bst large fragment polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 82
    Name:
    ThermoPol Reaction Buffer Pack
    Description:

    Catalog Number:
    B9004S
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bst large fragment polymerase

    https://www.bioz.com/result/bst large fragment polymerase/product/New England Biolabs
    Average 82 stars, based on 63 article reviews
    Price from $9.99 to $1999.99
    bst large fragment polymerase - by Bioz Stars, 2019-12
    82/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Novel circular DNA viruses in stool samples of wild-living chimpanzees
    Article Snippet: Paragraph title: Diagnostic PCR screening for ChiSCVs. ... The PCR conditions were as follows: denaturation at 95 °C for 3 min, 5 cycles of 95 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min, 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s, and a final extension at 72 °C for 10 min. For the second round of nested PCR, the reaction mix included 1.5 μl of PCR product from the first round, 5 μl 10× ThermoPol reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl each 10 μM primer (specifChiSCV-F2 and specifChiSCV-R2, or degenChiSCV-F2 and degenChiSCV-R2), 1 μl Taq DNA Polymerase (New England Biolabs) and 32.5 μl DEPC-treated water.

    Article Title: Bamboo tea: reduction of taxonomic complexity and application of DNA diagnostics based on rbcL and matK sequence data
    Article Snippet: The diagnostic primers were evaluated in a multiplex PCR with the universal primer-pair (rbcLa ). .. For each diagnostic primer a separate set of 10 µL PCR reactions containing 6.5 µL nuclease free water (Lonza; Biozym Scientific GmbH), 1-fold Thermopol Buffer (NEB), 1 mg/ml bovine serum albumin, 200 µmol dm−3 dNTPs (NEB), 0.3 µmol dm−3 of universal forward primer, 0.2 µmol dm−3 of universal and diagnostic reverse primer, 25–50 ng DNA template and 0.5 units of Taq polymerase (NEB) was used. .. We used the same PCR program as employed for amplification of the rbcLa marker region (see above).

    Clone Assay:

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: To examine the genetic sequence of the MFS-1F and MFS-1R primer binding region, the ehxA gene of O157:H7 and O104:H21 was amplified, cloned, and sequenced as follows. .. A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM.

    Centrifugation:

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: After centrifugation at 12,000 g for 3 min, the resulting supernatant was used as templates for LAMP and PCR assays. .. LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA.

    Article Title: Suppressors of a Host Range Mutation in the Rabbitpox Virus Serpin SPI-1 Map to Proteins Essential for Viral DNA Replication
    Article Snippet: PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl. .. PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl.

    Amplification:

    Article Title: Lack of Influence of Apolipoprotein E Status on Cognition or Brain Structure in Professional Fighters
    Article Snippet: Briefly, genomic DNA was collected from blood DNA extracted using Qiamp DNA blood maxi kit (Qiagen) and APoE genotyping was performed using Applied Biosystems TaqMan SNP Genotyping Assay. .. The amplification reaction contained 5 μ L genomic DNA, 2.5 U of Taq DNA Polymerase (New England Biolabs, Inc, Ipswich, MA), 1 × ThermoPol Reaction Buffer (New England Biolabs), 0.3 mmol/L deoxynucleotide (dNTPs), 10% dimethyl sulfoxide (DMSO), and 0.3 μ mol/L of each primer (forward primer: 5′-ACGCGGGCACGGCTGTCCAAGGA-3′; reverse primer: 5′-GCGGGCCCCGGCCTGGTACAC-3′). .. The assay was run on a Bio-Rad CFX96.

    Article Title: Molecular confirmation of Hymenolepis hibernia in field mice (Apodemus sylvaticus) from St Kilda has potential to resolve a host-parasite relationship
    Article Snippet: Paragraph title: 2.3. Genomic DNA isolation, PCR amplification and sequence analysis of mitochondrial cytochrome c oxidase subunit-1 (Cox-1) ... PCR reaction conditions consisted of 1x thermopol reaction buffer (NEB BioLab), 2 mM MgSO4, 200 μM dNTPs, 0.2 μM forward and reverse primers and 1U of Phusion high fidelity DNA polymerase (Finenzyme).

    Article Title: Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty
    Article Snippet: Complementary DNA was then prepared using the T7-BpmI-oligo(A)15 and the Superscript III reverse transcription Kit (Invitrogen), followed by second-strand synthesis using a 1:5 ratio TaqPolymerase (Roche, Branford, CT) and Pfu Polymerase (Agilent) in Thermopol Buffer (NEB) in a 200 µl reaction for 30 min at 72 °C. .. Eluted DNA was quantitated using the Qubit High Sensitivity Kit (Invitrogen) and the DNA integrity was assessed using a Bioanalyzer High Sensitivity Chip (Agilent).

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA. .. LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA.

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: To examine the genetic sequence of the MFS-1F and MFS-1R primer binding region, the ehxA gene of O157:H7 and O104:H21 was amplified, cloned, and sequenced as follows. .. A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM. .. This primer pair amplifies a 368-bp fragment (nucleotides [nt] 1612 to 1980) of the ehxA gene that includes the MFS-1F binding site.

    Article Title: Mitochondrial DNA Variation Among Populations of Rhynchophorus ferrugineus (Coleoptera: Curculionidae) From Pakistan
    Article Snippet: Paragraph title: DNA Extraction and Amplification ... PCR was performed in 25 µl reactions containing 2 µl of DNA template, ddH2 O, 1× ThermoPol PCR Buffer (New England BioLabs, Ipswich, MA), an additional 1 mM MgCl2 , 400 µM dUTP, 200 µM each dATP, dCTP and dGTP, 10 µg BSA (NEB), 1 U Taq polymerase (NEB), and 0.2 µM of each PCR primer.

    Transduction:

    Article Title: Cloning large natural product gene clusters from the environment: Piecing environmental DNA gene clusters back together with TAR
    Article Snippet: In total, the Utah soil library contains ∼10 million unique cosmid clones and the California soil library contains ∼15 million unique cosmid clones. .. DNA from each unique E. coli transduction reaction was used as a template in PCR reactions with degenerate primers designed to amplify β-Ketoacyl synthase gene sequences (dp:KSβ , 5′-TTCGGSGGNTTCCAGWSNGCSATG-3′ and dp:ACP, 5′-TCSAKSAGSGCSANSGASTCGTANCC-3′)., Each 25-μl PCR reaction contained 50 ng eDNA template, 2.5 μM of each primer, 2 mM dNTPs, 1X ThermoPol Reaction Buffer (New England Biolabs), 0.5 U Taq DNA polymerase (New England Biolabs), and 5% dimethyl sulfoxide. .. Reactions were cycled using the following touchdown protocol: initial denaturation (95°C, 2 min), then eight touchdown cycles [95°C, 45 s; 65°C (dt −1°C/cycle), 1 min; 72°C, 2 min], 35 standard cycles (95°C, 45 s; 58°C, 1 min; 72°C, 2 min) and a final extension step (72°C, 2 min)., Amplicons of the correct predicted size (∼1.5 kb) were identified by gel electrophoresis, gel purified, and directly sequenced.

