ape1  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    APE 1
    Description:
    APE 1 5 000 units
    Catalog Number:
    m0282l
    Price:
    293
    Size:
    5 000 units
    Category:
    Other Endonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs ape1
    APE 1
    APE 1 5 000 units
    https://www.bioz.com/result/ape1/product/New England Biolabs
    Average 95 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    ape1 - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    2) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    3) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    4) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    5) Product Images from "Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *"

    Article Title: Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.629907

    MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times
    Figure Legend Snippet: MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times

    Techniques Used: Incubation, Recombinant, Purification

    6) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    7) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    8) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    9) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    10) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    11) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    12) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    13) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    14) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    15) Product Images from "Deletion of Individual Ku Subunits in Mice Causes an NHEJ-Independent Phenotype Potentially by Altering Apurinic/Apyrimidinic Site Repair"

    Article Title: Deletion of Individual Ku Subunits in Mice Causes an NHEJ-Independent Phenotype Potentially by Altering Apurinic/Apyrimidinic Site Repair

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0086358

    Molecular beacon assay to measure APE1 activity. No Ku70 was compared to Ku70 added to substrate with or without APE1. Fluorescence: the excitation wavelength is 485 nm and the emission wavelength is 538 nm. Shown is the average of three experiments with error bars (standard deviation). (A) Ku70 1–609 (full-length Ku70) (B) Ku70 115–609 . (C) Ku70 1–115 . (D) Ku70 1–300 .
    Figure Legend Snippet: Molecular beacon assay to measure APE1 activity. No Ku70 was compared to Ku70 added to substrate with or without APE1. Fluorescence: the excitation wavelength is 485 nm and the emission wavelength is 538 nm. Shown is the average of three experiments with error bars (standard deviation). (A) Ku70 1–609 (full-length Ku70) (B) Ku70 115–609 . (C) Ku70 1–115 . (D) Ku70 1–300 .

    Techniques Used: Activity Assay, Fluorescence, Standard Deviation

    CRT0044876 (CRT) survival fraction (SF). All cells are deleted for p53 (even controls) to avoid early replicative senescence. Shown is the average of three experiments. (A) Cells deleted for Ku80 are hypersensitive to CRT. Expression of APE1 or mouse Ku80 rescued CRT hypersensitivity for Ku80-mutant cells. (B) Cells deleted for either Ku70 or Ku80 but not both were hypersensitive to CRT demonstrating independent function for the individual Ku subunits as opposed to the Ku heterodimer. (C) Cells deleted for Ku70 or Ku80 or both were hypersensitive to γ-radiation demonstrating the Ku heterodimer repaired damage as opposed to independent function for the individual proteins.
    Figure Legend Snippet: CRT0044876 (CRT) survival fraction (SF). All cells are deleted for p53 (even controls) to avoid early replicative senescence. Shown is the average of three experiments. (A) Cells deleted for Ku80 are hypersensitive to CRT. Expression of APE1 or mouse Ku80 rescued CRT hypersensitivity for Ku80-mutant cells. (B) Cells deleted for either Ku70 or Ku80 but not both were hypersensitive to CRT demonstrating independent function for the individual Ku subunits as opposed to the Ku heterodimer. (C) Cells deleted for Ku70 or Ku80 or both were hypersensitive to γ-radiation demonstrating the Ku heterodimer repaired damage as opposed to independent function for the individual proteins.

    Techniques Used: Expressing, Mutagenesis

    16) Product Images from "4-Pregnen-21-ol-3,20-dione-21-(4-bromobenzenesufonate) (NSC 88915) and Related Novel Steroid Derivatives as Tyrosyl-DNA Phosphodiesterase (Tdp1) Inhibitors"

    Article Title: 4-Pregnen-21-ol-3,20-dione-21-(4-bromobenzenesufonate) (NSC 88915) and Related Novel Steroid Derivatives as Tyrosyl-DNA Phosphodiesterase (Tdp1) Inhibitors

    Journal: Journal of medicinal chemistry

    doi: 10.1021/jm901061s

    Counter screening of 1 against apurinic/apyrimidinic endonuclease enzyme (APE1) and topoisomerase I (Top1). A) Schematic representation of the APE1 gel-based biochemical assay. APE1 hydrolyzes the DNA phosphodiester backbone 5′ of the abasic site
    Figure Legend Snippet: Counter screening of 1 against apurinic/apyrimidinic endonuclease enzyme (APE1) and topoisomerase I (Top1). A) Schematic representation of the APE1 gel-based biochemical assay. APE1 hydrolyzes the DNA phosphodiester backbone 5′ of the abasic site

    Techniques Used:

    17) Product Images from "4-Pregnen-21-ol-3,20-dione-21-(4-bromobenzenesufonate) (NSC 88915) and Related Novel Steroid Derivatives as Tyrosyl-DNA Phosphodiesterase (Tdp1) Inhibitors"

    Article Title: 4-Pregnen-21-ol-3,20-dione-21-(4-bromobenzenesufonate) (NSC 88915) and Related Novel Steroid Derivatives as Tyrosyl-DNA Phosphodiesterase (Tdp1) Inhibitors

    Journal: Journal of medicinal chemistry

    doi: 10.1021/jm901061s

    Counter screening of 1 against apurinic/apyrimidinic endonuclease enzyme (APE1) and topoisomerase I (Top1). A) Schematic representation of the APE1 gel-based biochemical assay. APE1 hydrolyzes the DNA phosphodiester backbone 5′ of the abasic site
    Figure Legend Snippet: Counter screening of 1 against apurinic/apyrimidinic endonuclease enzyme (APE1) and topoisomerase I (Top1). A) Schematic representation of the APE1 gel-based biochemical assay. APE1 hydrolyzes the DNA phosphodiester backbone 5′ of the abasic site

    Techniques Used:

    18) Product Images from "CUX1 stimulates APE1 enzymatic activity and increases the resistance of glioblastoma cells to the mono-alkylating agent temozolomide"

    Article Title: CUX1 stimulates APE1 enzymatic activity and increases the resistance of glioblastoma cells to the mono-alkylating agent temozolomide

