17.3μg of protein from cell lysates were treated with 7 U of CIP (NEB, catalog #M0290S; final concentration of 350U/mL) at 37C for 30 minutes.

    Article Title: T47D Cells Expressing Myeloperoxidase Are Able to Process, Traffic and Store the Mature Protein in Lysosomes: Studies in T47D Cells Reveal a Role for Cys319 in MPO Biosynthesis that Precedes Its Known Role in Inter-Molecular Disulfide Bond Formation
    Article Snippet: The enzymes PNGase F (P0704S), Endoglycosidase H (P0702S) and calf intestinal phosphatase (M0290S) were from New England Biolabs. .. Complete™ protease inhibitor cocktail tablets with and without EDTA were from Roche (04693124001, 04693159001).

    Cell Culture:

    Article Title: Effects of Single Nucleotide Polymorphisms in Human KCNMA1 on BK Current Properties
    Article Snippet: Paragraph title: Cell Culture and Electrophysiology ... For dephosphorylation experiments, calf intestinal alkaline phosphatase (Alk P, Cat. #M0290S, New England Biolabs Inc., Ipswich, MA, USA) was warmed to room temperature and diluted to 10 U/ml in the internal bath solution (with 1-μM Ca2+ ), and currents were recorded from inside out patches in control bath solution, or bath solution containing Alk P, 1 min after, patches were excised.

    Polymerase Chain Reaction:

    Article Title: Protein and Antibody Engineering by Phage Display
    Article Snippet: .. 3,3′,5,5′-Tetramethylbenzidine (TMB) (Sigma, St. Louis, MO, catalog #: T0440) 0.5 M H2 SO4 Anti-M13-HRP conjugated antibody (GE Healthcare, Marlborough, MA, catalog #: GE27-9421-01) T7 DNA Polymerase (NEB, Ipswich, MA, catalog #: M0274L) T4 DNA Ligase (Invitrogen, Carlsbad, CA, catalog #: 15224-017) 25 m M dNTPs (Fisher, Hampton, NH, catalog #: FERR1121) 25 mg/mL Uridine (Sigma, St. Louis, MO, catalog #: U3750-100G) BugBuster 10X Protein Extraction Reagent (Millipore, Billerica, MA, catalog #: 70921) QIAquick PCR Purification Kit (Qiagen, Hilden, Germany, catalog #: 28104) QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany, catalog #: 28704) QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany, catalog #: 27104) NucleoBond Xtra Maxi Plus (Macherey-Nagel, Düren, Germany, catalog #: 740416.50) Ni-NTA Agarose (Qiagen, Hilden, Germany, catalog #: 30210) DNaseI (Invitrogen, Carlsbad, CA, catalog #: 18047-019) SIGMAFast EDTA-free protease cocktail inhibitor (Sigma, St. Louis, MO, catalog #: S8830) Precision Plus Protein Dual Color Standards (BioRad, Hercules, CA, catalog #: 161-03741) Anti-His (C-term)-HRP antibody (Invitrogen, Carlsbad, CA, catalog #: 46-0707) Protein A Agarose (Pierce, Thermo Fisher Scientific, Waltham, MA, catalog #: 15918-014) Phusion High Fidelity PCR Master Mix with HF Buffer (NEB, Ipswich, MA, catalog #: M0531S) Restriction enzymes: BssHII, BsiWI, NheI, NsiI, FseI (NEB, Ipswich, MA, catalog #s: R0199S, R0553S, R0131S, R0127S, R0558S, respectively) Alkaline Phosphatase, Calf Intestinal (NEB, Ipswich, MA, catalog #: M0290S) Quick Ligation Kit (NEB, Ipswich, MA, catalog #: M2200S) Polyethylenimine (PEI) Linear, 25,000 MW (Polysciences, Warrington, PA, catalog #: 23966) FreeStyle™ 293 Expression Medium (ThermoFisher; Invitrogen, Carlsbad, CA, catalog #: 12338-018) M2 antibody (Sigma-Aldrich, St. Louis, MO, catalog #: F1804) Protein A-HRP conjugate (Invitrogen, Carlsbad, CA, catalog #: 101023) ..

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: .. Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Binding Assay:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: .. Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Molecular Weight:

    Article Title: Afferent Regulation of Chicken Auditory Brainstem Neurons: Rapid Changes in Phosphorylation of Elongation Factor 2
    Article Snippet: For phosphatase treatment, HEK293 cells were incubated in a lysis buffer with Calf Intestinal Phosphatase (CIP; # M0290S; New England Biolabs, Ipswich, MA) at 1 unit CIP per 1 μg protein for 30 minutes at 37ºC before harvest. .. Molecular weight standards were used to determine relative sizes of labeled proteins.

    Two-Dimensional Gel Electrophoresis:

    Article Title: RanBP1 governs spindle assembly by defining mitotic Ran-GTP production
    Article Snippet: Either buffer or 10 units of alkaline phosphatase (NEB, M0290S) were added to the anaphase XEE beads and incubated 30 °C for 30 minutes to allow dephosphorylation of the phosphatase-treated sample. .. The eluted samples were separated by 2D gel electrophoresis.

    Magnetic Beads:

    Article Title: In vitro Reconstitution Assay of miRNA Biogenesis by Arabidopsis DCL1
    Article Snippet: .. Negative control plasmid: pBA] G-Tube® snap cap siliconized microcentrifuge tubes (VWR International, catalog number: 22179-004) Anti-FLAG® M2 magnetic beads (Sigma-Aldrich, catalog number: M8823) 3x Flag peptide (NH2-MDYKDHDGDYKDHDIDYKDDDDK-COOH) (Sigma-Aldrich, catalog number: F4799) DNase (Promega Corporation, catalog number: M6101) 3,000 Ci/mmol 10 mCi/ml [γ-32 P]-ATP (PerkinElmer, catalog number: BLU502A100UC) SuperaseIn RNase inhibitor (Ambion, catalog number: N8080119) T7 RNA polymerase (Ambion, catalog number: 18033019) Calf intestine alkaline phosphatase (NEB, catalog number: M0290S) Phenol: chloroform: isoamyl alcohol (25:24:1) (Life Technologies, Invitrogen™ , catalog number: 15593049) NaAc (Sigma-Aldrich, catalog number: S7670) 5 M ammonium acetate (Ambion, catalog: AM9071) GlycoBlue (Ambion, catalog number: AM9516) Decade marker (Ambion, catalog number: AM7778) Anti-c-Myc Agarose Affinity Gel (Sigma-Aldrich, catalog number: A7470) EDTA-free protease inhibitor cocktail (Roche Diagnostics, catalog number: 05892953001) Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P2714) HEPES (Sigma-Aldrich, catalog number: H3375) Spermidine (Sigma-Aldrich, catalog number: S2626) DTT (DL-Dithiothreitol) (Sigma-Aldrich, catalog number: 43817) MgCl2 (Sigma-Aldrich, catalog number: M8266) NTP (Thermo scientific, catalog number: R0481) Deionized formamide (Ambion, catalog number: AM9342) Bromophenol blue (Sigma-Aldrich, catalog number: B0126) Xylene cyanol (Sigma-Aldrich, catalog number: X4126) EDTA (Sigma-Aldrich, catalog number: V900106) SDS (Sigma-Aldrich, catalog number: L3771) DEPC (Sigma-Aldrich, catalog number: V900882) KCl (Sigma-Aldrich, catalog number: V900068) Tris-HCl (Sigma-Aldrich, catalog number: V900312) Triton X-100 (Sigma-Aldrich, catalog number: V900502) PMSF (Sigma-Aldrich, catalog number: 78830) NaCl (Sigma-Aldrich, catalog number: V900058) ATP (Thermo scientific, catalog number: R1441) GTP (Thermo scientific, catalog number: R1461) Glycerol (Sigma-Aldrich, catalog number: V900122) 0.1 M Glycine-HCl (Sigma-Aldrich, catalog number: 55097-5ML-F) 5x transcription buffer (see Recipes) RNA loading buffer (see Recipes) RNA elution buffer (see Recipes) DEPC H2 O (see Recipes) RNA dissolve buffer (see Recipes) Chloroform: isoamyl alcohol (24:1) (see Recipes) IP buffer (see Recipes) Protease inhibitor cocktail stock (see Recipes) TBS buffer (see Recipes) 3x Flag elution buffer stock (see Recipes) Washing buffer (see Recipes) Assay buffer (see Recipes) Fixing buffer (see Recipes) .. Compact UV lamp (UVP, model: UVGL-25) Fluor-Coated TLC Plate (10 × 10 cm) (Ambion, catalog number: AM10110) Geiger counter (Medcom, model: CRM-100) Vertical electrophoresis system (Whatman, model: V15.17) Thermomixer C (Eppendorf, model: 5382000023) Gel dryer (Bio-Rad Laboratories, model: 583) Gel analyzer Quantity One (Bio-Rad Laboratories, version: 4.6.9) DynaMag™ -2 (Life technologies, model: 12321D) Rugged Rotator (Glas-Col, model: 099A MR1512) PolyATtract® System 1000 Magnetic Separation Stand (Promega Corporation, model: Z541A) Phospho imager (PharosFX™ plus system)