    Synthesized:

    Article Title: Optimization of trans-Splicing for Huntington's Disease RNA Therapy
    Article Snippet: RNA was resuspended in 10 mM Tris–HCl pH 8.2, 1 mM EDTA, and concentrations were measured using a Nanodrop (Thermo Fisher). cDNA was synthesized using 1 μg of RNA and random primers following the SuperScript III protocol (Invitrogen, 18080-044). .. For amplifications outside the HTT exon 1 CAG repeat and the adjacent GC-rich region, Pfu enzyme (prepared in-house) with Thermopol buffer (New England Biolabs, B9004S) was used.

    Article Title: Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty
    Article Snippet: RNA was then synthesized by in vitro transcription using T7 RNA polymerase and the RNAMaxx high yield kit (Agilent) in an overnight reaction at 37 °C. .. Complementary DNA was then prepared using the T7-BpmI-oligo(A)15 and the Superscript III reverse transcription Kit (Invitrogen), followed by second-strand synthesis using a 1:5 ratio TaqPolymerase (Roche, Branford, CT) and Pfu Polymerase (Agilent) in Thermopol Buffer (NEB) in a 200 µl reaction for 30 min at 72 °C.

    Construct:

    Article Title: Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase
    Article Snippet: Paragraph title: Site-directed mutagenesis and associated construct modification ... The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min.

    Electrophoresis:

    Article Title: Novel circular DNA viruses in stool samples of wild-living chimpanzees
    Article Snippet: The PCR conditions were as follows: denaturation at 95 °C for 3 min, 5 cycles of 95 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min, 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s, and a final extension at 72 °C for 10 min. For the second round of nested PCR, the reaction mix included 1.5 μl of PCR product from the first round, 5 μl 10× ThermoPol reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl each 10 μM primer (specifChiSCV-F2 and specifChiSCV-R2, or degenChiSCV-F2 and degenChiSCV-R2), 1 μl Taq DNA Polymerase (New England Biolabs) and 32.5 μl DEPC-treated water. .. PCR conditions for the second round were identical to the first-round conditions.

    Article Title: Taxonomic and Molecular Identification of Mesocriconema and Criconemoides Species (Nematoda: Criconematidae)
    Article Snippet: The PCR mixture contained 4 μl of dNTP-mixture (0.2mM each) (Qiagen, Valencia, CA), 1 μl of each primer (0.4 μM), 0.4 μl (2 units) Taq DNA polymerase (New England Biolabs, Ipswich, MA) and 5 μl 10 X ThermoPol reaction buffer (New England Biolabs, Ipswich, MA). .. PCR was conducted using a Hybaid Express thermal cycler [Thermo Hybaid, Middlesex, UK] with the follow parameters: denaturation at 94 °C for 2 minutes, then 40 cycles of denaturation at 94 °C for 45 seconds, annealing at 52 or 56 °C for 45 seconds and extension at 72 °C for 60 seconds.

    Incubation:

    Article Title: Epigenetic Optical Mapping of 5-Hydroxymethylcytosine in Nanochannel Arrays
    Article Snippet: For the nicking reaction, 900 ng of lambda phage DNA (New England Biolabs) was digested with 30 units of Nt.BspQI nicking enzyme (New England Biolabs) for 2 h at 50 °C in the presence of 3 μL of 10× buffer 3.1 (New England Biolabs) and ultrapure water to a total volume of 30 μL. .. Next, nicked DNA was incubated for 1 h at 72 °C with 15 units of Taq DNA polymerase (New England Biolabs), supplemented with 600 nM of dATP, dGTP, dCTP (Sigma) and atto-532-dUTP (Jena Bioscience), or dATP, dGTP, dTTP (Sigma) and 5hmdCTP (Zymo Research), in the presence of 4.5 μL of 10× thermopol buffer (New England Biolabs) and ultrapure water to a total reaction volume of 45 μL. .. Following labeling, DNA was repaired for 30 min at 45 °C with 12 units of Taq DNA ligase (New England Biolabs) in the presence of 1.5 μL of 10× thermopol buffer, 1 mM NAD+ (New England Biolabs), and ultrapure water to a total reaction volume of 60 μL.

    Article Title: A loop-mediated isothermal amplification assay for the visual detection of duck circovirus
    Article Snippet: The DuCV LAMP assay was performed in tubes containing 10× Thermopol® Reaction Buffer (New England Biolabs, Beijing, China), Bst DNA polymerase (large fragment; New England Biolabs), dNTPs (Takara, Dalian, China), primers, betaine (Sigma–Aldrich), MgSO4 (Sigma–Aldrich), calcein (International Laboratory, USA), MnCl2 (International Laboratory, USA), template DNA/RNA and nuclease-free water. .. Based on the previous studies, different combinations of various concentrations of each component (dNTPs (0.4 mmol/L ~1.6 mmol/L), betaine (0.8 mmol/L ~1.4 mmol/L), MgSO4 (2 mmol/L ~9 mmol/L) were tested for amplification efficiency.

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA. .. The reaction was initiated by heating at 95°C for 3 min, then chilled on ice for 30 sec, with 1 μl (8 U) of Bst DNA polymerase (New England Biolabs, Ipswich, MA, USA) further added.

    Article Title: Suppressors of a Host Range Mutation in the Rabbitpox Virus Serpin SPI-1 Map to Proteins Essential for Viral DNA Replication
    Article Snippet: PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl. .. PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl.

    Article Title: Mitochondrial DNA Variation Among Populations of Rhynchophorus ferrugineus (Coleoptera: Curculionidae) From Pakistan
    Article Snippet: To this was added 120 µl of a 5% (w/v) suspension of Chelex 100 resin (Bio-Rad Laboratories, Hercules, CA) and the reaction was incubated at 55 °C for 1 h followed by 10 min at 99 °C. .. PCR was performed in 25 µl reactions containing 2 µl of DNA template, ddH2 O, 1× ThermoPol PCR Buffer (New England BioLabs, Ipswich, MA), an additional 1 mM MgCl2 , 400 µM dUTP, 200 µM each dATP, dCTP and dGTP, 10 µg BSA (NEB), 1 U Taq polymerase (NEB), and 0.2 µM of each PCR primer.

    Activity Assay:

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: Phenotypic assay for enterohemolysin activity was done on washed sheep blood agar plates containing calcium ( ). .. A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM.

    Expressing:

    Article Title: Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase
    Article Snippet: In addition, for the bi-cistronic expression plasmids pRSC2056 and the three p56 mutants E37D, Y40N and E37D/Y40N, a variant construct was also created by deletion of the bulk of the HHV-1 UDG ORF. .. The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min.

    Genome Wide:

    Article Title: Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty
    Article Snippet: Paragraph title: Genome-wide ChIP assays ... Complementary DNA was then prepared using the T7-BpmI-oligo(A)15 and the Superscript III reverse transcription Kit (Invitrogen), followed by second-strand synthesis using a 1:5 ratio TaqPolymerase (Roche, Branford, CT) and Pfu Polymerase (Agilent) in Thermopol Buffer (NEB) in a 200 µl reaction for 30 min at 72 °C.

    Modification:

    Article Title: Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase
    Article Snippet: Paragraph title: Site-directed mutagenesis and associated construct modification ... The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min.