    Journal: Neuro-Oncology

    doi: 10.1093/neuonc/nox178

    CUT domains stimulate APE1 endonuclease activity in vitro. (A) Schematic of CUX1 recombinant proteins used in APE1 endonuclease assays. (B, C) APE1 endonuclease assays were carried out using purified APE1, in the presence of purified CUX1 recombinant proteins or controls (BSA or homeobox B3) at 50 nM or as indicated, and a radiolabeled probe containing an abasic site produced in 2 different ways: as a tetrahydrofuran (B) or through removal of a uracil residue by UDG (C). (D) Schematic of the APE1 assay that utilizes a molecular beacon probe containing a tetrahydrofuran site. The APE1 assay was carried out with purified APE1 in the presence of nothing, 50 nM BSA, or purified CUX1 recombinant proteins (C2C3HD, C1C2, and C3HD), as indicated.
    Figure Legend Snippet: CUT domains stimulate APE1 endonuclease activity in vitro. (A) Schematic of CUX1 recombinant proteins used in APE1 endonuclease assays. (B, C) APE1 endonuclease assays were carried out using purified APE1, in the presence of purified CUX1 recombinant proteins or controls (BSA or homeobox B3) at 50 nM or as indicated, and a radiolabeled probe containing an abasic site produced in 2 different ways: as a tetrahydrofuran (B) or through removal of a uracil residue by UDG (C). (D) Schematic of the APE1 assay that utilizes a molecular beacon probe containing a tetrahydrofuran site. The APE1 assay was carried out with purified APE1 in the presence of nothing, 50 nM BSA, or purified CUX1 recombinant proteins (C2C3HD, C1C2, and C3HD), as indicated.

    Techniques Used: Activity Assay, In Vitro, Recombinant, Purification, Produced

    19) Product Images from "Controllable Autocatalytic Cleavage-Mediated Fluorescence Recovery for Homogeneous Sensing of Alkyladenine DNA Glycosylase from Human Cancer Cells"

    Article Title: Controllable Autocatalytic Cleavage-Mediated Fluorescence Recovery for Homogeneous Sensing of Alkyladenine DNA Glycosylase from Human Cancer Cells

    Journal: Theranostics

    doi: 10.7150/thno.35393

    Dependence of initial velocity ( V ) on different concentrations of hairpin substrate. The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment. The time for hAAG-induced 2′-deoxyinosine excision reaction was 5 min. Error bars show the standard deviation of three experiments.
    Figure Legend Snippet: Dependence of initial velocity ( V ) on different concentrations of hairpin substrate. The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment. The time for hAAG-induced 2′-deoxyinosine excision reaction was 5 min. Error bars show the standard deviation of three experiments.

    Techniques Used: Standard Deviation

    (A) Nondenaturing PAGE analysis of the products of hAAG-catalyzed cleavage reaction under different reaction conditions. Lane M, the DNA ladder marker; lane 1, the synthesized cleavage product; lane 2, the synthesized trigger 1; lane 3, the synthesized HP1; lane 4, in the presence of APE1 + HP1; lane 5, in the presence of hAAG + APE1 + HP1. (B) Nondenaturing PAGE analysis of the products of T7 exo-assisted autocatalytic recycling cleavage reaction. Lane M, the DNA ladder marker; lane 1, in the absence of hAAG; lane 2, the synthesized trigger 2; lane 3, in the presence of hAAG. SYBR Gold is used as the fluorescent indicator. The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment.
    Figure Legend Snippet: (A) Nondenaturing PAGE analysis of the products of hAAG-catalyzed cleavage reaction under different reaction conditions. Lane M, the DNA ladder marker; lane 1, the synthesized cleavage product; lane 2, the synthesized trigger 1; lane 3, the synthesized HP1; lane 4, in the presence of APE1 + HP1; lane 5, in the presence of hAAG + APE1 + HP1. (B) Nondenaturing PAGE analysis of the products of T7 exo-assisted autocatalytic recycling cleavage reaction. Lane M, the DNA ladder marker; lane 1, in the absence of hAAG; lane 2, the synthesized trigger 2; lane 3, in the presence of hAAG. SYBR Gold is used as the fluorescent indicator. The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Marker, Synthesized

    Schematic illustration of the controllable autocatalytic cleavage-induced fluorescence recovery for hAAG assay. This strategy involves two consecutive steps: (1) the specific cleavage of HP1 at 2′-deoxyinosine site by hAAG and APE1, and (2) T7 exo-assisted autocatalytic recycling signal amplification.
    Figure Legend Snippet: Schematic illustration of the controllable autocatalytic cleavage-induced fluorescence recovery for hAAG assay. This strategy involves two consecutive steps: (1) the specific cleavage of HP1 at 2′-deoxyinosine site by hAAG and APE1, and (2) T7 exo-assisted autocatalytic recycling signal amplification.

    Techniques Used: Fluorescence, Amplification

    Dependence of the relative activity of hAAG on different concentrations of CdCl 2 . The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment. The error bars represent the standard deviations of the three experiments.
    Figure Legend Snippet: Dependence of the relative activity of hAAG on different concentrations of CdCl 2 . The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment. The error bars represent the standard deviations of the three experiments.

    Techniques Used: Activity Assay

    Mechanism of hAAG-catalyzed base-excision repair. The hAAG can remove the damaged 2′-deoxyinosine (red color) to produce an AP site. The AP site will subsequently be cleaved by APE1 to generate the 5′-dRP and 3′-OH termini.
    Figure Legend Snippet: Mechanism of hAAG-catalyzed base-excision repair. The hAAG can remove the damaged 2′-deoxyinosine (red color) to produce an AP site. The AP site will subsequently be cleaved by APE1 to generate the 5′-dRP and 3′-OH termini.

    Techniques Used:

    20) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    21) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    22) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    23) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    24) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    25) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    26) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    27) Product Images from "Controllable Autocatalytic Cleavage-Mediated Fluorescence Recovery for Homogeneous Sensing of Alkyladenine DNA Glycosylase from Human Cancer Cells"

    Article Title: Controllable Autocatalytic Cleavage-Mediated Fluorescence Recovery for Homogeneous Sensing of Alkyladenine DNA Glycosylase from Human Cancer Cells

    Journal: Theranostics

    doi: 10.7150/thno.35393

    Dependence of initial velocity ( V ) on different concentrations of hairpin substrate. The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment. The time for hAAG-induced 2′-deoxyinosine excision reaction was 5 min. Error bars show the standard deviation of three experiments.
    Figure Legend Snippet: Dependence of initial velocity ( V ) on different concentrations of hairpin substrate. The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment. The time for hAAG-induced 2′-deoxyinosine excision reaction was 5 min. Error bars show the standard deviation of three experiments.