    Article Title: RanBP1 governs spindle assembly by defining mitotic Ran-GTP production
    Article Snippet: 25 µg anti-xRanBP1 antibodies were crosslinked on 100 µl protein A magnetic beads (Invitrogen) and incubated with each sample for 90 min at 4°C. .. Either buffer or 10 units of alkaline phosphatase (NEB, M0290S) were added to the anaphase XEE beads and incubated 30 °C for 30 minutes to allow dephosphorylation of the phosphatase-treated sample.

    Immunohistochemistry:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Labeling:

    Article Title: Afferent Regulation of Chicken Auditory Brainstem Neurons: Rapid Changes in Phosphorylation of Elongation Factor 2
    Article Snippet: For phosphatase treatment, HEK293 cells were incubated in a lysis buffer with Calf Intestinal Phosphatase (CIP; # M0290S; New England Biolabs, Ipswich, MA) at 1 unit CIP per 1 μg protein for 30 minutes at 37ºC before harvest. .. Molecular weight standards were used to determine relative sizes of labeled proteins.

    Purification:

    Article Title: Protein and Antibody Engineering by Phage Display
    Article Snippet: .. 3,3′,5,5′-Tetramethylbenzidine (TMB) (Sigma, St. Louis, MO, catalog #: T0440) 0.5 M H2 SO4 Anti-M13-HRP conjugated antibody (GE Healthcare, Marlborough, MA, catalog #: GE27-9421-01) T7 DNA Polymerase (NEB, Ipswich, MA, catalog #: M0274L) T4 DNA Ligase (Invitrogen, Carlsbad, CA, catalog #: 15224-017) 25 m M dNTPs (Fisher, Hampton, NH, catalog #: FERR1121) 25 mg/mL Uridine (Sigma, St. Louis, MO, catalog #: U3750-100G) BugBuster 10X Protein Extraction Reagent (Millipore, Billerica, MA, catalog #: 70921) QIAquick PCR Purification Kit (Qiagen, Hilden, Germany, catalog #: 28104) QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany, catalog #: 28704) QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany, catalog #: 27104) NucleoBond Xtra Maxi Plus (Macherey-Nagel, Düren, Germany, catalog #: 740416.50) Ni-NTA Agarose (Qiagen, Hilden, Germany, catalog #: 30210) DNaseI (Invitrogen, Carlsbad, CA, catalog #: 18047-019) SIGMAFast EDTA-free protease cocktail inhibitor (Sigma, St. Louis, MO, catalog #: S8830) Precision Plus Protein Dual Color Standards (BioRad, Hercules, CA, catalog #: 161-03741) Anti-His (C-term)-HRP antibody (Invitrogen, Carlsbad, CA, catalog #: 46-0707) Protein A Agarose (Pierce, Thermo Fisher Scientific, Waltham, MA, catalog #: 15918-014) Phusion High Fidelity PCR Master Mix with HF Buffer (NEB, Ipswich, MA, catalog #: M0531S) Restriction enzymes: BssHII, BsiWI, NheI, NsiI, FseI (NEB, Ipswich, MA, catalog #s: R0199S, R0553S, R0131S, R0127S, R0558S, respectively) Alkaline Phosphatase, Calf Intestinal (NEB, Ipswich, MA, catalog #: M0290S) Quick Ligation Kit (NEB, Ipswich, MA, catalog #: M2200S) Polyethylenimine (PEI) Linear, 25,000 MW (Polysciences, Warrington, PA, catalog #: 23966) FreeStyle™ 293 Expression Medium (ThermoFisher; Invitrogen, Carlsbad, CA, catalog #: 12338-018) M2 antibody (Sigma-Aldrich, St. Louis, MO, catalog #: F1804) Protein A-HRP conjugate (Invitrogen, Carlsbad, CA, catalog #: 101023) ..

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Article Title: The MAP kinase pathway coordinates crossover designation with disassembly of synaptonemal complex proteins during meiosis
    Article Snippet: Thirty microliters of immunoprecipitate were incubated with 20 units of calf intestinal phosphatase (NEB catalog # M0290S) for 1 hr at 37°C. .. The immunoprecipitate was purified after CIP treatment by using a Pierce SDS-PAGE sample prep kit (catalog # 89888).

    Protein Extraction:

    Article Title: Protein and Antibody Engineering by Phage Display
    Article Snippet: .. 3,3′,5,5′-Tetramethylbenzidine (TMB) (Sigma, St. Louis, MO, catalog #: T0440) 0.5 M H2 SO4 Anti-M13-HRP conjugated antibody (GE Healthcare, Marlborough, MA, catalog #: GE27-9421-01) T7 DNA Polymerase (NEB, Ipswich, MA, catalog #: M0274L) T4 DNA Ligase (Invitrogen, Carlsbad, CA, catalog #: 15224-017) 25 m M dNTPs (Fisher, Hampton, NH, catalog #: FERR1121) 25 mg/mL Uridine (Sigma, St. Louis, MO, catalog #: U3750-100G) BugBuster 10X Protein Extraction Reagent (Millipore, Billerica, MA, catalog #: 70921) QIAquick PCR Purification Kit (Qiagen, Hilden, Germany, catalog #: 28104) QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany, catalog #: 28704) QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany, catalog #: 27104) NucleoBond Xtra Maxi Plus (Macherey-Nagel, Düren, Germany, catalog #: 740416.50) Ni-NTA Agarose (Qiagen, Hilden, Germany, catalog #: 30210) DNaseI (Invitrogen, Carlsbad, CA, catalog #: 18047-019) SIGMAFast EDTA-free protease cocktail inhibitor (Sigma, St. Louis, MO, catalog #: S8830) Precision Plus Protein Dual Color Standards (BioRad, Hercules, CA, catalog #: 161-03741) Anti-His (C-term)-HRP antibody (Invitrogen, Carlsbad, CA, catalog #: 46-0707) Protein A Agarose (Pierce, Thermo Fisher Scientific, Waltham, MA, catalog #: 15918-014) Phusion High Fidelity PCR Master Mix with HF Buffer (NEB, Ipswich, MA, catalog #: M0531S) Restriction enzymes: BssHII, BsiWI, NheI, NsiI, FseI (NEB, Ipswich, MA, catalog #s: R0199S, R0553S, R0131S, R0127S, R0558S, respectively) Alkaline Phosphatase, Calf Intestinal (NEB, Ipswich, MA, catalog #: M0290S) Quick Ligation Kit (NEB, Ipswich, MA, catalog #: M2200S) Polyethylenimine (PEI) Linear, 25,000 MW (Polysciences, Warrington, PA, catalog #: 23966) FreeStyle™ 293 Expression Medium (ThermoFisher; Invitrogen, Carlsbad, CA, catalog #: 12338-018) M2 antibody (Sigma-Aldrich, St. Louis, MO, catalog #: F1804) Protein A-HRP conjugate (Invitrogen, Carlsbad, CA, catalog #: 101023) ..

    Hydrolysis Assay:

    Article Title: NPP4 is a procoagulant enzyme on the surface of vascular endothelium
    Article Snippet: NPP4 nucleotide substrates were identified by directly detecting the free phosphate (Pi ) product using malachite green (ADP substrate) or by a linked hydrolysis assay with alkaline phosphatase combined with malachite green (lipid substrates and nucleotide substrates without terminal Pi ) to measure released Pi . .. For substrates without terminal phosphates, 10 U of calf intestinal alkaline phosphatase (M0290S, 10 000 units/mL; New England Biolabs) was added for a final reaction volume of 50 μL.

    Immunoprecipitation:

    Article Title: RanBP1 governs spindle assembly by defining mitotic Ran-GTP production
    Article Snippet: Paragraph title: RanBP1 immunoprecipitation and on beads phosphatase treatment ... Either buffer or 10 units of alkaline phosphatase (NEB, M0290S) were added to the anaphase XEE beads and incubated 30 °C for 30 minutes to allow dephosphorylation of the phosphatase-treated sample.

    Article Title: ERK2 phosphorylates Krüppel-like factor 8 protein at serine 48 to maintain its stability
    Article Snippet: Antibody used for co-immunoprecipitation was Anti-HA mouse monoclonal (IP0010) Immunoprecipitation Kit (Sigma-Aldrich, St. Louis, MO, USA). .. M0290) were purchased from New England Biolabs (Ipswich, MA, USA).

    Article Title: The MAP kinase pathway coordinates crossover designation with disassembly of synaptonemal complex proteins during meiosis
    Article Snippet: Calf intestinal phosphatase assay Immunoprecipitation was prepared as mentioned above. .. Thirty microliters of immunoprecipitate were incubated with 20 units of calf intestinal phosphatase (NEB catalog # M0290S) for 1 hr at 37°C.

    De-Phosphorylation Assay:

    Article Title: RanBP1 governs spindle assembly by defining mitotic Ran-GTP production
    Article Snippet: .. Either buffer or 10 units of alkaline phosphatase (NEB, M0290S) were added to the anaphase XEE beads and incubated 30 °C for 30 minutes to allow dephosphorylation of the phosphatase-treated sample. .. After incubation, beads were washed three times with 1× NEBuffer 3 and eluted with DeStreak Rehydration Solution (GE Healthcare).

    Article Title: Effects of Single Nucleotide Polymorphisms in Human KCNMA1 on BK Current Properties
    Article Snippet: .. For dephosphorylation experiments, calf intestinal alkaline phosphatase (Alk P, Cat. #M0290S, New England Biolabs Inc., Ipswich, MA, USA) was warmed to room temperature and diluted to 10 U/ml in the internal bath solution (with 1-μM Ca2+ ), and currents were recorded from inside out patches in control bath solution, or bath solution containing Alk P, 1 min after, patches were excised. .. For redox experiments, the reducing agent dithiothreitol (DTT, 1 mM, cat. #2325, Invitrogen, Waltham, MA, USA) and oxidizing agent hydrogen peroxide (H2 O2 , 0.3%, Cat. #H1009, Sigma-Aldrich, St. Louis, MO, USA) were diluted to working concentrations in the internal bath solution (with 10-μM Ca2+ ).

    Article Title: K45A mutation of RIPK1 results in poor necroptosis and cytokine signaling in macrophages, which impacts inflammatory responses in vivo
    Article Snippet: .. Dephosphorylation of the total protein was performed with 50U of Alkaline Phosphatase, Calf Intestinal – CIP, (M0290, NEB, Ipswich, MA, USA) in RIPA-EDTA free, supplemented with protease inhibitors but not phosphatase inhibitors, and 1 × CutSmart NEB buffer. .. BMDMs were treated for 3 h with LPS/zVAD or TNF α /zVAD before proceeding with immunoprecipitation.

    Article Title: Phosphorylation of huntingtin at residue T3 is decreased in Huntington’s disease and modulates mutant huntingtin protein conformation
    Article Snippet: .. Dephosphorylation of protein was performed using 10 unit/µL concentrated alkaline phosphatase (calf intestinal phosphatase, catalog #M0290S; New England Biolabs), following the manufacturer’s instructions. .. Plasmid and Constructs. cDNAs encoding N-terminal HTT fragments (exon 1) bearing different polyQ lengths (Q16, Q39, or Q72) were synthesized by Genscript, quality-controlled by DNA sequencing, and subcloned into pCDNA3.1, and their expression in mammalian cells was validated as previously reported ( ).

    Lysis:

    Article Title: Afferent Regulation of Chicken Auditory Brainstem Neurons: Rapid Changes in Phosphorylation of Elongation Factor 2
    Article Snippet: .. For phosphatase treatment, HEK293 cells were incubated in a lysis buffer with Calf Intestinal Phosphatase (CIP; # M0290S; New England Biolabs, Ipswich, MA) at 1 unit CIP per 1 μg protein for 30 minutes at 37ºC before harvest. ..

    Article Title: A reversible phospho-switch mediated by ULK1 regulates the activity of autophagy protease ATG4B
    Article Snippet: .. Phosphatase treatment of cell extracts Cell lysates or IP samples were divided equally into tubes on ice containing 1/10 volume of Calf Intestinal Phosphatase (New England BioLabs, M0290L) or an equivalent volume of lysis buffer or IP buffer for control reactions. ..

    Titration:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    SDS Page:

    Article Title: T47D Cells Expressing Myeloperoxidase Are Able to Process, Traffic and Store the Mature Protein in Lysosomes: Studies in T47D Cells Reveal a Role for Cys319 in MPO Biosynthesis that Precedes Its Known Role in Inter-Molecular Disulfide Bond Formation
    Article Snippet: Reagents NuPage 4–12% Bis-Tris SDS-PAGE gels and MOPS-SDS running buffer were from Life Technologies. .. The enzymes PNGase F (P0704S), Endoglycosidase H (P0702S) and calf intestinal phosphatase (M0290S) were from New England Biolabs.