    Real-time Polymerase Chain Reaction:

    Article Title: Lack of Influence of Apolipoprotein E Status on Cognition or Brain Structure in Professional Fighters
    Article Snippet: Paragraph title: Real-time polymerase chain reaction (PCR) for APoE genotyping ... The amplification reaction contained 5 μ L genomic DNA, 2.5 U of Taq DNA Polymerase (New England Biolabs, Inc, Ipswich, MA), 1 × ThermoPol Reaction Buffer (New England Biolabs), 0.3 mmol/L deoxynucleotide (dNTPs), 10% dimethyl sulfoxide (DMSO), and 0.3 μ mol/L of each primer (forward primer: 5′-ACGCGGGCACGGCTGTCCAAGGA-3′; reverse primer: 5′-GCGGGCCCCGGCCTGGTACAC-3′).

    Gas Chromatography:

    Article Title: Optimization of trans-Splicing for Huntington's Disease RNA Therapy
    Article Snippet: PCR was performed using two different procedures. .. For amplifications outside the HTT exon 1 CAG repeat and the adjacent GC-rich region, Pfu enzyme (prepared in-house) with Thermopol buffer (New England Biolabs, B9004S) was used. .. For amplification across the exon 1 CAG repeat, Taq PCRx with 2 × enhancer solution (Invitrogen, 11495-017) was used, per manufacturer instructions.

    Immunoprecipitation:

    Article Title: Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty
    Article Snippet: Shortly, 10 µl of immunoprecipitated DNA were dephosphorylated using Shrimp Alkaline Phosphatase (NEB, 1 U) for 10 min at 37 °C. .. Complementary DNA was then prepared using the T7-BpmI-oligo(A)15 and the Superscript III reverse transcription Kit (Invitrogen), followed by second-strand synthesis using a 1:5 ratio TaqPolymerase (Roche, Branford, CT) and Pfu Polymerase (Agilent) in Thermopol Buffer (NEB) in a 200 µl reaction for 30 min at 72 °C.

    Biomarker Assay:

    Article Title: Lack of Influence of Apolipoprotein E Status on Cognition or Brain Structure in Professional Fighters
    Article Snippet: Genotyping of APoE alleles was performed using real time PCR restriction fragment length polymorphism analysis by the Alzheimer's Disease Cooperative Study (ADCS) Biomarker Core according to standard operating procedures. .. The amplification reaction contained 5 μ L genomic DNA, 2.5 U of Taq DNA Polymerase (New England Biolabs, Inc, Ipswich, MA), 1 × ThermoPol Reaction Buffer (New England Biolabs), 0.3 mmol/L deoxynucleotide (dNTPs), 10% dimethyl sulfoxide (DMSO), and 0.3 μ mol/L of each primer (forward primer: 5′-ACGCGGGCACGGCTGTCCAAGGA-3′; reverse primer: 5′-GCGGGCCCCGGCCTGGTACAC-3′).

    Plasmid Preparation:

    Article Title: Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase
    Article Snippet: These constructs were created by separately digesting each plasmid using NheI and XhoI restriction enzymes. .. The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min. .. The reactions were each then expanded to 50 µl with 1× T4 DNA ligase buffer incorporating 400 units T4 DNA ligase and incubated at 30°C for 2 h, before propagation in NEB5α cells.

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA. .. LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA.

    Article Title: Suppressors of a Host Range Mutation in the Rabbitpox Virus Serpin SPI-1 Map to Proteins Essential for Viral DNA Replication
    Article Snippet: PCR primers were designed in pairs using Vector NTI (InforMax, Inc.) with the following optimal parameters: 26-mer length, melting temperature ( Tm ) of each primer was 58°C, difference in Tm between primers was less than 2°C, and the difference in the percent G+C was less than 2%. .. PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl.

    other:

    Article Title: Activation of EP2 Prostanoid Receptors in Human Glial Cell Lines Stimulates the Secretion of BDNF
    Article Snippet: Each reaction contained 1.5 mM MgCl2 , 0.2 mM in each dNTP, 0.2 mM each in forward and reverse primers, 1 unit Taq polymerase and 1x ThermoPol reaction buffer.

    Article Title: Repair of DNA Double-Strand Breaks following UV Damage in Three Sulfolobussolfataricus Strains
    Article Snippet: Standard PCRs were performed in 1×× ThermoPol buffer (New England BioLabs [NEB]) with 200 pmol of the appropriate primer (see Table S1 in the supplemental material), 200 μμM dinucleotide triphosphates (NEB), and 2.5 U Taq (NEB).

    Article Title: Controlled Microwave Heating Accelerates Rolling Circle Amplification
    Article Snippet: The temperature profiles of RCA components by microwave heating suggest that the ionic components of the ThermoPol buffer are selectively heated and that the rate of temperature increase induced by microwave heating depends on the components of a molecule and the concentrations of buffer components.

    DNA Sequencing:

    Article Title: Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase
    Article Snippet: The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min. .. The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min.

    Sequencing:

    Article Title: Molecular confirmation of Hymenolepis hibernia in field mice (Apodemus sylvaticus) from St Kilda has potential to resolve a host-parasite relationship
    Article Snippet: Paragraph title: 2.3. Genomic DNA isolation, PCR amplification and sequence analysis of mitochondrial cytochrome c oxidase subunit-1 (Cox-1) ... PCR reaction conditions consisted of 1x thermopol reaction buffer (NEB BioLab), 2 mM MgSO4, 200 μM dNTPs, 0.2 μM forward and reverse primers and 1U of Phusion high fidelity DNA polymerase (Finenzyme).

    Article Title: Taxonomic and Molecular Identification of Mesocriconema and Criconemoides Species (Nematoda: Criconematidae)
    Article Snippet: The PCR mixture contained 4 μl of dNTP-mixture (0.2mM each) (Qiagen, Valencia, CA), 1 μl of each primer (0.4 μM), 0.4 μl (2 units) Taq DNA polymerase (New England Biolabs, Ipswich, MA) and 5 μl 10 X ThermoPol reaction buffer (New England Biolabs, Ipswich, MA). .. A UV transluminator (BioDoc-it ™ system, UVP, Upland, CA) was used to visualize PCR products.

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: To examine the genetic sequence of the MFS-1F and MFS-1R primer binding region, the ehxA gene of O157:H7 and O104:H21 was amplified, cloned, and sequenced as follows. .. A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM.

    Binding Assay:

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: To examine the genetic sequence of the MFS-1F and MFS-1R primer binding region, the ehxA gene of O157:H7 and O104:H21 was amplified, cloned, and sequenced as follows. .. A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM.

    DNA Extraction:

    Article Title: Molecular confirmation of Hymenolepis hibernia in field mice (Apodemus sylvaticus) from St Kilda has potential to resolve a host-parasite relationship
    Article Snippet: Paragraph title: 2.3. Genomic DNA isolation, PCR amplification and sequence analysis of mitochondrial cytochrome c oxidase subunit-1 (Cox-1) ... PCR reaction conditions consisted of 1x thermopol reaction buffer (NEB BioLab), 2 mM MgSO4, 200 μM dNTPs, 0.2 μM forward and reverse primers and 1U of Phusion high fidelity DNA polymerase (Finenzyme).