    Techniques Used: Standard Deviation

    (A) Nondenaturing PAGE analysis of the products of hAAG-catalyzed cleavage reaction under different reaction conditions. Lane M, the DNA ladder marker; lane 1, the synthesized cleavage product; lane 2, the synthesized trigger 1; lane 3, the synthesized HP1; lane 4, in the presence of APE1 + HP1; lane 5, in the presence of hAAG + APE1 + HP1. (B) Nondenaturing PAGE analysis of the products of T7 exo-assisted autocatalytic recycling cleavage reaction. Lane M, the DNA ladder marker; lane 1, in the absence of hAAG; lane 2, the synthesized trigger 2; lane 3, in the presence of hAAG. SYBR Gold is used as the fluorescent indicator. The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment.
    Figure Legend Snippet: (A) Nondenaturing PAGE analysis of the products of hAAG-catalyzed cleavage reaction under different reaction conditions. Lane M, the DNA ladder marker; lane 1, the synthesized cleavage product; lane 2, the synthesized trigger 1; lane 3, the synthesized HP1; lane 4, in the presence of APE1 + HP1; lane 5, in the presence of hAAG + APE1 + HP1. (B) Nondenaturing PAGE analysis of the products of T7 exo-assisted autocatalytic recycling cleavage reaction. Lane M, the DNA ladder marker; lane 1, in the absence of hAAG; lane 2, the synthesized trigger 2; lane 3, in the presence of hAAG. SYBR Gold is used as the fluorescent indicator. The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Marker, Synthesized

    Schematic illustration of the controllable autocatalytic cleavage-induced fluorescence recovery for hAAG assay. This strategy involves two consecutive steps: (1) the specific cleavage of HP1 at 2′-deoxyinosine site by hAAG and APE1, and (2) T7 exo-assisted autocatalytic recycling signal amplification.
    Figure Legend Snippet: Schematic illustration of the controllable autocatalytic cleavage-induced fluorescence recovery for hAAG assay. This strategy involves two consecutive steps: (1) the specific cleavage of HP1 at 2′-deoxyinosine site by hAAG and APE1, and (2) T7 exo-assisted autocatalytic recycling signal amplification.

    Techniques Used: Fluorescence, Amplification

    Dependence of the relative activity of hAAG on different concentrations of CdCl 2 . The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment. The error bars represent the standard deviations of the three experiments.
    Figure Legend Snippet: Dependence of the relative activity of hAAG on different concentrations of CdCl 2 . The 0.1 U/µL hAAG and 0.3 U/µL APE1 were used in this experiment. The error bars represent the standard deviations of the three experiments.

    Techniques Used: Activity Assay

    Mechanism of hAAG-catalyzed base-excision repair. The hAAG can remove the damaged 2′-deoxyinosine (red color) to produce an AP site. The AP site will subsequently be cleaved by APE1 to generate the 5′-dRP and 3′-OH termini.
    Figure Legend Snippet: Mechanism of hAAG-catalyzed base-excision repair. The hAAG can remove the damaged 2′-deoxyinosine (red color) to produce an AP site. The AP site will subsequently be cleaved by APE1 to generate the 5′-dRP and 3′-OH termini.

    Techniques Used:

    28) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    29) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    30) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    31) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    32) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    33) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    34) Product Images from "Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *"

    Article Title: Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.629907

    MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times
    Figure Legend Snippet: MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times

    Techniques Used: Incubation, Recombinant, Purification

    35) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    36) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    37) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    38) Product Images from "CUX1 stimulates APE1 enzymatic activity and increases the resistance of glioblastoma cells to the mono-alkylating agent temozolomide"

    Article Title: CUX1 stimulates APE1 enzymatic activity and increases the resistance of glioblastoma cells to the mono-alkylating agent temozolomide

    Journal: Neuro-Oncology

    doi: 10.1093/neuonc/nox178

    CUT domains stimulate APE1 endonuclease activity in vitro. (A) Schematic of CUX1 recombinant proteins used in APE1 endonuclease assays. (B, C) APE1 endonuclease assays were carried out using purified APE1, in the presence of purified CUX1 recombinant proteins or controls (BSA or homeobox B3) at 50 nM or as indicated, and a radiolabeled probe containing an abasic site produced in 2 different ways: as a tetrahydrofuran (B) or through removal of a uracil residue by UDG (C). (D) Schematic of the APE1 assay that utilizes a molecular beacon probe containing a tetrahydrofuran site. The APE1 assay was carried out with purified APE1 in the presence of nothing, 50 nM BSA, or purified CUX1 recombinant proteins (C2C3HD, C1C2, and C3HD), as indicated.
    Figure Legend Snippet: CUT domains stimulate APE1 endonuclease activity in vitro. (A) Schematic of CUX1 recombinant proteins used in APE1 endonuclease assays. (B, C) APE1 endonuclease assays were carried out using purified APE1, in the presence of purified CUX1 recombinant proteins or controls (BSA or homeobox B3) at 50 nM or as indicated, and a radiolabeled probe containing an abasic site produced in 2 different ways: as a tetrahydrofuran (B) or through removal of a uracil residue by UDG (C). (D) Schematic of the APE1 assay that utilizes a molecular beacon probe containing a tetrahydrofuran site. The APE1 assay was carried out with purified APE1 in the presence of nothing, 50 nM BSA, or purified CUX1 recombinant proteins (C2C3HD, C1C2, and C3HD), as indicated.

    Techniques Used: Activity Assay, In Vitro, Recombinant, Purification, Produced

    39) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    40) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    41) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    42) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    43) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    44) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    45) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    46) Product Images from "Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage"

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage

    Journal: Free radical biology & medicine

    doi: 10.1016/j.freeradbiomed.2013.05.010

    Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p
    Figure Legend Snippet: Decreased AP lyase activity and differential stimulation of polymorphic OGG1s by APE1 (A) OGG1 recombinant proteins (64nM) were incubated at 37°C for 15 minutes in the presence (+) or absence (−) of 45pM APE1, along with a 5′-end-labeled oligonucleotide duplex containing an 8-oxoG lesion. The cleavage products were analyzed on a 15% polyacrylamide gel containing 7M Urea and imaged on a phosphorimager. A representative experiment is shown. (B) The histogram represents the mean ± S.E.M. from five independent experiments. The incision value was calculated by taking the amount of cleaved substrate (lower band) normalized to the amount of cleaved + uncleaved substrate (lower + upper bands) . *p

    Techniques Used: Activity Assay, Recombinant, Incubation, Labeling

    47) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    48) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    49) Product Images from "Germline ablation of SMUG1 DNA glycosylase causes loss of 5-hydroxymethyluracil- and UNG-backup uracil-excision activities and increases cancer predisposition of Ung−/−Msh2−/− mice"