    Article Title: The MAP kinase pathway coordinates crossover designation with disassembly of synaptonemal complex proteins during meiosis
    Article Snippet: Thirty microliters of immunoprecipitate were incubated with 20 units of calf intestinal phosphatase (NEB catalog # M0290S) for 1 hr at 37°C. .. The immunoprecipitate was purified after CIP treatment by using a Pierce SDS-PAGE sample prep kit (catalog # 89888).

    Plasmid Preparation:

    Article Title: In vitro Reconstitution Assay of miRNA Biogenesis by Arabidopsis DCL1
    Article Snippet: .. Negative control plasmid: pBA] G-Tube® snap cap siliconized microcentrifuge tubes (VWR International, catalog number: 22179-004) Anti-FLAG® M2 magnetic beads (Sigma-Aldrich, catalog number: M8823) 3x Flag peptide (NH2-MDYKDHDGDYKDHDIDYKDDDDK-COOH) (Sigma-Aldrich, catalog number: F4799) DNase (Promega Corporation, catalog number: M6101) 3,000 Ci/mmol 10 mCi/ml [γ-32 P]-ATP (PerkinElmer, catalog number: BLU502A100UC) SuperaseIn RNase inhibitor (Ambion, catalog number: N8080119) T7 RNA polymerase (Ambion, catalog number: 18033019) Calf intestine alkaline phosphatase (NEB, catalog number: M0290S) Phenol: chloroform: isoamyl alcohol (25:24:1) (Life Technologies, Invitrogen™ , catalog number: 15593049) NaAc (Sigma-Aldrich, catalog number: S7670) 5 M ammonium acetate (Ambion, catalog: AM9071) GlycoBlue (Ambion, catalog number: AM9516) Decade marker (Ambion, catalog number: AM7778) Anti-c-Myc Agarose Affinity Gel (Sigma-Aldrich, catalog number: A7470) EDTA-free protease inhibitor cocktail (Roche Diagnostics, catalog number: 05892953001) Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P2714) HEPES (Sigma-Aldrich, catalog number: H3375) Spermidine (Sigma-Aldrich, catalog number: S2626) DTT (DL-Dithiothreitol) (Sigma-Aldrich, catalog number: 43817) MgCl2 (Sigma-Aldrich, catalog number: M8266) NTP (Thermo scientific, catalog number: R0481) Deionized formamide (Ambion, catalog number: AM9342) Bromophenol blue (Sigma-Aldrich, catalog number: B0126) Xylene cyanol (Sigma-Aldrich, catalog number: X4126) EDTA (Sigma-Aldrich, catalog number: V900106) SDS (Sigma-Aldrich, catalog number: L3771) DEPC (Sigma-Aldrich, catalog number: V900882) KCl (Sigma-Aldrich, catalog number: V900068) Tris-HCl (Sigma-Aldrich, catalog number: V900312) Triton X-100 (Sigma-Aldrich, catalog number: V900502) PMSF (Sigma-Aldrich, catalog number: 78830) NaCl (Sigma-Aldrich, catalog number: V900058) ATP (Thermo scientific, catalog number: R1441) GTP (Thermo scientific, catalog number: R1461) Glycerol (Sigma-Aldrich, catalog number: V900122) 0.1 M Glycine-HCl (Sigma-Aldrich, catalog number: 55097-5ML-F) 5x transcription buffer (see Recipes) RNA loading buffer (see Recipes) RNA elution buffer (see Recipes) DEPC H2 O (see Recipes) RNA dissolve buffer (see Recipes) Chloroform: isoamyl alcohol (24:1) (see Recipes) IP buffer (see Recipes) Protease inhibitor cocktail stock (see Recipes) TBS buffer (see Recipes) 3x Flag elution buffer stock (see Recipes) Washing buffer (see Recipes) Assay buffer (see Recipes) Fixing buffer (see Recipes) .. Compact UV lamp (UVP, model: UVGL-25) Fluor-Coated TLC Plate (10 × 10 cm) (Ambion, catalog number: AM10110) Geiger counter (Medcom, model: CRM-100) Vertical electrophoresis system (Whatman, model: V15.17) Thermomixer C (Eppendorf, model: 5382000023) Gel dryer (Bio-Rad Laboratories, model: 583) Gel analyzer Quantity One (Bio-Rad Laboratories, version: 4.6.9) DynaMag™ -2 (Life technologies, model: 12321D) Rugged Rotator (Glas-Col, model: 099A MR1512) PolyATtract® System 1000 Magnetic Separation Stand (Promega Corporation, model: Z541A) Phospho imager (PharosFX™ plus system)

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: .. Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Software:

    Article Title: K45A mutation of RIPK1 results in poor necroptosis and cytokine signaling in macrophages, which impacts inflammatory responses in vivo
    Article Snippet: Densitometric analysis was performed with the GE Healthcare ImageQuantTL software (Piscataway, NJ, USA). .. Dephosphorylation of the total protein was performed with 50U of Alkaline Phosphatase, Calf Intestinal – CIP, (M0290, NEB, Ipswich, MA, USA) in RIPA-EDTA free, supplemented with protease inhibitors but not phosphatase inhibitors, and 1 × CutSmart NEB buffer.

    Negative Control:

    Article Title: In vitro Reconstitution Assay of miRNA Biogenesis by Arabidopsis DCL1
    Article Snippet: .. Negative control plasmid: pBA] G-Tube® snap cap siliconized microcentrifuge tubes (VWR International, catalog number: 22179-004) Anti-FLAG® M2 magnetic beads (Sigma-Aldrich, catalog number: M8823) 3x Flag peptide (NH2-MDYKDHDGDYKDHDIDYKDDDDK-COOH) (Sigma-Aldrich, catalog number: F4799) DNase (Promega Corporation, catalog number: M6101) 3,000 Ci/mmol 10 mCi/ml [γ-32 P]-ATP (PerkinElmer, catalog number: BLU502A100UC) SuperaseIn RNase inhibitor (Ambion, catalog number: N8080119) T7 RNA polymerase (Ambion, catalog number: 18033019) Calf intestine alkaline phosphatase (NEB, catalog number: M0290S) Phenol: chloroform: isoamyl alcohol (25:24:1) (Life Technologies, Invitrogen™ , catalog number: 15593049) NaAc (Sigma-Aldrich, catalog number: S7670) 5 M ammonium acetate (Ambion, catalog: AM9071) GlycoBlue (Ambion, catalog number: AM9516) Decade marker (Ambion, catalog number: AM7778) Anti-c-Myc Agarose Affinity Gel (Sigma-Aldrich, catalog number: A7470) EDTA-free protease inhibitor cocktail (Roche Diagnostics, catalog number: 05892953001) Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P2714) HEPES (Sigma-Aldrich, catalog number: H3375) Spermidine (Sigma-Aldrich, catalog number: S2626) DTT (DL-Dithiothreitol) (Sigma-Aldrich, catalog number: 43817) MgCl2 (Sigma-Aldrich, catalog number: M8266) NTP (Thermo scientific, catalog number: R0481) Deionized formamide (Ambion, catalog number: AM9342) Bromophenol blue (Sigma-Aldrich, catalog number: B0126) Xylene cyanol (Sigma-Aldrich, catalog number: X4126) EDTA (Sigma-Aldrich, catalog number: V900106) SDS (Sigma-Aldrich, catalog number: L3771) DEPC (Sigma-Aldrich, catalog number: V900882) KCl (Sigma-Aldrich, catalog number: V900068) Tris-HCl (Sigma-Aldrich, catalog number: V900312) Triton X-100 (Sigma-Aldrich, catalog number: V900502) PMSF (Sigma-Aldrich, catalog number: 78830) NaCl (Sigma-Aldrich, catalog number: V900058) ATP (Thermo scientific, catalog number: R1441) GTP (Thermo scientific, catalog number: R1461) Glycerol (Sigma-Aldrich, catalog number: V900122) 0.1 M Glycine-HCl (Sigma-Aldrich, catalog number: 55097-5ML-F) 5x transcription buffer (see Recipes) RNA loading buffer (see Recipes) RNA elution buffer (see Recipes) DEPC H2 O (see Recipes) RNA dissolve buffer (see Recipes) Chloroform: isoamyl alcohol (24:1) (see Recipes) IP buffer (see Recipes) Protease inhibitor cocktail stock (see Recipes) TBS buffer (see Recipes) 3x Flag elution buffer stock (see Recipes) Washing buffer (see Recipes) Assay buffer (see Recipes) Fixing buffer (see Recipes) .. Compact UV lamp (UVP, model: UVGL-25) Fluor-Coated TLC Plate (10 × 10 cm) (Ambion, catalog number: AM10110) Geiger counter (Medcom, model: CRM-100) Vertical electrophoresis system (Whatman, model: V15.17) Thermomixer C (Eppendorf, model: 5382000023) Gel dryer (Bio-Rad Laboratories, model: 583) Gel analyzer Quantity One (Bio-Rad Laboratories, version: 4.6.9) DynaMag™ -2 (Life technologies, model: 12321D) Rugged Rotator (Glas-Col, model: 099A MR1512) PolyATtract® System 1000 Magnetic Separation Stand (Promega Corporation, model: Z541A) Phospho imager (PharosFX™ plus system)