    Article Title: Taxonomic and Molecular Identification of Mesocriconema and Criconemoides Species (Nematoda: Criconematidae)
    Article Snippet: PCR: Polymerase chain reaction (PCR) of the ITS1region was performed using 5 μl of the DNA extraction in a 50-μl PCR reaction mixture. .. The PCR mixture contained 4 μl of dNTP-mixture (0.2mM each) (Qiagen, Valencia, CA), 1 μl of each primer (0.4 μM), 0.4 μl (2 units) Taq DNA polymerase (New England Biolabs, Ipswich, MA) and 5 μl 10 X ThermoPol reaction buffer (New England Biolabs, Ipswich, MA).

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: Cultural conditions and DNA extraction of gram-negative and gram-positive strains were performed as described previously [ , - ]. .. LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA.

    Article Title: Mitochondrial DNA Variation Among Populations of Rhynchophorus ferrugineus (Coleoptera: Curculionidae) From Pakistan
    Article Snippet: Paragraph title: DNA Extraction and Amplification ... PCR was performed in 25 µl reactions containing 2 µl of DNA template, ddH2 O, 1× ThermoPol PCR Buffer (New England BioLabs, Ipswich, MA), an additional 1 mM MgCl2 , 400 µM dUTP, 200 µM each dATP, dCTP and dGTP, 10 µg BSA (NEB), 1 U Taq polymerase (NEB), and 0.2 µM of each PCR primer.

    Nucleic Acid Electrophoresis:

    Article Title: Bamboo tea: reduction of taxonomic complexity and application of DNA diagnostics based on rbcL and matK sequence data
    Article Snippet: For each diagnostic primer a separate set of 10 µL PCR reactions containing 6.5 µL nuclease free water (Lonza; Biozym Scientific GmbH), 1-fold Thermopol Buffer (NEB), 1 mg/ml bovine serum albumin, 200 µmol dm−3 dNTPs (NEB), 0.3 µmol dm−3 of universal forward primer, 0.2 µmol dm−3 of universal and diagnostic reverse primer, 25–50 ng DNA template and 0.5 units of Taq polymerase (NEB) was used. .. We used the same PCR program as employed for amplification of the rbcLa marker region (see above).

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA. .. LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA.

    Fluorescence:

    Article Title: Rapid and Sensitive Detection of Didymella bryoniae by Visual Loop-Mediated Isothermal Amplification Assay
    Article Snippet: To optimize the efficiency of the LAMP reaction, the concentration of LAMP components was optimized using genomic DNA of D. bryoniae (strain DBJSJY2) as the template. .. The best results according to a fluorescence metal indicator (calcein; Figure ) and the typical ladder-like pattern on 2% agarose gel electrophoresis ( Figure ) were obtained in a 25 μL volume containing 8 U Bst DNA polymerase, 2.5 μL 10x ThermoPol Buffer [New England Biolabs (Beijing) Ltd. Beijing, China], 8 mM MgSO4 , 10 mM dNTPs, 4 μM each of DB17RG-FIP and DB17RG-BIP, 0.5 μM each of DB17RG-F3 and DB17RG-B3, 2 μM DB17RG-LB, 0.3 mM MnCl2 , 8 μM calcein, and 1 μL target DNA. .. Based on the optimized reaction reagents, LAMP was performed using genomic DNA of D. bryoniae (strain DBJSJY2) as a template to determine the optimal temperature and reaction time.

    Mutagenesis:

    Article Title: Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase
    Article Snippet: Paragraph title: Site-directed mutagenesis and associated construct modification ... The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min.

    Isolation:

    Article Title: Optimization of trans-Splicing for Huntington's Disease RNA Therapy
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... For amplifications outside the HTT exon 1 CAG repeat and the adjacent GC-rich region, Pfu enzyme (prepared in-house) with Thermopol buffer (New England Biolabs, B9004S) was used.

    Article Title: Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty
    Article Snippet: Complementary DNA was then prepared using the T7-BpmI-oligo(A)15 and the Superscript III reverse transcription Kit (Invitrogen), followed by second-strand synthesis using a 1:5 ratio TaqPolymerase (Roche, Branford, CT) and Pfu Polymerase (Agilent) in Thermopol Buffer (NEB) in a 200 µl reaction for 30 min at 72 °C. .. The double-stranded DNA was purified using the QiaQuick PCR purification Kit (Qiagen) and eluted in 50 µl sterile water.

    Polymerase Chain Reaction:

    Article Title: Optimization of trans-Splicing for Huntington's Disease RNA Therapy
    Article Snippet: For amplifications outside the HTT exon 1 CAG repeat and the adjacent GC-rich region, Pfu enzyme (prepared in-house) with Thermopol buffer (New England Biolabs, B9004S) was used. .. For amplifications outside the HTT exon 1 CAG repeat and the adjacent GC-rich region, Pfu enzyme (prepared in-house) with Thermopol buffer (New England Biolabs, B9004S) was used.

    Article Title: Lack of Influence of Apolipoprotein E Status on Cognition or Brain Structure in Professional Fighters
    Article Snippet: Paragraph title: Real-time polymerase chain reaction (PCR) for APoE genotyping ... The amplification reaction contained 5 μ L genomic DNA, 2.5 U of Taq DNA Polymerase (New England Biolabs, Inc, Ipswich, MA), 1 × ThermoPol Reaction Buffer (New England Biolabs), 0.3 mmol/L deoxynucleotide (dNTPs), 10% dimethyl sulfoxide (DMSO), and 0.3 μ mol/L of each primer (forward primer: 5′-ACGCGGGCACGGCTGTCCAAGGA-3′; reverse primer: 5′-GCGGGCCCCGGCCTGGTACAC-3′).

    Article Title: Molecular confirmation of Hymenolepis hibernia in field mice (Apodemus sylvaticus) from St Kilda has potential to resolve a host-parasite relationship
    Article Snippet: A fragment of 396 bp of the mitochondrial cytochrome c oxidase subunit-1 (Cox-1), was amplified using forward (CeCox-For- TTTTTTGGGCATCCTGAGGTTTAT) and reverse primers (CeCox-Rev- TAAAGAAAGAACATAATGAAAATG) ( ). .. PCR reaction conditions consisted of 1x thermopol reaction buffer (NEB BioLab), 2 mM MgSO4, 200 μM dNTPs, 0.2 μM forward and reverse primers and 1U of Phusion high fidelity DNA polymerase (Finenzyme). .. The thermo-cycling parameters consisted of an initial 98 °C for 30 s followed by 40 cycles of 98 °C for 10 s, 54 °C for 30 s and 72 °C for 2 min with a single final extension cycle of 72 °C for 7 min. DNA templates for direct sequencing of the Cox-1 region were cleaned using QIAquick PCR Purification Kit (Cat No./ID: 28104) following the manufacturers’ protocols.