    Article Title: Germline ablation of SMUG1 DNA glycosylase causes loss of 5-hydroxymethyluracil- and UNG-backup uracil-excision activities and increases cancer predisposition of Ung−/−Msh2−/− mice

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks259

    Smug1 inactivation ablates hmU excision activity and gives resistance to hmUdR. ( A ) Analysis of base excision activity in brain and liver nuclear extracts from wild-type (WT), Ung −/− and Smug1 −/− mice assayed on a 3′-fluorescently labelled double-stranded oligodeoxyribonucleotide substrate containing a centrally placed hmU:G mispair (left), as well as on a single-stranded 3′-fluorescently labelled substrate containing a single centrally placed U as an UNG activity control. Excision creates an abasic site that is subject to cleavage by APE1; cleavage products of the 3′-fluorescently labelled oligonucleotides were visualized after polyacrylamide gel electrophoresis. Similar results regarding a loss of hmU-excision activity were obtained on assaying multiple different tissues from Smug1 −/− mice of different ages. ( B ) Effects of a 48-h culture in the presence of various concentrations of hmUdR on the viability of embryo fibroblast cell-lines derived from mice of different genotypes. Survival is expressed relative to that obtained in the absence of hmUdR. The results are shown for triplicate assays performed on two independently derived cell-lines for each indicated genotype.
    Figure Legend Snippet: Smug1 inactivation ablates hmU excision activity and gives resistance to hmUdR. ( A ) Analysis of base excision activity in brain and liver nuclear extracts from wild-type (WT), Ung −/− and Smug1 −/− mice assayed on a 3′-fluorescently labelled double-stranded oligodeoxyribonucleotide substrate containing a centrally placed hmU:G mispair (left), as well as on a single-stranded 3′-fluorescently labelled substrate containing a single centrally placed U as an UNG activity control. Excision creates an abasic site that is subject to cleavage by APE1; cleavage products of the 3′-fluorescently labelled oligonucleotides were visualized after polyacrylamide gel electrophoresis. Similar results regarding a loss of hmU-excision activity were obtained on assaying multiple different tissues from Smug1 −/− mice of different ages. ( B ) Effects of a 48-h culture in the presence of various concentrations of hmUdR on the viability of embryo fibroblast cell-lines derived from mice of different genotypes. Survival is expressed relative to that obtained in the absence of hmUdR. The results are shown for triplicate assays performed on two independently derived cell-lines for each indicated genotype.

    Techniques Used: Activity Assay, Mouse Assay, Polyacrylamide Gel Electrophoresis, Derivative Assay

    50) Product Images from "Acetylation of the histone H3 tail domain regulates base excision repair on higher-order chromatin structures"

    Article Title: Acetylation of the histone H3 tail domain regulates base excision repair on higher-order chromatin structures

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-52340-0

    Acetylation of histone H3 differentially regulates UDG/APE1-mediated removal of dU49 on compact chromatin. The indicated substrates (10 nM; Fig. 1 ) were incubated with UDG and APE1 (1 nM each) in the presence of 2.0 mM Mg 2+ for 60 minutes. Error bars represent standard deviation from at least three independent experiments (*P
    Figure Legend Snippet: Acetylation of histone H3 differentially regulates UDG/APE1-mediated removal of dU49 on compact chromatin. The indicated substrates (10 nM; Fig. 1 ) were incubated with UDG and APE1 (1 nM each) in the presence of 2.0 mM Mg 2+ for 60 minutes. Error bars represent standard deviation from at least three independent experiments (*P

    Techniques Used: Incubation, Standard Deviation

    BER of damaged DNA within various chromatin environments. The indicated substrates (10 nM; Fig. 1 ) were incubated with UDG and APE1 (1 nM each) in the presence of either 0.2 mM Mg 2+ ( a,b ) or 2.0 mM Mg 2+ ( c,d ). Error bars represent standard deviation from at least three independent experiments. See Table 1 for relevant statistics.
    Figure Legend Snippet: BER of damaged DNA within various chromatin environments. The indicated substrates (10 nM; Fig. 1 ) were incubated with UDG and APE1 (1 nM each) in the presence of either 0.2 mM Mg 2+ ( a,b ) or 2.0 mM Mg 2+ ( c,d ). Error bars represent standard deviation from at least three independent experiments. See Table 1 for relevant statistics.

    Techniques Used: Incubation, Standard Deviation

    51) Product Images from "CUX1 stimulates APE1 enzymatic activity and increases the resistance of glioblastoma cells to the mono-alkylating agent temozolomide"

    Article Title: CUX1 stimulates APE1 enzymatic activity and increases the resistance of glioblastoma cells to the mono-alkylating agent temozolomide

    Journal: Neuro-Oncology

    doi: 10.1093/neuonc/nox178

    CUT domains stimulate APE1 endonuclease activity in vitro. (A) Schematic of CUX1 recombinant proteins used in APE1 endonuclease assays. (B, C) APE1 endonuclease assays were carried out using purified APE1, in the presence of purified CUX1 recombinant proteins or controls (BSA or homeobox B3) at 50 nM or as indicated, and a radiolabeled probe containing an abasic site produced in 2 different ways: as a tetrahydrofuran (B) or through removal of a uracil residue by UDG (C). (D) Schematic of the APE1 assay that utilizes a molecular beacon probe containing a tetrahydrofuran site. The APE1 assay was carried out with purified APE1 in the presence of nothing, 50 nM BSA, or purified CUX1 recombinant proteins (C2C3HD, C1C2, and C3HD), as indicated.
    Figure Legend Snippet: CUT domains stimulate APE1 endonuclease activity in vitro. (A) Schematic of CUX1 recombinant proteins used in APE1 endonuclease assays. (B, C) APE1 endonuclease assays were carried out using purified APE1, in the presence of purified CUX1 recombinant proteins or controls (BSA or homeobox B3) at 50 nM or as indicated, and a radiolabeled probe containing an abasic site produced in 2 different ways: as a tetrahydrofuran (B) or through removal of a uracil residue by UDG (C). (D) Schematic of the APE1 assay that utilizes a molecular beacon probe containing a tetrahydrofuran site. The APE1 assay was carried out with purified APE1 in the presence of nothing, 50 nM BSA, or purified CUX1 recombinant proteins (C2C3HD, C1C2, and C3HD), as indicated.

