longamp  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    LongAmp Taq 2X Master Mix
    Description:
    LongAmp Taq 2X Master Mix 500 rxns
    Catalog Number:
    M0287L
    Price:
    537
    Category:
    Long distance PCR Kits
    Size:
    500 rxns
    Buy from Supplier


    Structured Review

    New England Biolabs longamp
    LongAmp Taq 2X Master Mix
    LongAmp Taq 2X Master Mix 500 rxns
    https://www.bioz.com/result/longamp/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    longamp - by Bioz Stars, 2021-06
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Metagenomic analysis of medicinalCannabis samples; pathogenic bacteria, toxigenic fungi, and beneficial microbes grow in culture-based yeast and mold tests
    Article Snippet: Quantitative PCR was performed using a commercially available TYM assay (TYM-PathogINDICAtor, Medicinal Genomics, Woburn MA), or TAC assay (TAC-PathogINDICAtor, Medicinal Genomics, Woburn, MA) in a Bio-Rad CFX 96 Touch qPCR instrument, according to the manufacturer’s instructions. .. Primers used for PCR and sequencing PCR was performed using 5μL of DNA (3ng/μL) 12.5μL 2X LongAmp (NEB) with 1.25 μL of each 10 μM MGC-ITS3F and MGC-ITS3R primer or MGC-TAC_F and MGC-TAC_R primer (MGC-ITS3F: TACACGACGTTGTAAAACGACGCATCGATGAAGAACGCAGC), (MGC-ITS3R: AGGATAACAATTTCACACAGGATTTGAGCTCTTGCCGCTTCA), (MGC-TAC_F: TACACGACGTTGTAAAACGATCCTACGGGAGGCAGCAGT) and (MGC-TAC_R: AGGATAACAATTTCACACAGGGGACTACCAGGGTATCTAATCCTGTT) with 10μL ddH20 for a 25 μL total reaction. ..

    Article Title: Short and Long-Read Sequencing Survey of the Dynamic Transcriptomes of African Swine Fever Virus and the Host Cells
    Article Snippet: The strand-switching buffer mixture (RT buffer, RNaseOUT, nuclease-free water, and SSP) was added to the samples, which were incubated at 40°C for 2 min. RT was conducted by adding Maxima H Minus Reverse Transcriptase at 42°C for 90 min. .. The enzyme was inactivated by increasing the temperature to 85°C for 5 min. LongAmp Taq Master Mix, one of the Low Input barcode primers (LWB01-12, from the ONT's SQK-PBK004 kit, ), and nuclease-free water were included in the RT reaction mixture. shows the PCR conditions. .. PCR products were treated with exonuclease (NEB), and the mixture was then incubated at 37°C for 15 min, followed by 80°C for 15 min. AMPure Beads (0.8 BR) was used for purification, and the clean sample was eluted.

    Article Title: Rapid bacterial identification by direct PCR amplification of 16S rRNA genes using the MinION™ nanopore sequencer
    Article Snippet: Bacterial DNA was purified using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) and used as a PCR template. .. PCR amplification of 16S rRNA genes was conducted using the 16S Barcoding Kit (SQK‐RAB204; Oxford Nanopore Technologies, Oxford, UK) containing the 27F/1492R primer set , and LongAmp™ Taq 2× Master Mix (New England Biolabs, Ipswich, MA, USA). .. Amplification was performed using an Applied Biosystems Veriti™ Thermal Cycler (Thermo Fischer Scientific, Waltham, MA, USA) with the following PCR conditions: initial denaturation at 95 °C for 3 min, 25 cycles of 95 °C for 20 s, 55 °C for 30 s, and 65 °C for 2 min, followed by a final extension at 65 °C for 5 min. To determine the effects of human DNA contamination on 16S rRNA gene amplification, genomic DNA purified from the human monocytic cell line THP‐1 was mixed with E. coli DNA and subjected to PCR.

    Article Title: Microtubule nucleation promoters Mto1 and Mto2 regulate cytokinesis in fission yeast
    Article Snippet: Lithium acetate transformation was used to introduce 5–10 μg of integration cassette DNA ( ). .. Integration at the correct locus was verified by colony PCR using LongAmp Taq 2X Master Mix (New England BioLabs), and the mto2 gene was sequenced in its entirety to verify the S338N or S338C point mutations. .. The bgs1D277N strain was generated by CRISPR ( ).