    Article Title: Novel circular DNA viruses in stool samples of wild-living chimpanzees
    Article Snippet: For the first round of nested PCR, 3 μl template DNA was mixed with 5 μl 10× ThermoPol Reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl of each 10 μM primer (specifChiSCV-F1 and specifChiSCV-R1, or degenChiSCV-F1 and degenChiSCV-R1), 1 μl Taq DNA Polymerase (New England Biolabs) and 31 μl DEPC-treated water. .. The PCR conditions were as follows: denaturation at 95 °C for 3 min, 5 cycles of 95 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min, 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s, and a final extension at 72 °C for 10 min. For the second round of nested PCR, the reaction mix included 1.5 μl of PCR product from the first round, 5 μl 10× ThermoPol reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl each 10 μM primer (specifChiSCV-F2 and specifChiSCV-R2, or degenChiSCV-F2 and degenChiSCV-R2), 1 μl Taq DNA Polymerase (New England Biolabs) and 32.5 μl DEPC-treated water. .. PCR conditions for the second round were identical to the first-round conditions.

    Article Title: Taxonomic and Molecular Identification of Mesocriconema and Criconemoides Species (Nematoda: Criconematidae)
    Article Snippet: This PCR primer pair ampliflied the 3’ end of the 18S rDNA gene, the entire ITS1 region and the 5’ end of the 5.8S rDNA gene. .. The PCR mixture contained 4 μl of dNTP-mixture (0.2mM each) (Qiagen, Valencia, CA), 1 μl of each primer (0.4 μM), 0.4 μl (2 units) Taq DNA polymerase (New England Biolabs, Ipswich, MA) and 5 μl 10 X ThermoPol reaction buffer (New England Biolabs, Ipswich, MA). .. PCR was conducted using a Hybaid Express thermal cycler [Thermo Hybaid, Middlesex, UK] with the follow parameters: denaturation at 94 °C for 2 minutes, then 40 cycles of denaturation at 94 °C for 45 seconds, annealing at 52 or 56 °C for 45 seconds and extension at 72 °C for 60 seconds.

    Article Title: Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase
    Article Snippet: The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min. .. The reactions were each then expanded to 50 µl with 1× T4 DNA ligase buffer incorporating 400 units T4 DNA ligase and incubated at 30°C for 2 h, before propagation in NEB5α cells.

    Article Title: Bamboo tea: reduction of taxonomic complexity and application of DNA diagnostics based on rbcL and matK sequence data
    Article Snippet: The diagnostic primers were evaluated in a multiplex PCR with the universal primer-pair (rbcLa ). .. For each diagnostic primer a separate set of 10 µL PCR reactions containing 6.5 µL nuclease free water (Lonza; Biozym Scientific GmbH), 1-fold Thermopol Buffer (NEB), 1 mg/ml bovine serum albumin, 200 µmol dm−3 dNTPs (NEB), 0.3 µmol dm−3 of universal forward primer, 0.2 µmol dm−3 of universal and diagnostic reverse primer, 25–50 ng DNA template and 0.5 units of Taq polymerase (NEB) was used. .. We used the same PCR program as employed for amplification of the rbcLa marker region (see above).

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: After centrifugation at 12,000 g for 3 min, the resulting supernatant was used as templates for LAMP and PCR assays. .. LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA.

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: Isolates were also tested for the presence of the ehxA gene with another set of PCR primers (hlyA1 and hlyA4) as described by Schmidt et al. ( ). .. A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM.

    Article Title: Suppressors of a Host Range Mutation in the Rabbitpox Virus Serpin SPI-1 Map to Proteins Essential for Viral DNA Replication
    Article Snippet: Paragraph title: Development of 5-kb PCR libraries for RPV and VV-WR. ... PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl.

    Article Title: Cloning large natural product gene clusters from the environment: Piecing environmental DNA gene clusters back together with TAR
    Article Snippet: In total, the Utah soil library contains ∼10 million unique cosmid clones and the California soil library contains ∼15 million unique cosmid clones. .. DNA from each unique E. coli transduction reaction was used as a template in PCR reactions with degenerate primers designed to amplify β-Ketoacyl synthase gene sequences (dp:KSβ , 5′-TTCGGSGGNTTCCAGWSNGCSATG-3′ and dp:ACP, 5′-TCSAKSAGSGCSANSGASTCGTANCC-3′)., Each 25-μl PCR reaction contained 50 ng eDNA template, 2.5 μM of each primer, 2 mM dNTPs, 1X ThermoPol Reaction Buffer (New England Biolabs), 0.5 U Taq DNA polymerase (New England Biolabs), and 5% dimethyl sulfoxide. .. Reactions were cycled using the following touchdown protocol: initial denaturation (95°C, 2 min), then eight touchdown cycles [95°C, 45 s; 65°C (dt −1°C/cycle), 1 min; 72°C, 2 min], 35 standard cycles (95°C, 45 s; 58°C, 1 min; 72°C, 2 min) and a final extension step (72°C, 2 min)., Amplicons of the correct predicted size (∼1.5 kb) were identified by gel electrophoresis, gel purified, and directly sequenced.

    Article Title: Mitochondrial DNA Variation Among Populations of Rhynchophorus ferrugineus (Coleoptera: Curculionidae) From Pakistan
    Article Snippet: Polymerase chain reaction (PCR) was used to amplify a section of the mitochondrial gene (mtDNA) cytochrome oxidase subunit 1 (COI) from each specimen. .. PCR was performed in 25 µl reactions containing 2 µl of DNA template, ddH2 O, 1× ThermoPol PCR Buffer (New England BioLabs, Ipswich, MA), an additional 1 mM MgCl2 , 400 µM dUTP, 200 µM each dATP, dCTP and dGTP, 10 µg BSA (NEB), 1 U Taq polymerase (NEB), and 0.2 µM of each PCR primer. .. Initial reactions utilized the primers C1-J-1718 and C1-N-2329 ( ).

    Negative Control:

    Article Title: Lack of Influence of Apolipoprotein E Status on Cognition or Brain Structure in Professional Fighters
    Article Snippet: The amplification reaction contained 5 μ L genomic DNA, 2.5 U of Taq DNA Polymerase (New England Biolabs, Inc, Ipswich, MA), 1 × ThermoPol Reaction Buffer (New England Biolabs), 0.3 mmol/L deoxynucleotide (dNTPs), 10% dimethyl sulfoxide (DMSO), and 0.3 μ mol/L of each primer (forward primer: 5′-ACGCGGGCACGGCTGTCCAAGGA-3′; reverse primer: 5′-GCGGGCCCCGGCCTGGTACAC-3′). .. The amplification reaction contained 5 μ L genomic DNA, 2.5 U of Taq DNA Polymerase (New England Biolabs, Inc, Ipswich, MA), 1 × ThermoPol Reaction Buffer (New England Biolabs), 0.3 mmol/L deoxynucleotide (dNTPs), 10% dimethyl sulfoxide (DMSO), and 0.3 μ mol/L of each primer (forward primer: 5′-ACGCGGGCACGGCTGTCCAAGGA-3′; reverse primer: 5′-GCGGGCCCCGGCCTGGTACAC-3′).

    Labeling:

    Article Title: Epigenetic Optical Mapping of 5-Hydroxymethylcytosine in Nanochannel Arrays
    Article Snippet: Paragraph title: Measuring the Labeling Efficiency of 5-hmC ... Next, nicked DNA was incubated for 1 h at 72 °C with 15 units of Taq DNA polymerase (New England Biolabs), supplemented with 600 nM of dATP, dGTP, dCTP (Sigma) and atto-532-dUTP (Jena Bioscience), or dATP, dGTP, dTTP (Sigma) and 5hmdCTP (Zymo Research), in the presence of 4.5 μL of 10× thermopol buffer (New England Biolabs) and ultrapure water to a total reaction volume of 45 μL.