    Techniques Used: Activity Assay, In Vitro, Recombinant, Purification, Produced

    52) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    53) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    54) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    55) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    56) Product Images from "CUX1 stimulates APE1 enzymatic activity and increases the resistance of glioblastoma cells to the mono-alkylating agent temozolomide"

    Article Title: CUX1 stimulates APE1 enzymatic activity and increases the resistance of glioblastoma cells to the mono-alkylating agent temozolomide

    Journal: Neuro-Oncology

    doi: 10.1093/neuonc/nox178

    CUT domains stimulate APE1 endonuclease activity in vitro. (A) Schematic of CUX1 recombinant proteins used in APE1 endonuclease assays. (B, C) APE1 endonuclease assays were carried out using purified APE1, in the presence of purified CUX1 recombinant proteins or controls (BSA or homeobox B3) at 50 nM or as indicated, and a radiolabeled probe containing an abasic site produced in 2 different ways: as a tetrahydrofuran (B) or through removal of a uracil residue by UDG (C). (D) Schematic of the APE1 assay that utilizes a molecular beacon probe containing a tetrahydrofuran site. The APE1 assay was carried out with purified APE1 in the presence of nothing, 50 nM BSA, or purified CUX1 recombinant proteins (C2C3HD, C1C2, and C3HD), as indicated.
    Figure Legend Snippet: CUT domains stimulate APE1 endonuclease activity in vitro. (A) Schematic of CUX1 recombinant proteins used in APE1 endonuclease assays. (B, C) APE1 endonuclease assays were carried out using purified APE1, in the presence of purified CUX1 recombinant proteins or controls (BSA or homeobox B3) at 50 nM or as indicated, and a radiolabeled probe containing an abasic site produced in 2 different ways: as a tetrahydrofuran (B) or through removal of a uracil residue by UDG (C). (D) Schematic of the APE1 assay that utilizes a molecular beacon probe containing a tetrahydrofuran site. The APE1 assay was carried out with purified APE1 in the presence of nothing, 50 nM BSA, or purified CUX1 recombinant proteins (C2C3HD, C1C2, and C3HD), as indicated.

    Techniques Used: Activity Assay, In Vitro, Recombinant, Purification, Produced

    57) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    58) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    59) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    60) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    61) Product Images from "Proficient repair in chromatin remodeling defective ino80 mutants of Saccharomyces cerevisiae highlights replication defects as the main contributor to DNA damage sensitivity"

    Article Title: Proficient repair in chromatin remodeling defective ino80 mutants of Saccharomyces cerevisiae highlights replication defects as the main contributor to DNA damage sensitivity

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2010.06.010

    Induction and repair of MMS-induced methylated bases in genomic DNA of ino80 Δ cells. Exponentially growing wt and ino80 Δ cells were treated with 0.035% MMS for 3 h, after which MMS was washed out and the cells were allowed to repair in rich medium for the next 6 h. The cells were harvested at the indicated times after initiation of MMS treatment and genomic DNA was purified. Methylated DNA damage was converted to single and double DNA strand breakes upon the treatment with glycosylase Aag and endonuclease Ape1. Treated DNA was resolved in alkaline agarose gel and stained with SYBRgold. The approximate positions of the ensemble average size of DNA in each lane are denoted with asterisks (*) and connected by a dotted line . Representative gel scans demonstrate time course of induction and repair of MMS-induced methylated bases in genomic DNA from wt -BY4733 and ino80 Δ cells (a) and wt-By4741 and mag1Δ cells (b). Incubation times (in hours, after start of MMS treatment) are indicated above the lanes. Other labels are: C, DNA from untreated cells; λ DNA markers (Fermentas, Inc.). (c) Induction and repair of MMS-induced methylated bases in DNA as a function of repair time.
    Figure Legend Snippet: Induction and repair of MMS-induced methylated bases in genomic DNA of ino80 Δ cells. Exponentially growing wt and ino80 Δ cells were treated with 0.035% MMS for 3 h, after which MMS was washed out and the cells were allowed to repair in rich medium for the next 6 h. The cells were harvested at the indicated times after initiation of MMS treatment and genomic DNA was purified. Methylated DNA damage was converted to single and double DNA strand breakes upon the treatment with glycosylase Aag and endonuclease Ape1. Treated DNA was resolved in alkaline agarose gel and stained with SYBRgold. The approximate positions of the ensemble average size of DNA in each lane are denoted with asterisks (*) and connected by a dotted line . Representative gel scans demonstrate time course of induction and repair of MMS-induced methylated bases in genomic DNA from wt -BY4733 and ino80 Δ cells (a) and wt-By4741 and mag1Δ cells (b). Incubation times (in hours, after start of MMS treatment) are indicated above the lanes. Other labels are: C, DNA from untreated cells; λ DNA markers (Fermentas, Inc.). (c) Induction and repair of MMS-induced methylated bases in DNA as a function of repair time.

    Techniques Used: Methylation, Purification, Agarose Gel Electrophoresis, Staining, Incubation

    62) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    63) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    64) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    65) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    66) Product Images from "Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines"

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6606058

    ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.
    Figure Legend Snippet: ( A ) AP endonuclease activity assays using 18-mer radiolabelled oligonucleotide substrates (see Materials and methods) were performed using HeLa whole-cell extracts (WCE). Compound 4 showed 93% inhibition of AP cleavage activity using WCE. ( B ) Compound 3, on the other hand did not inhibit WCE cleavage activity. ( C ) Testing AP site cleavage activity in wild-type and D148 polymorph. The figure shows that the activity was similar in both wild-type and the D148E polymorph. ( D ) Inhibitory activity of compound 4 against the D148E polymorphic variant of APE1 is shown here. D148E was more sensitive to inhibition by compound 4 compared with wild type.

    Techniques Used: Activity Assay, Inhibition, Variant Assay

    Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.
    Figure Legend Snippet: Kinetics analysis. To evaluate potential mechanism of action of APE1 inhibitor, kinetic analysis was performed. Lineweaver–Burk plots and kinetic parameters determined from eight independent data points (note: error bars are in some cases too small to see) for compound 4 is shown here. The APE1 inhibitor was tested at three dose levels (5, 10 and 20 μ ) and oligonucleotide substrate was evaluated at three different concentrations (100, 200 and 500 n). The reaction was performed as described in methods. K M and k cat decreased at each inhibitor concentration (compared with no inhibitor) and the k cat /K M decreased at increasing inhibitor concentration. The data is consistent with uncompetitive inhibition.