    Article Title: Enrichment by hybridisation of long DNA fragments for Nanopore sequencing
    Article Snippet: .. The ligated DNA was amplified using Long Amp Taq 2x Master mix (#M0287, NEB) and ONT PCR primers with the following program: 95 °C 3 min; 15–18 cycles of 95 °C 15 sec, 62 °C 15 sec, 65 °C 10 min; 65 °C 20 min; 4 °C hold. .. A second round of end repair and dA-tailing was performed on 500 ng of enriched, amplified PCR product using SureSelectXT reagents as described above, but without purification after dA-tailing.

    Article Title: Short and long-read genome sequencing methodologies for somatic variant detection; genomic analysis of a patient with diffuse large B-cell lymphoma
    Article Snippet: Subsequently, full-length double stranded cDNA was generated employing the Nanopore Strand Switching Primer and amplified in 50 µl reaction volumes. .. The PCR reaction contained 5 µl cDNA, 25 µl 2X LongAmp Taq Master Mix (NEB Biolabs Inc, Ipswich, Massachusetts, USA, cat. #M0287S), 1.5 µl Nanopore cDNA Primers and 18.5 µl NFW. .. The amplification products were normalised to ~ 400 fmol into 20 µl of Nanopore Rapid Annealing Buffer.

    Article Title: Targeted RNA-Based Oxford Nanopore Sequencing for Typing 12 Classical HLA Genes
    Article Snippet: Using this information, the molarity of each pool was calculated using the DNA concentration (ng/μl) and the average fragment length (bp) of the gene pool. .. ONT Library Preparation and Sequencing ONT’s sequencing compatible barcoded fragments were prepared in a PCR reaction 0.5 nM of DNA from gene pools, 2 μl of PCR barcode from the 96 PCR Barcoding Kit (ONT), 50 μl of LongAmp Taq 2x Mix (New England Biolabs), and Nuclease-Free water in a final volume of 100 μl where ONT’s universal tails were used as a template for barcode introducing primers. .. The PCR was performed in the following conditions: initial denaturation of 3 min at 95°C, following 15 cycles of 15 s at 95°C, 15 s at 62°C, 30 s at 65°C, and a final extension step 3 min at 65°C.

    Sequencing:

    Article Title: Metagenomic analysis of medicinalCannabis samples; pathogenic bacteria, toxigenic fungi, and beneficial microbes grow in culture-based yeast and mold tests
    Article Snippet: Quantitative PCR was performed using a commercially available TYM assay (TYM-PathogINDICAtor, Medicinal Genomics, Woburn MA), or TAC assay (TAC-PathogINDICAtor, Medicinal Genomics, Woburn, MA) in a Bio-Rad CFX 96 Touch qPCR instrument, according to the manufacturer’s instructions. .. Primers used for PCR and sequencing PCR was performed using 5μL of DNA (3ng/μL) 12.5μL 2X LongAmp (NEB) with 1.25 μL of each 10 μM MGC-ITS3F and MGC-ITS3R primer or MGC-TAC_F and MGC-TAC_R primer (MGC-ITS3F: TACACGACGTTGTAAAACGACGCATCGATGAAGAACGCAGC), (MGC-ITS3R: AGGATAACAATTTCACACAGGATTTGAGCTCTTGCCGCTTCA), (MGC-TAC_F: TACACGACGTTGTAAAACGATCCTACGGGAGGCAGCAGT) and (MGC-TAC_R: AGGATAACAATTTCACACAGGGGACTACCAGGGTATCTAATCCTGTT) with 10μL ddH20 for a 25 μL total reaction. ..

    Article Title: Targeted RNA-Based Oxford Nanopore Sequencing for Typing 12 Classical HLA Genes
    Article Snippet: Using this information, the molarity of each pool was calculated using the DNA concentration (ng/μl) and the average fragment length (bp) of the gene pool. .. ONT Library Preparation and Sequencing ONT’s sequencing compatible barcoded fragments were prepared in a PCR reaction 0.5 nM of DNA from gene pools, 2 μl of PCR barcode from the 96 PCR Barcoding Kit (ONT), 50 μl of LongAmp Taq 2x Mix (New England Biolabs), and Nuclease-Free water in a final volume of 100 μl where ONT’s universal tails were used as a template for barcode introducing primers. .. The PCR was performed in the following conditions: initial denaturation of 3 min at 95°C, following 15 cycles of 15 s at 95°C, 15 s at 62°C, 30 s at 65°C, and a final extension step 3 min at 65°C.