    Low Protein Binding:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: .. Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Sample Prep:

    Article Title: The MAP kinase pathway coordinates crossover designation with disassembly of synaptonemal complex proteins during meiosis
    Article Snippet: Thirty microliters of immunoprecipitate were incubated with 20 units of calf intestinal phosphatase (NEB catalog # M0290S) for 1 hr at 37°C. .. The immunoprecipitate was purified after CIP treatment by using a Pierce SDS-PAGE sample prep kit (catalog # 89888).

    Activation Assay:

    Article Title: Effects of Single Nucleotide Polymorphisms in Human KCNMA1 on BK Current Properties
    Article Snippet: Activation kinetics were determined by fitting the rising phase of the outward currents to single exponential functions. .. For dephosphorylation experiments, calf intestinal alkaline phosphatase (Alk P, Cat. #M0290S, New England Biolabs Inc., Ipswich, MA, USA) was warmed to room temperature and diluted to 10 U/ml in the internal bath solution (with 1-μM Ca2+ ), and currents were recorded from inside out patches in control bath solution, or bath solution containing Alk P, 1 min after, patches were excised.

    Concentration Assay:

    Article Title: Whole genome variant association across 100 dogs identifies a frame shift mutation in DISHEVELLED 2 which contributes to Robinow-like syndrome in Bulldogs and related screw tail dog breeds
    Article Snippet: .. For phosphatase treatment, 17.3μg of protein from cell lysates were treated with 7 U of CIP (NEB, catalog #M0290S; final concentration of 350U/mL) at 37C for 30 minutes. ..

    Article Title: Phosphorylation of huntingtin at residue T3 is decreased in Huntington’s disease and modulates mutant huntingtin protein conformation
    Article Snippet: Pure trifluoroacetic acid was added to the lyophilized protein powder for disaggregation, and proteins were then dissolved in TBS buffer (50 mM Tris 150 mM NaCl) to obtain a final concentration of 20 µM (pH adjusted to 7.2–7.4 using 1 M NaOH). .. Dephosphorylation of protein was performed using 10 unit/µL concentrated alkaline phosphatase (calf intestinal phosphatase, catalog #M0290S; New England Biolabs), following the manufacturer’s instructions.

    DNA Purification:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: .. Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Marker:

    Article Title: In vitro Reconstitution Assay of miRNA Biogenesis by Arabidopsis DCL1
    Article Snippet: .. Negative control plasmid: pBA] G-Tube® snap cap siliconized microcentrifuge tubes (VWR International, catalog number: 22179-004) Anti-FLAG® M2 magnetic beads (Sigma-Aldrich, catalog number: M8823) 3x Flag peptide (NH2-MDYKDHDGDYKDHDIDYKDDDDK-COOH) (Sigma-Aldrich, catalog number: F4799) DNase (Promega Corporation, catalog number: M6101) 3,000 Ci/mmol 10 mCi/ml [γ-32 P]-ATP (PerkinElmer, catalog number: BLU502A100UC) SuperaseIn RNase inhibitor (Ambion, catalog number: N8080119) T7 RNA polymerase (Ambion, catalog number: 18033019) Calf intestine alkaline phosphatase (NEB, catalog number: M0290S) Phenol: chloroform: isoamyl alcohol (25:24:1) (Life Technologies, Invitrogen™ , catalog number: 15593049) NaAc (Sigma-Aldrich, catalog number: S7670) 5 M ammonium acetate (Ambion, catalog: AM9071) GlycoBlue (Ambion, catalog number: AM9516) Decade marker (Ambion, catalog number: AM7778) Anti-c-Myc Agarose Affinity Gel (Sigma-Aldrich, catalog number: A7470) EDTA-free protease inhibitor cocktail (Roche Diagnostics, catalog number: 05892953001) Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P2714) HEPES (Sigma-Aldrich, catalog number: H3375) Spermidine (Sigma-Aldrich, catalog number: S2626) DTT (DL-Dithiothreitol) (Sigma-Aldrich, catalog number: 43817) MgCl2 (Sigma-Aldrich, catalog number: M8266) NTP (Thermo scientific, catalog number: R0481) Deionized formamide (Ambion, catalog number: AM9342) Bromophenol blue (Sigma-Aldrich, catalog number: B0126) Xylene cyanol (Sigma-Aldrich, catalog number: X4126) EDTA (Sigma-Aldrich, catalog number: V900106) SDS (Sigma-Aldrich, catalog number: L3771) DEPC (Sigma-Aldrich, catalog number: V900882) KCl (Sigma-Aldrich, catalog number: V900068) Tris-HCl (Sigma-Aldrich, catalog number: V900312) Triton X-100 (Sigma-Aldrich, catalog number: V900502) PMSF (Sigma-Aldrich, catalog number: 78830) NaCl (Sigma-Aldrich, catalog number: V900058) ATP (Thermo scientific, catalog number: R1441) GTP (Thermo scientific, catalog number: R1461) Glycerol (Sigma-Aldrich, catalog number: V900122) 0.1 M Glycine-HCl (Sigma-Aldrich, catalog number: 55097-5ML-F) 5x transcription buffer (see Recipes) RNA loading buffer (see Recipes) RNA elution buffer (see Recipes) DEPC H2 O (see Recipes) RNA dissolve buffer (see Recipes) Chloroform: isoamyl alcohol (24:1) (see Recipes) IP buffer (see Recipes) Protease inhibitor cocktail stock (see Recipes) TBS buffer (see Recipes) 3x Flag elution buffer stock (see Recipes) Washing buffer (see Recipes) Assay buffer (see Recipes) Fixing buffer (see Recipes) .. Compact UV lamp (UVP, model: UVGL-25) Fluor-Coated TLC Plate (10 × 10 cm) (Ambion, catalog number: AM10110) Geiger counter (Medcom, model: CRM-100) Vertical electrophoresis system (Whatman, model: V15.17) Thermomixer C (Eppendorf, model: 5382000023) Gel dryer (Bio-Rad Laboratories, model: 583) Gel analyzer Quantity One (Bio-Rad Laboratories, version: 4.6.9) DynaMag™ -2 (Life technologies, model: 12321D) Rugged Rotator (Glas-Col, model: 099A MR1512) PolyATtract® System 1000 Magnetic Separation Stand (Promega Corporation, model: Z541A) Phospho imager (PharosFX™ plus system)

    Staining:

    Article Title: Ex vivo Culture and Lentiviral Transduction of Benign Prostatic Hyperplasia (BPH) Samples
    Article Snippet: Lentiviral vector generation pLVX Lenti-X Tet-One inducible expression system (Clontech, catalog number: 631847) FWDseq : taaaccagggcgcctataaa (IDT custom primer) REVseq : taggcagtagctctgacggc (IDT custom primer) Bam HI (NEB, catalog number: R3136S) Eco RI (NEB, catalog number: R3101S) Calf Intestinal Alkaline Phosphatase (CIAP; NEB, catalog number: M0290S) Hi-fidelity DNA polymerase for PCR amplification ( e.g., Platinum PCR SuperMix, Invitrogen, catalog number: 12532-016 or PfuTurbo DNA Polymerase, Agilent Technologies, catalog number: 600252) In-Fusion HD enzyme (Clontech, catalog number: 638910) QIAquick gel extraction columns (QIAGEN, catalog number: 28704) Ampicillin 100 mg/ml (dissolved in ddH2 O and filtered sterilized) Small-scale plasmid DNA purification QIAprep Spin Miniprep kit (QIAGEN, catalog number: 27104) Large-scale plasmid DNA purification Maxi kit (QIAGEN, catalog number: 12163) Yeast extract Tryptone NaCl 2YT media (see ) Lentiviral particules packaging Syringe 0.45 μm filters Caution: Make sure to use low protein-binding, such as Millex-HV Filter PVDF (Millipore, catalog number: SLHVM33RS) to prevent binding of viral particules to the membrane and loss . .. 100 mm culture dishes Amicon Ultra-15 (Millipore, catalog number: UFC903024) HEK293T cell line (ATCC, catalog number: CRL-3216) Packaging plasmids (pMD2.G and psPAX2 from Addgene, catalog numbers: 12260 and 12259, respectively) to be transformed and purified ( e.g., Maxi kit, QIAGEN, catalog number: 12163) Transfection reagent TransIT-LT1 (Mirus MIR, catalog number: 2305) Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, catalog number: D6171) Lentiviral particules transduction and titration 6-well culture plates LNCaP cell line (ATCC, catalog number: CRL-1740) RPMI-1640 media (Sigma-Aldrich, catalog number: R5886) 200 mM L-glutamine (Invitrogen) Fetal calf serum (Gibco) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Puromycin dihydrochloride (Sigma-Aldrich, catalog number: P9620) Crystal violet Induction of gene expression 10% ethanol Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, catalog number: A8592) Doxycycline (Sigma-Aldrich, 10 mg/ml) 4% formalin Ex vivo tissue preparation and transduction Scalpels or surgical blades Hydrophobic pen (DAKO) 100% ethanol Media (RPMI-1640, Sigma-Aldrich, catalog number: R5886) Gelatin sponges (Spongostan, Johnson & Johnson, catalog number: 1364245) Antimycotic solution (Sigma-Aldrich, catalog number: A5955) 10 μg/ml hydrocortisone (Sigma-Aldrich) 10 μg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516) Hexadimethrine bromide (Polybrene, Sigma-Aldrich, catalog number: H9268) Doxycycline (10 mg/ml) Bovine Serum Albumin (Sigma-Aldrich) HRP-conjugated secondary antibodies ImmPRESS™ HRP Anti-Rabbit IgG (Vector Laboratories, catalog number: MP-7401) ImmPRESS™ HRP Anti-mouse IgG (Vector Laboratories, catalog number: MP-7402) ImmPACT DAB Peroxidase (HRP) Substrate (Vector Laboratories, catalog number: SK-4105) Xylene DPX mounting media (Sigma) Tetracycline-free FBS (Clontech, catalog number: 631106) Immunohistochemistry staining for proliferation markers Primary antibodies for proliferation markers: H3S10phos (Millipore, catalog number: 06-570) Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0) ( e.g., Abcam, catalog number: ab93678) NaHCO3 MgSO4 Hematoxylin Scott's tap water substitute (see ) Gill's Hematoxylin II solution (see )

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs calf intestinal alkaline phosphatase cip
    Ser/Thr and Tyr autophosphorylation independently influence substrate specificity. Increasing amounts (8, 20, and 50 ng) of P-Clk/Sty (lanes 2 to 4), <t>PTP-Clk/Sty</t> (lanes 5 to 7), and <t>CIP-Clk/Sty</t> (lanes 8 to 10) were added to splicing reactions performed with S100 extracts in the presence of phosphatase inhibitors and ASF/SF2 (A) or SC35 (B). Reaction mixtures were deproteinized after 80 min, and RNAs were precipitated with ethanol. RNAs were fractionated by 5% denaturing PAGE and visualized by autoradiography.
    Calf Intestinal Alkaline Phosphatase Cip, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 131 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/calf intestinal alkaline phosphatase cip/product/New England Biolabs
    Average 95 stars, based on 131 article reviews
    Price from $9.99 to $1999.99
    calf intestinal alkaline phosphatase cip - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Ser/Thr and Tyr autophosphorylation independently influence substrate specificity. Increasing amounts (8, 20, and 50 ng) of P-Clk/Sty (lanes 2 to 4), PTP-Clk/Sty (lanes 5 to 7), and CIP-Clk/Sty (lanes 8 to 10) were added to splicing reactions performed with S100 extracts in the presence of phosphatase inhibitors and ASF/SF2 (A) or SC35 (B). Reaction mixtures were deproteinized after 80 min, and RNAs were precipitated with ethanol. RNAs were fractionated by 5% denaturing PAGE and visualized by autoradiography.

    Journal: Molecular and Cellular Biology

    Article Title: Regulation and Substrate Specificity of the SR Protein Kinase Clk/Sty

    doi: 10.1128/MCB.23.12.4139-4149.2003

    Figure Lengend Snippet: Ser/Thr and Tyr autophosphorylation independently influence substrate specificity. Increasing amounts (8, 20, and 50 ng) of P-Clk/Sty (lanes 2 to 4), PTP-Clk/Sty (lanes 5 to 7), and CIP-Clk/Sty (lanes 8 to 10) were added to splicing reactions performed with S100 extracts in the presence of phosphatase inhibitors and ASF/SF2 (A) or SC35 (B). Reaction mixtures were deproteinized after 80 min, and RNAs were precipitated with ethanol. RNAs were fractionated by 5% denaturing PAGE and visualized by autoradiography.

    Article Snippet: Tyr-dephosphorylated Clk/Sty (PTP-Clk/Sty) and unphosphorylated Clk/Sty (CIP-Clk/Sty) were prepared by adding 200 U of protein tyrosine phosphatase (PTP) (Boehringer Mannheim) and 40 U of calf intestinal alkaline phosphatase (CIP) (New England Biolabs), respectively, to 400 μg of P-Clk/Sty bound to glutathione beads, and dephosphorylation was carried out according to the manufacturers' instructions.

    Techniques: Polyacrylamide Gel Electrophoresis, Autoradiography

    Autophosphorylation of Clk/Sty modulates kinase activity towards ASF/SF2 but not SRp40. (A) Increasing amounts of P-Clk/Sty (1, 5, and 20 ng) and equivalent amounts of PTP- and CIP-Clk/Sty were incubated with 1 μg of MBP under kinase conditions. Reactions were stopped by adding 1/2 volume of 3× SDS sample buffer, and proteins were fractionated by 10% SDS-PAGE and detected by autoradiography. (B and C) Increasing amounts of P-Clk/Sty (5, 20, and 100 ng) or equivalent amounts of PTP- and CIP-Clk/Sty were added to 1 μg of ASF/SF2 (B) or SRp40 (C) purified from E. coli and incubated for 30 min at 37°C. Reactions were processed as described for panel A except that proteins were transferred to nitrocellulose following PAGE. The extent of γ- 32 P incorporation was visualized by autoradiography (lanes 1 to 10). Subsequently, blots were incubated with the monoclonal antibody mAb104 (lanes 11 to 20) and reactivity was detected by chemiluminescence.

    Journal: Molecular and Cellular Biology

    Article Title: Regulation and Substrate Specificity of the SR Protein Kinase Clk/Sty

    doi: 10.1128/MCB.23.12.4139-4149.2003

    Figure Lengend Snippet: Autophosphorylation of Clk/Sty modulates kinase activity towards ASF/SF2 but not SRp40. (A) Increasing amounts of P-Clk/Sty (1, 5, and 20 ng) and equivalent amounts of PTP- and CIP-Clk/Sty were incubated with 1 μg of MBP under kinase conditions. Reactions were stopped by adding 1/2 volume of 3× SDS sample buffer, and proteins were fractionated by 10% SDS-PAGE and detected by autoradiography. (B and C) Increasing amounts of P-Clk/Sty (5, 20, and 100 ng) or equivalent amounts of PTP- and CIP-Clk/Sty were added to 1 μg of ASF/SF2 (B) or SRp40 (C) purified from E. coli and incubated for 30 min at 37°C. Reactions were processed as described for panel A except that proteins were transferred to nitrocellulose following PAGE. The extent of γ- 32 P incorporation was visualized by autoradiography (lanes 1 to 10). Subsequently, blots were incubated with the monoclonal antibody mAb104 (lanes 11 to 20) and reactivity was detected by chemiluminescence.

    Article Snippet: Tyr-dephosphorylated Clk/Sty (PTP-Clk/Sty) and unphosphorylated Clk/Sty (CIP-Clk/Sty) were prepared by adding 200 U of protein tyrosine phosphatase (PTP) (Boehringer Mannheim) and 40 U of calf intestinal alkaline phosphatase (CIP) (New England Biolabs), respectively, to 400 μg of P-Clk/Sty bound to glutathione beads, and dephosphorylation was carried out according to the manufacturers' instructions.

    Techniques: Activity Assay, Incubation, SDS Page, Autoradiography, Purification, Polyacrylamide Gel Electrophoresis

    Clk/Sty is autophosphorylated on Ser/Thr and Thr. (A) A total of 1 μg each of GST-Clk/Sty (lane 1) and a kinase-inactive mutant (GST-ClkR/Sty; lane 2) was fractionated by 10% SDS-PAGE and stained with Coomassie blue. The species indicated by the asterisk reflects an N-terminal truncation consisting of GST plus an approximately 10-kDa segment of Clk/Sty, which became phosphorylated in the wild-type but not the mutant sample. (B) A total of 0.5 μg of P-, PTP-, and CIP-Clk/Sty (lanes 1 to 3, respectively), was fractionated by 10% SDS-PAGE and stained with Coomassie blue. (C) A total of 20 to 50 ng of P-Clk/Sty (lane 1), PTP-Clk/Sty (lane 2), and CIP-Clk/Sty (lane 3) was fractionated by 10% SDS-PAGE and transferred to nitrocellulose. The blot was probed with antiphosphotyrosine antibody, and proteins were detected by chemiluminescence.

    Journal: Molecular and Cellular Biology

    Article Title: Regulation and Substrate Specificity of the SR Protein Kinase Clk/Sty

    doi: 10.1128/MCB.23.12.4139-4149.2003

    Figure Lengend Snippet: Clk/Sty is autophosphorylated on Ser/Thr and Thr. (A) A total of 1 μg each of GST-Clk/Sty (lane 1) and a kinase-inactive mutant (GST-ClkR/Sty; lane 2) was fractionated by 10% SDS-PAGE and stained with Coomassie blue. The species indicated by the asterisk reflects an N-terminal truncation consisting of GST plus an approximately 10-kDa segment of Clk/Sty, which became phosphorylated in the wild-type but not the mutant sample. (B) A total of 0.5 μg of P-, PTP-, and CIP-Clk/Sty (lanes 1 to 3, respectively), was fractionated by 10% SDS-PAGE and stained with Coomassie blue. (C) A total of 20 to 50 ng of P-Clk/Sty (lane 1), PTP-Clk/Sty (lane 2), and CIP-Clk/Sty (lane 3) was fractionated by 10% SDS-PAGE and transferred to nitrocellulose. The blot was probed with antiphosphotyrosine antibody, and proteins were detected by chemiluminescence.

    Article Snippet: Tyr-dephosphorylated Clk/Sty (PTP-Clk/Sty) and unphosphorylated Clk/Sty (CIP-Clk/Sty) were prepared by adding 200 U of protein tyrosine phosphatase (PTP) (Boehringer Mannheim) and 40 U of calf intestinal alkaline phosphatase (CIP) (New England Biolabs), respectively, to 400 μg of P-Clk/Sty bound to glutathione beads, and dephosphorylation was carried out according to the manufacturers' instructions.

    Techniques: Mutagenesis, SDS Page, Staining

    BIK1 Conserved Residues and in Vitro and in Vivo Kinase Assays. (A) Structure of the BIK1 protein and comparison of residues in the ADs of BIK1 and related kinases. Gray region denotes the KD and black the AD. Residues noted in the BIK1 protein indicate those substituted for in planta assays. (B) Kinase activity of recombinant BIK1 and Ala substitution mutants produced in E. coli detected by autoradiogram. CCB, Coomassie blue staining. (C) and (D) BIK1 substitution mutants in vivo detected by a mobility shift on an HA-immunoblot or by phosphoserine/Thr-specific antibody. (E) BIK1 and MBP phosphorylation is abrogated by phosphatase treatment. Protein dephosphorylation was performed according to the manufacturer’s protocol (New England Biolabs) with ~1 to 2.5 units CIP/μg protein (left) or (~2.5 μ/μg) (right). −, Buffer; +, CIP. In (C) and (D) , plants were treated with ACC (Ac) or flg22 (Fl) for 3 h and assayed for changes in BIK1 and MBP phosphorylation activity. In (C) to (E) , in vivo BIK1 phosphorylation was detected by ACC or flagellin-induced mobility shifts observable by HA-immunoblot. The top band corresponds to phosphorylated BIK1, which is migrating slower than the unphosphorylated form. MBP phosphorylation by BIK1 was detected by immunoblots with a phosphoserine/Thr-specific antibody.

    Journal: The Plant Cell

    Article Title: Biochemical and Genetic Requirements for Function of the Immune Response Regulator BOTRYTIS-INDUCED KINASE1 in Plant Growth, Ethylene Signaling, and PAMP-Triggered Immunity in Arabidopsis [C] [C] [W]

    doi: 10.1105/tpc.111.087122

    Figure Lengend Snippet: BIK1 Conserved Residues and in Vitro and in Vivo Kinase Assays. (A) Structure of the BIK1 protein and comparison of residues in the ADs of BIK1 and related kinases. Gray region denotes the KD and black the AD. Residues noted in the BIK1 protein indicate those substituted for in planta assays. (B) Kinase activity of recombinant BIK1 and Ala substitution mutants produced in E. coli detected by autoradiogram. CCB, Coomassie blue staining. (C) and (D) BIK1 substitution mutants in vivo detected by a mobility shift on an HA-immunoblot or by phosphoserine/Thr-specific antibody. (E) BIK1 and MBP phosphorylation is abrogated by phosphatase treatment. Protein dephosphorylation was performed according to the manufacturer’s protocol (New England Biolabs) with ~1 to 2.5 units CIP/μg protein (left) or (~2.5 μ/μg) (right). −, Buffer; +, CIP. In (C) and (D) , plants were treated with ACC (Ac) or flg22 (Fl) for 3 h and assayed for changes in BIK1 and MBP phosphorylation activity. In (C) to (E) , in vivo BIK1 phosphorylation was detected by ACC or flagellin-induced mobility shifts observable by HA-immunoblot. The top band corresponds to phosphorylated BIK1, which is migrating slower than the unphosphorylated form. MBP phosphorylation by BIK1 was detected by immunoblots with a phosphoserine/Thr-specific antibody.

    Article Snippet: Protein dephosphorylation was performed using calf intestinal alkaline phosphatase (CIP) according to the manufacturer’s protocol (New England Biolabs) with ~1 to 2.5 units of CIP (as indicated)/μg protein.

    Techniques: In Vitro, In Vivo, Activity Assay, Recombinant, Produced, Staining, Mobility Shift, De-Phosphorylation Assay, Western Blot

    Characterization of the anti-EF-1δ-S133 P monoclonal antibody. (A) HEK293T cells were transfected with a plasmid expressing EGFP-EF-1δ(F) (lane 1 and 2) or a plasmid expressing EGFP-EF-1δS133A(F) (lane 3) and harvested at 48 h posttransfection. Cell lysates were mock treated (lanes 1 and 3) or treated with CIP (lane 2) and then analyzed by immunoblotting with anti-Flag monoclonal antibody (top), anti-EF-1δ-S133 P monoclonal antibody (middle), or anti-β-actin monoclonal antibody (bottom). β-Actin was used as a loading control. (B) U2OS cells were mock infected (lane 1) or infected with wild-type HSV-2 186 (lane 2), YK862 (ΔUL13) (lane 3), or YK863 (ΔUL13-repair) (lane 4) at an MOI of 3 and harvested at 24 h postinfection, and lysates were analyzed by immunoblotting with the indicated antibodies. α-Tubulin and UL37 were used as a loading control and an infection indicator, respectively. (C) U2OS cells were mock infected (lanes 1) or infected with wild-type HSV-2 186 (lane 2), YK864 (UL13-K176M) (lane 3), or YK865 (UL13-K176M-repair) (lane 4) and harvested, and lysates were analyzed as described above for panel B. Molecular mass markers are shown on the left.

    Journal: Journal of Virology

    Article Title: Regulation of Herpes Simplex Virus 2 Protein Kinase UL13 by Phosphorylation and Its Role in Viral Pathogenesis

    doi: 10.1128/JVI.00807-18

    Figure Lengend Snippet: Characterization of the anti-EF-1δ-S133 P monoclonal antibody. (A) HEK293T cells were transfected with a plasmid expressing EGFP-EF-1δ(F) (lane 1 and 2) or a plasmid expressing EGFP-EF-1δS133A(F) (lane 3) and harvested at 48 h posttransfection. Cell lysates were mock treated (lanes 1 and 3) or treated with CIP (lane 2) and then analyzed by immunoblotting with anti-Flag monoclonal antibody (top), anti-EF-1δ-S133 P monoclonal antibody (middle), or anti-β-actin monoclonal antibody (bottom). β-Actin was used as a loading control. (B) U2OS cells were mock infected (lane 1) or infected with wild-type HSV-2 186 (lane 2), YK862 (ΔUL13) (lane 3), or YK863 (ΔUL13-repair) (lane 4) at an MOI of 3 and harvested at 24 h postinfection, and lysates were analyzed by immunoblotting with the indicated antibodies. α-Tubulin and UL37 were used as a loading control and an infection indicator, respectively. (C) U2OS cells were mock infected (lanes 1) or infected with wild-type HSV-2 186 (lane 2), YK864 (UL13-K176M) (lane 3), or YK865 (UL13-K176M-repair) (lane 4) and harvested, and lysates were analyzed as described above for panel B. Molecular mass markers are shown on the left.

    Article Snippet: Lysates of Vero cells that had been infected with wild-type HSV-2 186 at an MOI of 3 for 24 h and lysates of HEK293T cells that had been transfected with pEGFP-EF-1δ(F) were treated with calf intestinal alkaline phosphatase (CIP) (New England BioLabs) as described previously ( ).

    Techniques: Transfection, Plasmid Preparation, Expressing, Infection

    Scheme of the pocket-sized RNA-seq method. 5P-, 5′-phosphate group; 3OH-, 3′-hydroxyl group; 5-, dephosphorylated 5′-end; (AAA)n-3OH, polyadenylated 3′-end; (AAA)n and (TTT)n, polyA and polyT sequences, respectively; RACE, Rapid amplification of cDNA ends; RT, reverse transcription; CIP, calf intestinal phosphatase; oligo-biot, oligonucleotide biotinylated in 5′-end.

    Journal: Non-Coding RNA

    Article Title: “Pocket-sized RNA-Seq”: A Method to Capture New Mature microRNA Produced from a Genomic Region of Interest

    doi: 10.3390/ncrna1020127

    Figure Lengend Snippet: Scheme of the pocket-sized RNA-seq method. 5P-, 5′-phosphate group; 3OH-, 3′-hydroxyl group; 5-, dephosphorylated 5′-end; (AAA)n-3OH, polyadenylated 3′-end; (AAA)n and (TTT)n, polyA and polyT sequences, respectively; RACE, Rapid amplification of cDNA ends; RT, reverse transcription; CIP, calf intestinal phosphatase; oligo-biot, oligonucleotide biotinylated in 5′-end.

    Article Snippet: One microgram of bait RNA was therefore dephosphorylated using 1 U CIP (Alkaline Phosphatase, Calf Intestinal, New England Biolabs, Evry, France) at 37 °C for 60 min and RNAs were purified by phenol-chloroform extraction.

    Techniques: RNA Sequencing Assay, Rapid Amplification of cDNA Ends