    Purification:

    Article Title: Novel circular DNA viruses in stool samples of wild-living chimpanzees
    Article Snippet: The PCR conditions were as follows: denaturation at 95 °C for 3 min, 5 cycles of 95 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min, 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s, and a final extension at 72 °C for 10 min. For the second round of nested PCR, the reaction mix included 1.5 μl of PCR product from the first round, 5 μl 10× ThermoPol reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl each 10 μM primer (specifChiSCV-F2 and specifChiSCV-R2, or degenChiSCV-F2 and degenChiSCV-R2), 1 μl Taq DNA Polymerase (New England Biolabs) and 32.5 μl DEPC-treated water. .. The PCR conditions were as follows: denaturation at 95 °C for 3 min, 5 cycles of 95 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min, 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s, and a final extension at 72 °C for 10 min. For the second round of nested PCR, the reaction mix included 1.5 μl of PCR product from the first round, 5 μl 10× ThermoPol reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl each 10 μM primer (specifChiSCV-F2 and specifChiSCV-R2, or degenChiSCV-F2 and degenChiSCV-R2), 1 μl Taq DNA Polymerase (New England Biolabs) and 32.5 μl DEPC-treated water.

    Article Title: Taxonomic and Molecular Identification of Mesocriconema and Criconemoides Species (Nematoda: Criconematidae)
    Article Snippet: The PCR mixture contained 4 μl of dNTP-mixture (0.2mM each) (Qiagen, Valencia, CA), 1 μl of each primer (0.4 μM), 0.4 μl (2 units) Taq DNA polymerase (New England Biolabs, Ipswich, MA) and 5 μl 10 X ThermoPol reaction buffer (New England Biolabs, Ipswich, MA). .. A UV transluminator (BioDoc-it ™ system, UVP, Upland, CA) was used to visualize PCR products.

    Article Title: Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty
    Article Snippet: The resulting RNA was purified using the RNeasy Mini Kit (Qiagen) and eluted in 20 µl sterile water. .. Complementary DNA was then prepared using the T7-BpmI-oligo(A)15 and the Superscript III reverse transcription Kit (Invitrogen), followed by second-strand synthesis using a 1:5 ratio TaqPolymerase (Roche, Branford, CT) and Pfu Polymerase (Agilent) in Thermopol Buffer (NEB) in a 200 µl reaction for 30 min at 72 °C.

    Article Title: Suppressors of a Host Range Mutation in the Rabbitpox Virus Serpin SPI-1 Map to Proteins Essential for Viral DNA Replication
    Article Snippet: PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl. .. PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Optimization of trans-Splicing for Huntington's Disease RNA Therapy
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... For amplifications outside the HTT exon 1 CAG repeat and the adjacent GC-rich region, Pfu enzyme (prepared in-house) with Thermopol buffer (New England Biolabs, B9004S) was used.

    Staining:

    Article Title: Taxonomic and Molecular Identification of Mesocriconema and Criconemoides Species (Nematoda: Criconematidae)
    Article Snippet: The PCR mixture contained 4 μl of dNTP-mixture (0.2mM each) (Qiagen, Valencia, CA), 1 μl of each primer (0.4 μM), 0.4 μl (2 units) Taq DNA polymerase (New England Biolabs, Ipswich, MA) and 5 μl 10 X ThermoPol reaction buffer (New England Biolabs, Ipswich, MA). .. PCR was conducted using a Hybaid Express thermal cycler [Thermo Hybaid, Middlesex, UK] with the follow parameters: denaturation at 94 °C for 2 minutes, then 40 cycles of denaturation at 94 °C for 45 seconds, annealing at 52 or 56 °C for 45 seconds and extension at 72 °C for 60 seconds.

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA. .. LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA.

    Nested PCR:

    Article Title: Novel circular DNA viruses in stool samples of wild-living chimpanzees
    Article Snippet: For the first round of nested PCR, 3 μl template DNA was mixed with 5 μl 10× ThermoPol Reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl of each 10 μM primer (specifChiSCV-F1 and specifChiSCV-R1, or degenChiSCV-F1 and degenChiSCV-R1), 1 μl Taq DNA Polymerase (New England Biolabs) and 31 μl DEPC-treated water. .. The PCR conditions were as follows: denaturation at 95 °C for 3 min, 5 cycles of 95 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min, 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s, and a final extension at 72 °C for 10 min. For the second round of nested PCR, the reaction mix included 1.5 μl of PCR product from the first round, 5 μl 10× ThermoPol reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl each 10 μM primer (specifChiSCV-F2 and specifChiSCV-R2, or degenChiSCV-F2 and degenChiSCV-R2), 1 μl Taq DNA Polymerase (New England Biolabs) and 32.5 μl DEPC-treated water. .. PCR conditions for the second round were identical to the first-round conditions.

    Chromatin Immunoprecipitation:

    Article Title: Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty
    Article Snippet: Paragraph title: Genome-wide ChIP assays ... Complementary DNA was then prepared using the T7-BpmI-oligo(A)15 and the Superscript III reverse transcription Kit (Invitrogen), followed by second-strand synthesis using a 1:5 ratio TaqPolymerase (Roche, Branford, CT) and Pfu Polymerase (Agilent) in Thermopol Buffer (NEB) in a 200 µl reaction for 30 min at 72 °C.

    Phenotypic Assay:

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: Phenotypic assay for enterohemolysin activity was done on washed sheep blood agar plates containing calcium ( ). .. A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM.

    Software:

    Article Title: Molecular confirmation of Hymenolepis hibernia in field mice (Apodemus sylvaticus) from St Kilda has potential to resolve a host-parasite relationship
    Article Snippet: PCR reaction conditions consisted of 1x thermopol reaction buffer (NEB BioLab), 2 mM MgSO4, 200 μM dNTPs, 0.2 μM forward and reverse primers and 1U of Phusion high fidelity DNA polymerase (Finenzyme). .. PCR reaction conditions consisted of 1x thermopol reaction buffer (NEB BioLab), 2 mM MgSO4, 200 μM dNTPs, 0.2 μM forward and reverse primers and 1U of Phusion high fidelity DNA polymerase (Finenzyme).

    Irradiation:

    Article Title: Controlled Microwave Heating Accelerates Rolling Circle Amplification
    Article Snippet: In contrast, the temperature of the four RCA components (Bst DNA polymerase-LF, dNTP, template–primer, and water) was 42°C. .. These data indicate that the ThermoPol buffer in MW-RCA was selectively heated by microwave irradiation. .. ThermoPol buffer, which contains a high concentration of ionic molecules, is considered to be heated by conduction loss of microwave irradiation [ , ].

    Multiplex Assay:

    Article Title: Bamboo tea: reduction of taxonomic complexity and application of DNA diagnostics based on rbcL and matK sequence data
    Article Snippet: The diagnostic primers were evaluated in a multiplex PCR with the universal primer-pair (rbcLa ). .. For each diagnostic primer a separate set of 10 µL PCR reactions containing 6.5 µL nuclease free water (Lonza; Biozym Scientific GmbH), 1-fold Thermopol Buffer (NEB), 1 mg/ml bovine serum albumin, 200 µmol dm−3 dNTPs (NEB), 0.3 µmol dm−3 of universal forward primer, 0.2 µmol dm−3 of universal and diagnostic reverse primer, 25–50 ng DNA template and 0.5 units of Taq polymerase (NEB) was used.

    TaqMan SNP Genotyping Assay:

    Article Title: Lack of Influence of Apolipoprotein E Status on Cognition or Brain Structure in Professional Fighters
    Article Snippet: Briefly, genomic DNA was collected from blood DNA extracted using Qiamp DNA blood maxi kit (Qiagen) and APoE genotyping was performed using Applied Biosystems TaqMan SNP Genotyping Assay. .. The amplification reaction contained 5 μ L genomic DNA, 2.5 U of Taq DNA Polymerase (New England Biolabs, Inc, Ipswich, MA), 1 × ThermoPol Reaction Buffer (New England Biolabs), 0.3 mmol/L deoxynucleotide (dNTPs), 10% dimethyl sulfoxide (DMSO), and 0.3 μ mol/L of each primer (forward primer: 5′-ACGCGGGCACGGCTGTCCAAGGA-3′; reverse primer: 5′-GCGGGCCCCGGCCTGGTACAC-3′).

    Agarose Gel Electrophoresis:

    Article Title: Novel circular DNA viruses in stool samples of wild-living chimpanzees
    Article Snippet: The PCR conditions were as follows: denaturation at 95 °C for 3 min, 5 cycles of 95 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min, 35 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s, and a final extension at 72 °C for 10 min. For the second round of nested PCR, the reaction mix included 1.5 μl of PCR product from the first round, 5 μl 10× ThermoPol reaction buffer (New England Biolabs), 5 μl 10 μM dNTP, 2.5 μl each 10 μM primer (specifChiSCV-F2 and specifChiSCV-R2, or degenChiSCV-F2 and degenChiSCV-R2), 1 μl Taq DNA Polymerase (New England Biolabs) and 32.5 μl DEPC-treated water. .. PCR conditions for the second round were identical to the first-round conditions.

    Article Title: Taxonomic and Molecular Identification of Mesocriconema and Criconemoides Species (Nematoda: Criconematidae)
    Article Snippet: The PCR mixture contained 4 μl of dNTP-mixture (0.2mM each) (Qiagen, Valencia, CA), 1 μl of each primer (0.4 μM), 0.4 μl (2 units) Taq DNA polymerase (New England Biolabs, Ipswich, MA) and 5 μl 10 X ThermoPol reaction buffer (New England Biolabs, Ipswich, MA). .. PCR was conducted using a Hybaid Express thermal cycler [Thermo Hybaid, Middlesex, UK] with the follow parameters: denaturation at 94 °C for 2 minutes, then 40 cycles of denaturation at 94 °C for 45 seconds, annealing at 52 or 56 °C for 45 seconds and extension at 72 °C for 60 seconds.

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM. .. The PCR mixtures were heated at 95°C for 5 min, at which time 0.5 U of Vent DNA polymerase (New England Biolabs) in 5 μl of 1× Thermopol buffer was added to yield a final reaction volume of 50 μl.

    Article Title: Rapid and Sensitive Detection of Didymella bryoniae by Visual Loop-Mediated Isothermal Amplification Assay
    Article Snippet: To optimize the efficiency of the LAMP reaction, the concentration of LAMP components was optimized using genomic DNA of D. bryoniae (strain DBJSJY2) as the template. .. The best results according to a fluorescence metal indicator (calcein; Figure ) and the typical ladder-like pattern on 2% agarose gel electrophoresis ( Figure ) were obtained in a 25 μL volume containing 8 U Bst DNA polymerase, 2.5 μL 10x ThermoPol Buffer [New England Biolabs (Beijing) Ltd. Beijing, China], 8 mM MgSO4 , 10 mM dNTPs, 4 μM each of DB17RG-FIP and DB17RG-BIP, 0.5 μM each of DB17RG-F3 and DB17RG-B3, 2 μM DB17RG-LB, 0.3 mM MnCl2 , 8 μM calcein, and 1 μL target DNA. .. Based on the optimized reaction reagents, LAMP was performed using genomic DNA of D. bryoniae (strain DBJSJY2) as a template to determine the optimal temperature and reaction time.

    Article Title: Mitochondrial DNA Variation Among Populations of Rhynchophorus ferrugineus (Coleoptera: Curculionidae) From Pakistan
    Article Snippet: PCR was performed in 25 µl reactions containing 2 µl of DNA template, ddH2 O, 1× ThermoPol PCR Buffer (New England BioLabs, Ipswich, MA), an additional 1 mM MgCl2 , 400 µM dUTP, 200 µM each dATP, dCTP and dGTP, 10 µg BSA (NEB), 1 U Taq polymerase (NEB), and 0.2 µM of each PCR primer. .. PCR was performed in 25 µl reactions containing 2 µl of DNA template, ddH2 O, 1× ThermoPol PCR Buffer (New England BioLabs, Ipswich, MA), an additional 1 mM MgCl2 , 400 µM dUTP, 200 µM each dATP, dCTP and dGTP, 10 µg BSA (NEB), 1 U Taq polymerase (NEB), and 0.2 µM of each PCR primer.

    In Vitro:

    Article Title: Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty
    Article Snippet: RNA was then synthesized by in vitro transcription using T7 RNA polymerase and the RNAMaxx high yield kit (Agilent) in an overnight reaction at 37 °C. .. Complementary DNA was then prepared using the T7-BpmI-oligo(A)15 and the Superscript III reverse transcription Kit (Invitrogen), followed by second-strand synthesis using a 1:5 ratio TaqPolymerase (Roche, Branford, CT) and Pfu Polymerase (Agilent) in Thermopol Buffer (NEB) in a 200 µl reaction for 30 min at 72 °C.

    Size-exclusion Chromatography:

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA. .. After incubation at various temperatures ranging from 59°C to 66°C for 15 min-120 min, the reaction was terminated by heating at 80°C for 2 min. As PCR assay was concerned, the amplification was carried out in 50 μl reactant, using the outer primers F3 and B3.

    Quantitation Assay:

    Article Title: Suppressors of a Host Range Mutation in the Rabbitpox Virus Serpin SPI-1 Map to Proteins Essential for Viral DNA Replication
    Article Snippet: PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl. .. PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl.