    Techniques Used: Concentration Assay, Inhibition

    ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).
    Figure Legend Snippet: ( A ) Consensus score plot was constructed by plotting Gold Score ( x -axis) and Chem Score ( y -axis) for the 1679 virtual APE1 inhibitor candidates. The top ranking 25% of the compounds were shortlisted from the consensus plot and subjected to detailed biochemical analyses. ( B ) Primary screening. Fluorescence-based APE1 cleavage assay is shown here. If the DNA is cleaved at the abasic site at position 7 from the 5′ end by APE1, the 6-mer fluorescein-containing product will dissociate from its complement by thermal melting. As a result, the quenching effect of the 3′ dabcyl (which absorbs fluorescein fluorescence when in close proximity) is lost, and APE1 activity is measured indirectly as an increase in fluorescence signal. For detailed protocol see Materials and methods section. ( C ) APE1 inhibition by CRT0044876 is shown here. Control=no APE1 in reaction. ( D ) APE1 inhibition by compound 4 is shown here (IC 50 =11 μ ).

    Techniques Used: Construct, Fluorescence, Cleavage Assay, Activity Assay, Inhibition

    ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.
    Figure Legend Snippet: ( A ) APE1 expression in melanoma cell lines is shown here. ( B ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in SK-Mel30 cell line is shown here. ( C ) Potentiation of temozolomide by compound 4(10 μ ) in SK-Mel30 cell line is shown here. ( D ) Toxicity of compound 4 in HUVEC, SK-Mel30 and U89MG is shown here. Compound 4 was relatively nontoxic to HUVEC cells.

    Techniques Used: Expressing

    Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.
    Figure Legend Snippet: Secondary biochemical screening. ( A ) Fluorescence-based endonuclease IV cleavage assay is shown here. Compound 4 was tested at 100 μ and showed no inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( B ). Compound 7 was tested at 100 μ and showed complete inhibition of endonuclease IV. Control=no endonuclease IV in reaction ( C ) Fluorescence queching assay did not reveal any quenching effect by compound 4. Control=no inhibitor in reaction ( D ). Radiolabelled assay showing inhibition of AP-site cleavage by APE1. Absence of 8-mer lower band indicates APE1 inhibition. See Material and methods for protcol details.

    Techniques Used: Fluorescence, Cleavage Assay, Inhibition

    Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.
    Figure Legend Snippet: Molecular Modelling. ( A ) The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309, see text for details). Visual Molecular Dynamics1.8.7 was used to visualise the crystal structure of APE1. The molecular surface in the region of the V-shaped active site cleft is shown here. ( B ) Sybyl8.0 was used to build inhibitor templates. Chemical structures and docked poses of the four prototypical ligands onto APE1 active site are shown here.

    Techniques Used: Activity Assay

    ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.
    Figure Legend Snippet: ( A ) APE1 expression in glioma cell lines is shown here. ( B ) (1 and 2). Aldehyde reactive probe assay. U89MG cells were pretreated with 10 μ of compound 4 alone or MMS (600 μ ) or a combination of compound 4 and MMS. Genomic DNA extracted at 90 min for AP-site quatification. The combination treatment led to increased AP site content in the genomic DNA. ( C ) Inhibitor alone at 10 μ was relatively nontoxic to cells (as shown in Figure 7D ). We took the survival fraction as 100%. The percentage survival for those cells exposed to both inhibitor and temozolomide was plotted as a relative survival to cells exposed to the inhibitor alone. Potentiation of cytotoxicity of MMS by compound 4 (10 μ ) in U89 MG cell line is shown here. ( D ) Potentiation of temozolomide by compound 4 (10 μ ) in U89MG cell line is shown here.

    Techniques Used: Expressing

    67) Product Images from "Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion"

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2011.06.003

    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Figure Legend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Techniques Used: Concentration Assay

    68) Product Images from "Proficient repair in chromatin remodeling defective ino80 mutants of Saccharomyces cerevisiae highlights replication defects as the main contributor to DNA damage sensitivity"

    Article Title: Proficient repair in chromatin remodeling defective ino80 mutants of Saccharomyces cerevisiae highlights replication defects as the main contributor to DNA damage sensitivity

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2010.06.010

    Induction and repair of MMS-induced methylated bases in genomic DNA of ino80 Δ cells. Exponentially growing wt and ino80 Δ cells were treated with 0.035% MMS for 3 h, after which MMS was washed out and the cells were allowed to repair in rich medium for the next 6 h. The cells were harvested at the indicated times after initiation of MMS treatment and genomic DNA was purified. Methylated DNA damage was converted to single and double DNA strand breakes upon the treatment with glycosylase Aag and endonuclease Ape1. Treated DNA was resolved in alkaline agarose gel and stained with SYBRgold. The approximate positions of the ensemble average size of DNA in each lane are denoted with asterisks (*) and connected by a dotted line . Representative gel scans demonstrate time course of induction and repair of MMS-induced methylated bases in genomic DNA from wt -BY4733 and ino80 Δ cells (a) and wt-By4741 and mag1Δ cells (b). Incubation times (in hours, after start of MMS treatment) are indicated above the lanes. Other labels are: C, DNA from untreated cells; λ DNA markers (Fermentas, Inc.). (c) Induction and repair of MMS-induced methylated bases in DNA as a function of repair time.
    Figure Legend Snippet: Induction and repair of MMS-induced methylated bases in genomic DNA of ino80 Δ cells. Exponentially growing wt and ino80 Δ cells were treated with 0.035% MMS for 3 h, after which MMS was washed out and the cells were allowed to repair in rich medium for the next 6 h. The cells were harvested at the indicated times after initiation of MMS treatment and genomic DNA was purified. Methylated DNA damage was converted to single and double DNA strand breakes upon the treatment with glycosylase Aag and endonuclease Ape1. Treated DNA was resolved in alkaline agarose gel and stained with SYBRgold. The approximate positions of the ensemble average size of DNA in each lane are denoted with asterisks (*) and connected by a dotted line . Representative gel scans demonstrate time course of induction and repair of MMS-induced methylated bases in genomic DNA from wt -BY4733 and ino80 Δ cells (a) and wt-By4741 and mag1Δ cells (b). Incubation times (in hours, after start of MMS treatment) are indicated above the lanes. Other labels are: C, DNA from untreated cells; λ DNA markers (Fermentas, Inc.). (c) Induction and repair of MMS-induced methylated bases in DNA as a function of repair time.