    Amplification:

    Article Title: Rapid bacterial identification by direct PCR amplification of 16S rRNA genes using the MinION™ nanopore sequencer
    Article Snippet: Bacterial DNA was purified using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) and used as a PCR template. .. PCR amplification of 16S rRNA genes was conducted using the 16S Barcoding Kit (SQK‐RAB204; Oxford Nanopore Technologies, Oxford, UK) containing the 27F/1492R primer set , and LongAmp™ Taq 2× Master Mix (New England Biolabs, Ipswich, MA, USA). .. Amplification was performed using an Applied Biosystems Veriti™ Thermal Cycler (Thermo Fischer Scientific, Waltham, MA, USA) with the following PCR conditions: initial denaturation at 95 °C for 3 min, 25 cycles of 95 °C for 20 s, 55 °C for 30 s, and 65 °C for 2 min, followed by a final extension at 65 °C for 5 min. To determine the effects of human DNA contamination on 16S rRNA gene amplification, genomic DNA purified from the human monocytic cell line THP‐1 was mixed with E. coli DNA and subjected to PCR.

    Article Title: Enrichment by hybridisation of long DNA fragments for Nanopore sequencing
    Article Snippet: .. The ligated DNA was amplified using Long Amp Taq 2x Master mix (#M0287, NEB) and ONT PCR primers with the following program: 95 °C 3 min; 15–18 cycles of 95 °C 15 sec, 62 °C 15 sec, 65 °C 10 min; 65 °C 20 min; 4 °C hold. .. A second round of end repair and dA-tailing was performed on 500 ng of enriched, amplified PCR product using SureSelectXT reagents as described above, but without purification after dA-tailing.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs longamp taq
    Taxonomic assignment of the mock community consisting of 10 bacterial species. A mixture of DNA from 10 different bacterial species was analyzed by 16S rRNA amplicon sequencing using MinION™. PCR amplification was performed with <t>LongAmp™</t> <t>Taq</t> or KAPA2G™ polymerase. The samples were analyzed by MinION™ sequencing with different run time conditions, and the percentage of reads mapping to the 10 bacterial species is shown. Expected abundance of individual taxa is based on the genome size and copy number of 16S rRNA genes.
    Longamp Taq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp taq/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    longamp taq - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    Image Search Results


    Taxonomic assignment of the mock community consisting of 10 bacterial species. A mixture of DNA from 10 different bacterial species was analyzed by 16S rRNA amplicon sequencing using MinION™. PCR amplification was performed with LongAmp™ Taq or KAPA2G™ polymerase. The samples were analyzed by MinION™ sequencing with different run time conditions, and the percentage of reads mapping to the 10 bacterial species is shown. Expected abundance of individual taxa is based on the genome size and copy number of 16S rRNA genes.

    Journal: FEBS Open Bio

    Article Title: Rapid bacterial identification by direct PCR amplification of 16S rRNA genes using the MinION™ nanopore sequencer

    doi: 10.1002/2211-5463.12590

    Figure Lengend Snippet: Taxonomic assignment of the mock community consisting of 10 bacterial species. A mixture of DNA from 10 different bacterial species was analyzed by 16S rRNA amplicon sequencing using MinION™. PCR amplification was performed with LongAmp™ Taq or KAPA2G™ polymerase. The samples were analyzed by MinION™ sequencing with different run time conditions, and the percentage of reads mapping to the 10 bacterial species is shown. Expected abundance of individual taxa is based on the genome size and copy number of 16S rRNA genes.

    Article Snippet: PCR amplification of 16S rRNA genes was conducted using the 16S Barcoding Kit (SQK‐RAB204; Oxford Nanopore Technologies, Oxford, UK) containing the 27F/1492R primer set , and LongAmp™ Taq 2× Master Mix (New England Biolabs, Ipswich, MA, USA).

    Techniques: Amplification, Sequencing, Polymerase Chain Reaction