    Concentration Assay:

    Article Title: Epigenetic Optical Mapping of 5-Hydroxymethylcytosine in Nanochannel Arrays
    Article Snippet: Next, nicked DNA was incubated for 1 h at 72 °C with 15 units of Taq DNA polymerase (New England Biolabs), supplemented with 600 nM of dATP, dGTP, dCTP (Sigma) and atto-532-dUTP (Jena Bioscience), or dATP, dGTP, dTTP (Sigma) and 5hmdCTP (Zymo Research), in the presence of 4.5 μL of 10× thermopol buffer (New England Biolabs) and ultrapure water to a total reaction volume of 45 μL. .. Next, nicked DNA was incubated for 1 h at 72 °C with 15 units of Taq DNA polymerase (New England Biolabs), supplemented with 600 nM of dATP, dGTP, dCTP (Sigma) and atto-532-dUTP (Jena Bioscience), or dATP, dGTP, dTTP (Sigma) and 5hmdCTP (Zymo Research), in the presence of 4.5 μL of 10× thermopol buffer (New England Biolabs) and ultrapure water to a total reaction volume of 45 μL.

    Article Title: Genetic Analysis for Virulence Factors in Escherichia coli O104:H21 That Was Implicated in an Outbreak of Hemorrhagic Colitis
    Article Snippet: To examine the genetic sequence of the MFS-1F and MFS-1R primer binding region, the ehxA gene of O157:H7 and O104:H21 was amplified, cloned, and sequenced as follows. .. A small amount of bacterial colony was directly added to 44 μl of an amplification mixture containing 1× Thermopol buffer (New England Biolabs, Beverly, Mass.), 2 mM MgSO4 , each deoxynucleoside triphosphate at a concentration of 200 μM, and the 5′ primer hlyAalt1 (5′-CCA GGA GAA GAA GTT AGA G-3′) and the 3′ primer MFS-1R each at a concentration of 200 nM. .. This primer pair amplifies a 368-bp fragment (nucleotides [nt] 1612 to 1980) of the ehxA gene that includes the MFS-1F binding site.

    Article Title: Rapid and Sensitive Detection of Didymella bryoniae by Visual Loop-Mediated Isothermal Amplification Assay
    Article Snippet: To optimize the efficiency of the LAMP reaction, the concentration of LAMP components was optimized using genomic DNA of D. bryoniae (strain DBJSJY2) as the template. .. The best results according to a fluorescence metal indicator (calcein; Figure ) and the typical ladder-like pattern on 2% agarose gel electrophoresis ( Figure ) were obtained in a 25 μL volume containing 8 U Bst DNA polymerase, 2.5 μL 10x ThermoPol Buffer [New England Biolabs (Beijing) Ltd. Beijing, China], 8 mM MgSO4 , 10 mM dNTPs, 4 μM each of DB17RG-FIP and DB17RG-BIP, 0.5 μM each of DB17RG-F3 and DB17RG-B3, 2 μM DB17RG-LB, 0.3 mM MnCl2 , 8 μM calcein, and 1 μL target DNA.

    Lamp Assay:

    Article Title: A loop-mediated isothermal amplification assay for the visual detection of duck circovirus
    Article Snippet: All primers were purchased from Invitrogen (Guangzhou, China). .. The DuCV LAMP assay was performed in tubes containing 10× Thermopol® Reaction Buffer (New England Biolabs, Beijing, China), Bst DNA polymerase (large fragment; New England Biolabs), dNTPs (Takara, Dalian, China), primers, betaine (Sigma–Aldrich), MgSO4 (Sigma–Aldrich), calcein (International Laboratory, USA), MnCl2 (International Laboratory, USA), template DNA/RNA and nuclease-free water. .. Based on the previous studies, different combinations of various concentrations of each component (dNTPs (0.4 mmol/L ~1.6 mmol/L), betaine (0.8 mmol/L ~1.4 mmol/L), MgSO4 (2 mmol/L ~9 mmol/L) were tested for amplification efficiency.

    Article Title: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfX loop-mediated isothermal amplification assay
    Article Snippet: Paragraph title: Establishment and optimization of orfX -Lamp assay ... LAMP assays was carried out in 3 different reaction mixture volumns, containing 1.6 μM (each) of the primers FIP and BIP, 0.2 μM (each) of the primers F3 and B3, 0.8 μM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4 , 1 M betain (Sigma, St. Louis, MO, USA), 1 X thermopol buffer (New England Biolabs, Ipswich, MA, USA), and specified amounts of target genomic DNA.

    Article Title: Rapid and Sensitive Detection of Didymella bryoniae by Visual Loop-Mediated Isothermal Amplification Assay
    Article Snippet: Paragraph title: Optimization of the LAMP Assay ... The best results according to a fluorescence metal indicator (calcein; Figure ) and the typical ladder-like pattern on 2% agarose gel electrophoresis ( Figure ) were obtained in a 25 μL volume containing 8 U Bst DNA polymerase, 2.5 μL 10x ThermoPol Buffer [New England Biolabs (Beijing) Ltd. Beijing, China], 8 mM MgSO4 , 10 mM dNTPs, 4 μM each of DB17RG-FIP and DB17RG-BIP, 0.5 μM each of DB17RG-F3 and DB17RG-B3, 2 μM DB17RG-LB, 0.3 mM MnCl2 , 8 μM calcein, and 1 μL target DNA.

    Lysis:

    Article Title: Molecular confirmation of Hymenolepis hibernia in field mice (Apodemus sylvaticus) from St Kilda has potential to resolve a host-parasite relationship
    Article Snippet: Aliquots of about 100 cyclophyllidean cestode eggs with hexacanth onchospheres were lysed in single 0.2 ml tubes containing 50 μl of proteinase K lysis buffer and stored at −80 °C as previously described ( ). .. PCR reaction conditions consisted of 1x thermopol reaction buffer (NEB BioLab), 2 mM MgSO4, 200 μM dNTPs, 0.2 μM forward and reverse primers and 1U of Phusion high fidelity DNA polymerase (Finenzyme).

    Variant Assay:

    Article Title: Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase
    Article Snippet: In addition, for the bi-cistronic expression plasmids pRSC2056 and the three p56 mutants E37D, Y40N and E37D/Y40N, a variant construct was also created by deletion of the bulk of the HHV-1 UDG ORF. .. The incompatible overhangs were then filled in by incubating 75 ng of each plasmid in 20 µl of reactions with 1× Thermopol buffer (NEB), supplemented with 0.3 mM dNTPs and 4 units VentR ® DNA polymerase, incubating at 72°C for 15 min.

    Genomic Sequencing:

    Article Title: Suppressors of a Host Range Mutation in the Rabbitpox Virus Serpin SPI-1 Map to Proteins Essential for Viral DNA Replication
    Article Snippet: Primer sequences were based on both VV-WR (provided by B. Moss) and RPV (Utrecht strain, provided by M. Buller and C. Upton) genomic sequences obtained prior to publication. .. PCRs included Vent DNA polymerase at 0.032 U per μl in 1× ThermoPol Buffer (New England Biolabs), which contains 2 mM MgSO4 , with 0.3 μM concentrations of each primer, 0.5 mM deoxynucleoside triphosphates, and 2 ng genomic wild-type RPV or VV DNA per μl.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 99
    New England Biolabs thermopol reaction buffer
    Thermopol Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermopol reaction buffer/product/New England Biolabs
    Average 99 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    thermopol reaction buffer - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    82
    New England Biolabs bst large fragment polymerase
    Bst Large Fragment Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bst large fragment polymerase/product/New England Biolabs
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bst large fragment polymerase - by Bioz Stars, 2019-12
    82/100 stars
      Buy from Supplier

    Image Search Results