    Techniques Used: Methylation, Purification, Agarose Gel Electrophoresis, Staining, Incubation

    69) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    70) Product Images from "The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *"

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.441444

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI
    Figure Legend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Techniques Used: Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1
    Figure Legend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Techniques Used: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated
    Figure Legend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Techniques Used: Activity Assay, Incubation

    UDG and APE1 Digestion
    Figure Legend Snippet: UDG and APE1 Digestion

    Techniques Used:

    71) Product Images from "Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *"

    Article Title: Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.629907

    MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times
    Figure Legend Snippet: MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times

    Techniques Used: Incubation, Recombinant, Purification

    72) Product Images from "Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *"

    Article Title: Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.629907

    MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times
    Figure Legend Snippet: MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times

    Techniques Used: Incubation, Recombinant, Purification

    73) Product Images from "Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *"

    Article Title: Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.629907

    MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times
    Figure Legend Snippet: MYH is active in HCT116 extracts and addresses G O /A but not A O /G or A O /C mispairs. A , nicking assay. The closed-circular homoduplex or the G O /A, A O /G, or A O /C substrates were incubated with recombinant, purified MYH-GST and APE1 for the indicated times

    Techniques Used: Incubation, Recombinant, Purification

    Related Articles

    Amplification:

    Article Title: The histone H4 lysine 16 acetyltransferase hMOF regulates the outcome of autophagy
    Article Snippet: After that, the first-strand cDNA was circularized by CircLigase (Epicentre) and relinearized by Ape1 (NEB). .. Finally, sscDNA template was amplified by PCR using the Phusion High-Fidelity enzyme (NEB) according to the manufacturer’s instructions with two oligonucleotide primers oNTI200 (5′-CAAGCAGAAGACGGCATA) and oNTI201 (5′-AATGATACGGCGACCACCGACAGGT TCAGAGTTCTACAGTCCGACG).

    RNA Sequencing Assay:

    Article Title: The histone H4 lysine 16 acetyltransferase hMOF regulates the outcome of autophagy
    Article Snippet: After that, the first-strand cDNA was circularized by CircLigase (Epicentre) and relinearized by Ape1 (NEB). .. DNA was then sequenced on the Illumina HiSeq2000 according to the manufacturer’s instructions, using the small RNA sequencing primer 5′-CGACAGGTTCAGAGTTCTACAGTCCGACGATC.

    Binding Assay:

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion
    Article Snippet: .. Lastly, we demonstrated that the TNR repeats do not affect hOGG1 binding, catalytic activity, or product release rate for duplex substrates and only minimally effect the ability of APE1 to stimulate the turnover of hOGG1. ..

    Generated:

    Article Title: Site-specific Acetylation of Histone H3 Decreases Polymerase β Activity on Nucleosome Core Particles in Vitro *
    Article Snippet: .. Gap-containing DNAs were generated by pretreating 5′ end-labeled uracil-containing DNAs with UDG and APE1. .. The cleaved DNA substrates were reconstituted with recombinant octamers containing WT histones or octamers containing H3K14Ac or H3K56Ac.

    Purification:

    Article Title: Replication-dependent unhooking of DNA interstrand cross-links by the NEIL3 glycosylase
    Article Snippet: For all other applications, replication reactions were stopped in 10 volumes of 50 mM Tris (pH 7.5), 0.5% SDS, 25 mM EDTA, and replication intermediates were purified as previously described ( ). .. Where indicated, replication intermediates were digested with 0.08 U/μL HincII (NEB) and/or 0.08 U/μL APE1 (NEB).

    Article Title: Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *
    Article Snippet: .. We therefore asked whether incubation of the supercoiled GO /A substrate with purified, recombinant MYH-GST and APE1 gave rise to nicked circular molecules. .. As shown in A ( lanes 3–6 ), the GO /A substrate was efficiently converted to the open-circular form upon incubation of the plasmid with the recombinant proteins.

    Concentration Assay:

    Article Title: Replication-dependent unhooking of DNA interstrand cross-links by the NEIL3 glycosylase
    Article Snippet: Where indicated, NMS-873 p97 inhibitor (Sigma) was used at a concentration of 200 μM in NPE. .. Where indicated, replication intermediates were digested with 0.08 U/μL HincII (NEB) and/or 0.08 U/μL APE1 (NEB).

    Incubation:

    Article Title: Replication-dependent unhooking of DNA interstrand cross-links by the NEIL3 glycosylase
    Article Snippet: Samples were incubated for 1 hour at 37 °C prior to separation by 0.8% native agarose gel electrophoresis. .. Where indicated, replication intermediates were digested with 0.08 U/μL HincII (NEB) and/or 0.08 U/μL APE1 (NEB).

    Article Title: Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *
    Article Snippet: .. We therefore asked whether incubation of the supercoiled GO /A substrate with purified, recombinant MYH-GST and APE1 gave rise to nicked circular molecules. .. As shown in A ( lanes 3–6 ), the GO /A substrate was efficiently converted to the open-circular form upon incubation of the plasmid with the recombinant proteins.

    other:

    Article Title: Site-specific Acetylation of Histone H3 Decreases Polymerase β Activity on Nucleosome Core Particles in Vitro *
    Article Snippet: The DNA was then treated with UDG (30 n m ) and APE1 (10 n m ) for 90 min at 37 °C to ensure cleavage of all uracils.

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage
    Article Snippet: In contrast to A53T, the A288V polymorphism was sufficiently activated by APE1.

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *
    Article Snippet: Alternatively, this could also suggest UDG and APE1 digest a significant fraction of the substrate at a much slower rate.

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion
    Article Snippet: APE1 has been shown to improve the efficiency of repair by stimulating the product release rate of OGG1 [ , , , ].

    Activity Assay:

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion
    Article Snippet: .. Lastly, we demonstrated that the TNR repeats do not affect hOGG1 binding, catalytic activity, or product release rate for duplex substrates and only minimally effect the ability of APE1 to stimulate the turnover of hOGG1. ..

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines
    Article Snippet: .. Inhibitory activity of compounds against the D148E polymorphic variant of APE1 The D148E polymorphic variant of APE1 has been implicated in cancer predisposition including melanoma ( ; ; ). ..

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *
    Article Snippet: .. In this study, we investigated the effect of rotationally and translationally positioned DNA lesions in NCPs on BER by assessing removal of uracil by UDG and APE1 and the extension activity of pol β at single nucleotide gaps. ..

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage
    Article Snippet: .. Although APE1 stimulated the activity of the A53T protein, the level of incision was still significantly lower than WT stimulated by APE1 (p < 0.01). .. APE1 stimulated the A288V polymorphic protein above APE1 stimulation of WT but this increase was not statistically significant.

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines
    Article Snippet: .. The DNA repair domain active site was localised on the basis of the previously reported 10 critical amino acid residues that are essential for the AP endonuclease activity of APE1 (D70, D90, E96, Y171, D210, N212, D219, D283, D308 and H309) ( ; ; ; ; ; ). ..

    Article Title: Alzheimer’s Disease Associated Polymorphisms in Human OGG1 Alter Catalytic Activity and Sensitize Cells to DNA Damage
    Article Snippet: .. One well established step of BER occurs when APE1 binds directly to OGG1 and stimulates its activity [ – , ]. .. We found that APE1 significantly stimulated the incision ability of WT OGG1.

    Recombinant:

    Article Title: Influence of Oxidized Purine Processing on Strand Directionality of Mismatch Repair *
    Article Snippet: .. We therefore asked whether incubation of the supercoiled GO /A substrate with purified, recombinant MYH-GST and APE1 gave rise to nicked circular molecules. .. As shown in A ( lanes 3–6 ), the GO /A substrate was efficiently converted to the open-circular form upon incubation of the plasmid with the recombinant proteins.

    Gel Extraction:

    Article Title: The histone H4 lysine 16 acetyltransferase hMOF regulates the outcome of autophagy
    Article Snippet: The cDNA products were separated on a 10% polyacrylamide TBE-urea gel and the extended first-strand product (100–500 bp) was excised and recovered by gel extraction. .. After that, the first-strand cDNA was circularized by CircLigase (Epicentre) and relinearized by Ape1 (NEB).

    Polymerase Chain Reaction:

    Article Title: The histone H4 lysine 16 acetyltransferase hMOF regulates the outcome of autophagy
    Article Snippet: After that, the first-strand cDNA was circularized by CircLigase (Epicentre) and relinearized by Ape1 (NEB). .. Finally, sscDNA template was amplified by PCR using the Phusion High-Fidelity enzyme (NEB) according to the manufacturer’s instructions with two oligonucleotide primers oNTI200 (5′-CAAGCAGAAGACGGCATA) and oNTI201 (5′-AATGATACGGCGACCACCGACAGGT TCAGAGTTCTACAGTCCGACG).

    Agarose Gel Electrophoresis:

    Article Title: Replication-dependent unhooking of DNA interstrand cross-links by the NEIL3 glycosylase
    Article Snippet: Samples were incubated for 1 hour at 37 °C prior to separation by 0.8% native agarose gel electrophoresis. .. Where indicated, replication intermediates were digested with 0.08 U/μL HincII (NEB) and/or 0.08 U/μL APE1 (NEB).

    Variant Assay:

    Article Title: Development and evaluation of human AP endonuclease inhibitors in melanoma and glioma cell lines
    Article Snippet: .. Inhibitory activity of compounds against the D148E polymorphic variant of APE1 The D148E polymorphic variant of APE1 has been implicated in cancer predisposition including melanoma ( ; ; ). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs ape1
    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM <t>APE1</t> in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.
    Ape1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ape1/product/New England Biolabs
    Average 95 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    ape1 - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Journal: DNA repair

    Article Title: Incidence and persistence of 8-oxo-7,8-dihydroguanine within a hairpin intermediate exacerbates a toxic oxidation cycle associated with trinucleotide repeat expansion

    doi: 10.1016/j.dnarep.2011.06.003

    Figure Lengend Snippet: Data obtained under multiple-turnover conditions for determination of k 3 . Shown is a graph of concentration of product as a function of time for (A) Mixed-DUP, (B) Loop-DUP, (C) Stem-DUP, and (D) Stem-HP. Conditions were 50 nM DNA, 5 nM hOGG1 or 5 nM hOGG1/50 nM APE1 in 20 mM Tris-HCl, 70 mM NaCl, 2 mM MgCl 2 , 100 µg/mL BSA, pH 7.6.

    Article Snippet: APE1 has been shown to improve the efficiency of repair by stimulating the product release rate of OGG1 [ , , , ].

    Techniques: Concentration Assay

    Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Journal: The Journal of Biological Chemistry

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    doi: 10.1074/jbc.M112.441444

    Figure Lengend Snippet: Assessment of the removal of rotationally and translationally positioned uracils by UDG and APE1. A, NCPs containing a single uracil at different sites were incubated with UDG and APE1. Open symbols represent in uracils as follows: red square , NCP-UI

    Article Snippet: Alternatively, this could also suggest UDG and APE1 digest a significant fraction of the substrate at a much slower rate.

    Techniques: Incubation

    UDG and APE1 Digestion

    Journal: The Journal of Biological Chemistry

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    doi: 10.1074/jbc.M112.441444

    Figure Lengend Snippet: UDG and APE1 Digestion

    Article Snippet: Alternatively, this could also suggest UDG and APE1 digest a significant fraction of the substrate at a much slower rate.

    Techniques:

    Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Journal: The Journal of Biological Chemistry

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    doi: 10.1074/jbc.M112.441444

    Figure Lengend Snippet: Polymerase β extension activity in NCPs near the dyad. A, representative gels for NCP-gO (+10) and NCP-gI (+4) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (+10) and NCP-gI (+4) were incubated with pol β and APE1

    Article Snippet: Alternatively, this could also suggest UDG and APE1 digest a significant fraction of the substrate at a much slower rate.

    Techniques: Activity Assay, Incubation

    Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Journal: The Journal of Biological Chemistry

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    doi: 10.1074/jbc.M112.441444

    Figure Lengend Snippet: Polymerase β extension activity in NCPs near DNA ends. A, representative gels for NCP-gO (−35) and NCP-gI (−49) pol β (100 n m ) extension in the absence of APE1. B, NCP-gO (−35) and NCP-gI (−49) were incubated

    Article Snippet: Alternatively, this could also suggest UDG and APE1 digest a significant fraction of the substrate at a much slower rate.

    Techniques: Activity Assay, Incubation

    UDG and APE1 Digestion

    Journal: The Journal of Biological Chemistry

    Article Title: The Structural Location of DNA Lesions in Nucleosome Core Particles Determines Accessibility by Base Excision Repair Enzymes *

    doi: 10.1074/jbc.M112.441444

    Figure Lengend Snippet: UDG and APE1 Digestion

    Article Snippet: Alternatively, this could also suggest UDG and APE1 digest a significant fraction of the substrate at a much slower rate.

    Techniques: