mcrbc restriction endonuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    McrBC
    Description:
    McrBC 2 500 units
    Catalog Number:
    m0272l
    Price:
    290
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mcrbc restriction endonuclease
    McrBC
    McrBC 2 500 units
    https://www.bioz.com/result/mcrbc restriction endonuclease/product/New England Biolabs
    Average 90 stars, based on 63 article reviews
    Price from $9.99 to $1999.99
    mcrbc restriction endonuclease - by Bioz Stars, 2020-03
    90/100 stars

    Images

    1) Product Images from "Changes in gene methylation patterns in neonatal murine hearts: Implications for the regenerative potential"

    Article Title: Changes in gene methylation patterns in neonatal murine hearts: Implications for the regenerative potential

    Journal: BMC Genomics

    doi: 10.1186/s12864-016-2545-1

    qPCR validation of microarray results for remarkable genes showing significant changes in DNA methylation and transcript levels between d1 and d7 in neonatal murine hearts. The left panels show DNA methylation and gene expression microarray results represented by red bars and black markers, respectively; DNA methylation is expressed as MeDIP enrichment and gene expression levels as normalized microarray signals. The black markers preceding that indicating the neonatal d1 represent gene expression levels in embryonic hearts E16, E18, E19, E20. The middle panels present CpG methylation estimated with Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) where the DNA methylation levels correspond to the amounts of DNA undigested by CpG methylation dependent McrBC enzyme (1-(McrBC/Input). The right panels demonstrate transcript levels determined with qPCR as the ratios to the reference transcript of the Tbp gene (TATA binding protein gene). The microarray results were determined for pooled samples of 3 mice. The qPCR results represent average values obtained for three individuals for each developmental time-point. The statistical significance has been determined with two-tailed heteroscedastic Student’s t -test. The complete results of qPCR validation are collected in Additional file 2 : F2
    Figure Legend Snippet: qPCR validation of microarray results for remarkable genes showing significant changes in DNA methylation and transcript levels between d1 and d7 in neonatal murine hearts. The left panels show DNA methylation and gene expression microarray results represented by red bars and black markers, respectively; DNA methylation is expressed as MeDIP enrichment and gene expression levels as normalized microarray signals. The black markers preceding that indicating the neonatal d1 represent gene expression levels in embryonic hearts E16, E18, E19, E20. The middle panels present CpG methylation estimated with Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) where the DNA methylation levels correspond to the amounts of DNA undigested by CpG methylation dependent McrBC enzyme (1-(McrBC/Input). The right panels demonstrate transcript levels determined with qPCR as the ratios to the reference transcript of the Tbp gene (TATA binding protein gene). The microarray results were determined for pooled samples of 3 mice. The qPCR results represent average values obtained for three individuals for each developmental time-point. The statistical significance has been determined with two-tailed heteroscedastic Student’s t -test. The complete results of qPCR validation are collected in Additional file 2 : F2

    Techniques Used: Real-time Polymerase Chain Reaction, Microarray, DNA Methylation Assay, Expressing, Methylated DNA Immunoprecipitation, CpG Methylation Assay, Methylation, Binding Assay, Mouse Assay, Two Tailed Test

    2) Product Images from "Changes in gene methylation patterns in neonatal murine hearts: Implications for the regenerative potential"

    Article Title: Changes in gene methylation patterns in neonatal murine hearts: Implications for the regenerative potential

    Journal: BMC Genomics

    doi: 10.1186/s12864-016-2545-1

    qPCR validation of microarray results for remarkable genes showing significant changes in DNA methylation and transcript levels between d1 and d7 in neonatal murine hearts. The left panels show DNA methylation and gene expression microarray results represented by red bars and black markers, respectively; DNA methylation is expressed as MeDIP enrichment and gene expression levels as normalized microarray signals. The black markers preceding that indicating the neonatal d1 represent gene expression levels in embryonic hearts E16, E18, E19, E20. The middle panels present CpG methylation estimated with Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) where the DNA methylation levels correspond to the amounts of DNA undigested by CpG methylation dependent McrBC enzyme (1-(McrBC/Input). The right panels demonstrate transcript levels determined with qPCR as the ratios to the reference transcript of the Tbp gene (TATA binding protein gene). The microarray results were determined for pooled samples of 3 mice. The qPCR results represent average values obtained for three individuals for each developmental time-point. The statistical significance has been determined with two-tailed heteroscedastic Student’s t -test. The complete results of qPCR validation are collected in Additional file 2 : F2
    Figure Legend Snippet: qPCR validation of microarray results for remarkable genes showing significant changes in DNA methylation and transcript levels between d1 and d7 in neonatal murine hearts. The left panels show DNA methylation and gene expression microarray results represented by red bars and black markers, respectively; DNA methylation is expressed as MeDIP enrichment and gene expression levels as normalized microarray signals. The black markers preceding that indicating the neonatal d1 represent gene expression levels in embryonic hearts E16, E18, E19, E20. The middle panels present CpG methylation estimated with Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) where the DNA methylation levels correspond to the amounts of DNA undigested by CpG methylation dependent McrBC enzyme (1-(McrBC/Input). The right panels demonstrate transcript levels determined with qPCR as the ratios to the reference transcript of the Tbp gene (TATA binding protein gene). The microarray results were determined for pooled samples of 3 mice. The qPCR results represent average values obtained for three individuals for each developmental time-point. The statistical significance has been determined with two-tailed heteroscedastic Student’s t -test. The complete results of qPCR validation are collected in Additional file 2 : F2

    Techniques Used: Real-time Polymerase Chain Reaction, Microarray, DNA Methylation Assay, Expressing, Methylated DNA Immunoprecipitation, CpG Methylation Assay, Methylation, Binding Assay, Mouse Assay, Two Tailed Test

    Related Articles

    Methylation Sequencing:

    Article Title: HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1 [W]HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1 [W] [OA]
    Article Snippet: Paragraph title: McrBC-PCR and Bisulfite Sequencing ... A total of 100 ng of genomic DNA from 18-d-old Col, axe1-5 , and met1-3 plants, growing in long-day conditions, was digested with 20 units of McrBC endonuclease (catalogue no. M0272S; New England Biolabs) for 8 h at 37°C.

    Clone Assay:

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in . .. Cycling parameters used are as follows: denaturation at 96°C 3 min, followed by 40 cycles of 96°C for 30 s, 50°C for 30 s, 62°C for 2 min and a final extension at 65°C for 2 min. PCR products were gel extracted (Qiagen) and cloned into pGEM-Teasy (Promega).

    Article Title: DNA Methylation Affects the SP1-regulated Transcription of FOXF2 in Breast Cancer Cells *
    Article Snippet: The amplified promoter fragments were gel-purified as described above and cloned into pGL3-Basic. .. The methylation efficiency was confirmed by restriction enzyme digestion using McrBC, HhaI, and HpaII (New England Biolabs).

    Article Title: The Genome of the Stick Insect Medauroidea extradentata Is Strongly Methylated within Genes and Repetitive DNA
    Article Snippet: Paragraph title: Digestions, cloning and Southern blot ... Digestion using MspI, HpaII, MboI, Bsp143I (all from Fermentas) and McrBC (New England Biolabs) has been performed according to the conditions required by the supplier at 37°C for 16 h using 1 U/µg DNA at least three times independently using the same DNA preparations for all enzymes.

    Amplification:

    Article Title: Genes and Transposons Are Differentially Methylated in Plants, but Not in Mammals
    Article Snippet: Sss I pre-treatment and McrBC digestion was performed as recommended by the supplier (New England Biolabs). .. Amplification was carried out using 25–50 ng of template DNA, 0.5 mM primers (see Supplemental information), 0.5 mM dNTPs, 1 U of Taq polymerase (QIAGEN) in 20 μL of 1× reaction buffer.

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: .. About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in . .. Total DNA (500 ng) from parents and hybrids was treated with sodium bisulphite using EZ-DNA methylation gold kit (Zymo Research) as per manufacturer's instructions.

    Article Title: DNA Methylation Affects the SP1-regulated Transcription of FOXF2 in Breast Cancer Cells *
    Article Snippet: The amplified promoter fragments were gel-purified as described above and cloned into pGL3-Basic. .. The methylation efficiency was confirmed by restriction enzyme digestion using McrBC, HhaI, and HpaII (New England Biolabs).

    Article Title: PbGA2ox8 induces vascular-related anthocyanin accumulation and contributes to red stripe formation on pear fruit
    Article Snippet: The isolated DNA was then digested with 40 units of the methylation-sensitive restriction enzyme McrBC (New England Biolabs; M0272L) for 2 h, and the digestion buffer without GTPase was used as the negative control. .. The 1300-bp region upstream of the ATG translation site of PbGA2ox8 was divided into four overlapping fragments and amplified using McrBc-PCR.

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C. .. Then the selected DNA fragments ( ) were amplified by qPCR using SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: Independent functions of DNMT1 and USP7 at replication foci
    Article Snippet: Genomic DNA was digested for two rounds with methylation-sensitive enzyme HpaII, its isoschizomer MspI as a control, or McrBC (all from NEB). .. Primers used for probe amplification: probe IAP F (GGTAAACAAATAATCTGCGC); probe IAP R (CTGGTAATGGGCTGCTTCTTCC).

    Filtration:

    Article Title: Genes and Transposons Are Differentially Methylated in Plants, but Not in Mammals
    Article Snippet: Paragraph title: McrPCR and Methylation Filtration ... Sss I pre-treatment and McrBC digestion was performed as recommended by the supplier (New England Biolabs).

    Quantitative RT-PCR:

    Article Title: Exendin-4 promotes extracellular-superoxide dismutase expression in A549 cells through DNA demethylation
    Article Snippet: Cleaved genomic DNA (500 ng) was further cleaved with McrBC (New England BioLabs, Beverly, MA), an endonuclease that cleaves DNA containing methylcytosine, in a final reaction volume of 10 µl at 37°C for 1 h followed by an incubation at 65°C for 20 min. .. The cleaved genomic DNA was diluted 10-fold with water, and 2 µl of the DNA was used as a template for the real-time RT-PCR analysis.

    Article Title: Tempered mlo broad-spectrum resistance to barley powdery mildew in an Ethiopian landrace
    Article Snippet: .. Cytosine methylation by McrBC-quantitative PCR Methylation of the promoter region of Mlo and the mlo-11 repeat units were detected by McrBC (NEB, Ipswich, MA) digestion followed by qRT-PCR. .. McrBC detects a high proportion of methyl cytosines by recognition of two short half sites with the consensus sequence (G/A)m C and, in addition, restricts asymmetric and hemi-methylated (single stranded) sites .

    SYBR Green Assay:

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: .. About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in . .. Total DNA (500 ng) from parents and hybrids was treated with sodium bisulphite using EZ-DNA methylation gold kit (Zymo Research) as per manufacturer's instructions.

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C. .. Then the selected DNA fragments ( ) were amplified by qPCR using SYBR Green PCR Master Mix (Applied Biosystems).

    Incubation:

    Article Title: Exendin-4 promotes extracellular-superoxide dismutase expression in A549 cells through DNA demethylation
    Article Snippet: .. Cleaved genomic DNA (500 ng) was further cleaved with McrBC (New England BioLabs, Beverly, MA), an endonuclease that cleaves DNA containing methylcytosine, in a final reaction volume of 10 µl at 37°C for 1 h followed by an incubation at 65°C for 20 min. .. The cleaved genomic DNA was diluted 10-fold with water, and 2 µl of the DNA was used as a template for the real-time RT-PCR analysis.

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: .. About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in . .. Total DNA (500 ng) from parents and hybrids was treated with sodium bisulphite using EZ-DNA methylation gold kit (Zymo Research) as per manufacturer's instructions.

    Article Title: Directed Evolution of Improved Zinc Finger Methyltransferases
    Article Snippet: Plasmid DNA was isolated via QIAprep Spin Miniprep Kit and digested for 3 hours at 37°C with McrBC (10 units/µg DNA), FspI (2.5–5 units/µg DNA) in 1X NEBuffer 2 supplemented with 100 µg/ml BSA and 1 mM GTP. .. Reactions were halted by incubation at 65°C for over 20 min to which ExoIII (30 units/µg DNA) was added and the solution incubated at 37°C for 60 min. ExoIII digestion was halted by incubation at 80°C for over 30 min and the DNA was desalted using Zymo Clean and Concentrator-5 kits per manufacturer’s instructions.

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: .. 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C. .. Then the selected DNA fragments ( ) were amplified by qPCR using SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: SUVH1, a Su(var)3–9 family member, promotes the expression of genes targeted by DNA methylation
    Article Snippet: One hundred nanogram DNA was treated with 2 units of McrBC (New England Biolabs, M0272S) at 37°C for 30 min, and a mix without McrBC was performed in parallel as the control. .. The mixtures were incubated at 65°C for 20 min to inactivate the McrBC. qPCR was performed using iQ™ SYBR® (Bio-Rad, 170-8880) to quantify the remaining DNA, with the ratio between the McrBC mix and the mix without McrBC as an indicator of the methylation level.

    Activity Assay:

    Article Title: DNA Methylation Affects the SP1-regulated Transcription of FOXF2 in Breast Cancer Cells *
    Article Snippet: Paragraph title: Influence of CpG Island Methylation Status on FOXF2 Promoter Activity ... The methylation efficiency was confirmed by restriction enzyme digestion using McrBC, HhaI, and HpaII (New England Biolabs).

    Transformation Assay:

    Article Title: Directed Evolution of Improved Zinc Finger Methyltransferases
    Article Snippet: Plasmid DNA was isolated via QIAprep Spin Miniprep Kit and digested for 3 hours at 37°C with McrBC (10 units/µg DNA), FspI (2.5–5 units/µg DNA) in 1X NEBuffer 2 supplemented with 100 µg/ml BSA and 1 mM GTP. .. DNA was transformed into ER2267 electrocompetent cells and plated on agar supplemented with 2% w/v glucose and 100 µg/ml ampicillin salt.

    Bisulfite Sequencing:

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: Paragraph title: DNA methylation assay and bisulphite sequencing ... About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in .

    Southern Blot:

    Article Title: The Genome of the Stick Insect Medauroidea extradentata Is Strongly Methylated within Genes and Repetitive DNA
    Article Snippet: Paragraph title: Digestions, cloning and Southern blot ... Digestion using MspI, HpaII, MboI, Bsp143I (all from Fermentas) and McrBC (New England Biolabs) has been performed according to the conditions required by the supplier at 37°C for 16 h using 1 U/µg DNA at least three times independently using the same DNA preparations for all enzymes.

    Article Title: Independent functions of DNMT1 and USP7 at replication foci
    Article Snippet: Genomic DNA was digested for two rounds with methylation-sensitive enzyme HpaII, its isoschizomer MspI as a control, or McrBC (all from NEB). .. Southern blot analysis was performed with IAP probes generated by PCR.

    Generated:

    Article Title: Independent functions of DNMT1 and USP7 at replication foci
    Article Snippet: Genomic DNA was digested for two rounds with methylation-sensitive enzyme HpaII, its isoschizomer MspI as a control, or McrBC (all from NEB). .. Southern blot analysis was performed with IAP probes generated by PCR.

    CpG Methylation Assay:

    Article Title: Changes in gene methylation patterns in neonatal murine hearts: Implications for the regenerative potential
    Article Snippet: .. Validation of CpG methylation CpG methylation levels were examined by using Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) with McrBC restriction endonuclease (NEB, cat. no. M0272). ..

    Polymerase Chain Reaction:

    Article Title: Genes and Transposons Are Differentially Methylated in Plants, but Not in Mammals
    Article Snippet: Sss I pre-treatment and McrBC digestion was performed as recommended by the supplier (New England Biolabs). .. Reactions were in 96-well PCR plates heated to 95°C for 5 min, followed by 26 cycles of 30 sec at 95°C, 45 sec at 58°C, and 45 sec at 72°C.

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in . .. Cycling parameters used are as follows: denaturation at 96°C 3 min, followed by 40 cycles of 96°C for 30 s, 50°C for 30 s, 62°C for 2 min and a final extension at 65°C for 2 min. PCR products were gel extracted (Qiagen) and cloned into pGEM-Teasy (Promega).

    Article Title: PbGA2ox8 induces vascular-related anthocyanin accumulation and contributes to red stripe formation on pear fruit
    Article Snippet: The isolated DNA was then digested with 40 units of the methylation-sensitive restriction enzyme McrBC (New England Biolabs; M0272L) for 2 h, and the digestion buffer without GTPase was used as the negative control. .. The methylation level in the digested DNA templates was measured by semiquantitative PCR.

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C. .. Then the selected DNA fragments ( ) were amplified by qPCR using SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: High-resolution spatiotemporal transcriptome mapping of tomato fruit development and ripening
    Article Snippet: A total of 0.5 μg DNA was digested with 7.5 U McrBC (NEB) according to the manufacturer’s recommendations for 6 h at 37 °C, or the same reaction without GTP as a negative control. .. PCR was performed using 40 ng McrBC-treated DNA.

    Article Title: Independent functions of DNMT1 and USP7 at replication foci
    Article Snippet: Genomic DNA was digested for two rounds with methylation-sensitive enzyme HpaII, its isoschizomer MspI as a control, or McrBC (all from NEB). .. Southern blot analysis was performed with IAP probes generated by PCR.

    Article Title: Tempered mlo broad-spectrum resistance to barley powdery mildew in an Ethiopian landrace
    Article Snippet: .. Cytosine methylation by McrBC-quantitative PCR Methylation of the promoter region of Mlo and the mlo-11 repeat units were detected by McrBC (NEB, Ipswich, MA) digestion followed by qRT-PCR. .. McrBC detects a high proportion of methyl cytosines by recognition of two short half sites with the consensus sequence (G/A)m C and, in addition, restricts asymmetric and hemi-methylated (single stranded) sites .

    Article Title: HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1 [W]HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1 [W] [OA]
    Article Snippet: A total of 100 ng of genomic DNA from 18-d-old Col, axe1-5 , and met1-3 plants, growing in long-day conditions, was digested with 20 units of McrBC endonuclease (catalogue no. M0272S; New England Biolabs) for 8 h at 37°C. .. Following the McrBC treatment, subsequent PCR was used to analyze the methylation status of the transposons.

    Molecular Weight:

    Article Title: The Genome of the Stick Insect Medauroidea extradentata Is Strongly Methylated within Genes and Repetitive DNA
    Article Snippet: Digestion using MspI, HpaII, MboI, Bsp143I (all from Fermentas) and McrBC (New England Biolabs) has been performed according to the conditions required by the supplier at 37°C for 16 h using 1 U/µg DNA at least three times independently using the same DNA preparations for all enzymes. .. For cloning of methylated DNA fragments, the band of highest molecular weight in the HpaII lane was excised from a 1.0% low melting agarose gel, heated 10 min at 70°C and supplemented immediately with Bsp143I and restriction buffer for overnight digestion.

    DNA Extraction:

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: Paragraph title: DNA extraction and McrBC-based methylation assay ... 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C.

    Fluorescence:

    Article Title: The Genome of the Stick Insect Medauroidea extradentata Is Strongly Methylated within Genes and Repetitive DNA
    Article Snippet: Digestion using MspI, HpaII, MboI, Bsp143I (all from Fermentas) and McrBC (New England Biolabs) has been performed according to the conditions required by the supplier at 37°C for 16 h using 1 U/µg DNA at least three times independently using the same DNA preparations for all enzymes. .. Applying the programs Object Image and Graphic Converter, a two-color-plot was made from the intensity of ethidium bromide fluorescence of MspI/HpaII digested probes running side by side at a 0.8% agarose gel.

    Methylation:

    Article Title: Changes in gene methylation patterns in neonatal murine hearts: Implications for the regenerative potential
    Article Snippet: .. Validation of CpG methylation CpG methylation levels were examined by using Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) with McrBC restriction endonuclease (NEB, cat. no. M0272). ..

    Article Title: Genes and Transposons Are Differentially Methylated in Plants, but Not in Mammals
    Article Snippet: Paragraph title: McrPCR and Methylation Filtration ... Sss I pre-treatment and McrBC digestion was performed as recommended by the supplier (New England Biolabs).

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in . .. Total DNA (500 ng) from parents and hybrids was treated with sodium bisulphite using EZ-DNA methylation gold kit (Zymo Research) as per manufacturer's instructions.

    Article Title: DNA Methylation Affects the SP1-regulated Transcription of FOXF2 in Breast Cancer Cells *
    Article Snippet: .. The methylation efficiency was confirmed by restriction enzyme digestion using McrBC, HhaI, and HpaII (New England Biolabs). .. Furthermore, the methylated or mock-methylated fragments were religated into pGL3-Basic to assess differentially methylated promoter activity.

    Article Title: PbGA2ox8 induces vascular-related anthocyanin accumulation and contributes to red stripe formation on pear fruit
    Article Snippet: .. The isolated DNA was then digested with 40 units of the methylation-sensitive restriction enzyme McrBC (New England Biolabs; M0272L) for 2 h, and the digestion buffer without GTPase was used as the negative control. .. The methylation level in the digested DNA templates was measured by semiquantitative PCR.

    Article Title: The Genome of the Stick Insect Medauroidea extradentata Is Strongly Methylated within Genes and Repetitive DNA
    Article Snippet: Digestion using MspI, HpaII, MboI, Bsp143I (all from Fermentas) and McrBC (New England Biolabs) has been performed according to the conditions required by the supplier at 37°C for 16 h using 1 U/µg DNA at least three times independently using the same DNA preparations for all enzymes. .. For cloning of methylated DNA fragments, the band of highest molecular weight in the HpaII lane was excised from a 1.0% low melting agarose gel, heated 10 min at 70°C and supplemented immediately with Bsp143I and restriction buffer for overnight digestion.

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: Paragraph title: DNA extraction and McrBC-based methylation assay ... 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C.

    Article Title: SUVH1, a Su(var)3–9 family member, promotes the expression of genes targeted by DNA methylation
    Article Snippet: One hundred nanogram DNA was treated with 2 units of McrBC (New England Biolabs, M0272S) at 37°C for 30 min, and a mix without McrBC was performed in parallel as the control. .. The mixtures were incubated at 65°C for 20 min to inactivate the McrBC. qPCR was performed using iQ™ SYBR® (Bio-Rad, 170-8880) to quantify the remaining DNA, with the ratio between the McrBC mix and the mix without McrBC as an indicator of the methylation level.

    Article Title: Independent functions of DNMT1 and USP7 at replication foci
    Article Snippet: .. Genomic DNA was digested for two rounds with methylation-sensitive enzyme HpaII, its isoschizomer MspI as a control, or McrBC (all from NEB). .. DNA was quantified and ran on 0.8% agarose gel, which was stained with ethidium bromide.

    Article Title: Chromatin and sequence features that define the fine and gross structure of genomic methylation patterns
    Article Snippet: .. Unmethylated and methylated compartments were obtained by limit digestions of 10–15 μg of DNA with McrBC or five tetranucleotide methylation-sensitive restriction endonucleases (referred to as RE), respectively (New England BioLabs). ..

    Article Title: Tempered mlo broad-spectrum resistance to barley powdery mildew in an Ethiopian landrace
    Article Snippet: .. Cytosine methylation by McrBC-quantitative PCR Methylation of the promoter region of Mlo and the mlo-11 repeat units were detected by McrBC (NEB, Ipswich, MA) digestion followed by qRT-PCR. .. McrBC detects a high proportion of methyl cytosines by recognition of two short half sites with the consensus sequence (G/A)m C and, in addition, restricts asymmetric and hemi-methylated (single stranded) sites .

    Article Title: HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1 [W]HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1 [W] [OA]
    Article Snippet: A total of 100 ng of genomic DNA from 18-d-old Col, axe1-5 , and met1-3 plants, growing in long-day conditions, was digested with 20 units of McrBC endonuclease (catalogue no. M0272S; New England Biolabs) for 8 h at 37°C. .. Following the McrBC treatment, subsequent PCR was used to analyze the methylation status of the transposons.

    Isolation:

    Article Title: Exendin-4 promotes extracellular-superoxide dismutase expression in A549 cells through DNA demethylation
    Article Snippet: McrBC digestion of genomic DNA Genomic DNA was isolated from A549 cells using a Puregene Core kit (Qiagen) according to the manufacturer’s protocol. .. Cleaved genomic DNA (500 ng) was further cleaved with McrBC (New England BioLabs, Beverly, MA), an endonuclease that cleaves DNA containing methylcytosine, in a final reaction volume of 10 µl at 37°C for 1 h followed by an incubation at 65°C for 20 min.

    Article Title: Directed Evolution of Improved Zinc Finger Methyltransferases
    Article Snippet: .. Plasmid DNA was isolated via QIAprep Spin Miniprep Kit and digested for 3 hours at 37°C with McrBC (10 units/µg DNA), FspI (2.5–5 units/µg DNA) in 1X NEBuffer 2 supplemented with 100 µg/ml BSA and 1 mM GTP. .. Reactions were halted by incubation at 65°C for over 20 min to which ExoIII (30 units/µg DNA) was added and the solution incubated at 37°C for 60 min. ExoIII digestion was halted by incubation at 80°C for over 30 min and the DNA was desalted using Zymo Clean and Concentrator-5 kits per manufacturer’s instructions.

    Article Title: PbGA2ox8 induces vascular-related anthocyanin accumulation and contributes to red stripe formation on pear fruit
    Article Snippet: .. The isolated DNA was then digested with 40 units of the methylation-sensitive restriction enzyme McrBC (New England Biolabs; M0272L) for 2 h, and the digestion buffer without GTPase was used as the negative control. .. The methylation level in the digested DNA templates was measured by semiquantitative PCR.

    Article Title: The Genome of the Stick Insect Medauroidea extradentata Is Strongly Methylated within Genes and Repetitive DNA
    Article Snippet: Digestions, cloning and Southern blot DNA was isolated by standard protocols. .. Digestion using MspI, HpaII, MboI, Bsp143I (all from Fermentas) and McrBC (New England Biolabs) has been performed according to the conditions required by the supplier at 37°C for 16 h using 1 U/µg DNA at least three times independently using the same DNA preparations for all enzymes.

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: DNA extraction and McrBC-based methylation assay DNA was isolated using Gen-Elute Mammalian Genomic DNA MiniPrep Kit (Sigma Aldrich) according to the manufacturer's protocol. .. 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C.

    Size-exclusion Chromatography:

    Article Title: Genes and Transposons Are Differentially Methylated in Plants, but Not in Mammals
    Article Snippet: Sss I pre-treatment and McrBC digestion was performed as recommended by the supplier (New England Biolabs). .. Reactions were in 96-well PCR plates heated to 95°C for 5 min, followed by 26 cycles of 30 sec at 95°C, 45 sec at 58°C, and 45 sec at 72°C.

    Purification:

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: The concentration of the purified DNA was estimated using a Nanodrop spectrophotometer. .. About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in .

    Dot Blot:

    Article Title: Genes and Transposons Are Differentially Methylated in Plants, but Not in Mammals
    Article Snippet: Libraries and dot-blot hybridizations were prepared as described previously ( ). .. Sss I pre-treatment and McrBC digestion was performed as recommended by the supplier (New England Biolabs).

    Sequencing:

    Article Title: Tempered mlo broad-spectrum resistance to barley powdery mildew in an Ethiopian landrace
    Article Snippet: Cytosine methylation by McrBC-quantitative PCR Methylation of the promoter region of Mlo and the mlo-11 repeat units were detected by McrBC (NEB, Ipswich, MA) digestion followed by qRT-PCR. .. McrBC detects a high proportion of methyl cytosines by recognition of two short half sites with the consensus sequence (G/A)m C and, in addition, restricts asymmetric and hemi-methylated (single stranded) sites .

    Activated Clotting Time Assay:

    Article Title: Exendin-4 promotes extracellular-superoxide dismutase expression in A549 cells through DNA demethylation
    Article Snippet: Cleaved genomic DNA (500 ng) was further cleaved with McrBC (New England BioLabs, Beverly, MA), an endonuclease that cleaves DNA containing methylcytosine, in a final reaction volume of 10 µl at 37°C for 1 h followed by an incubation at 65°C for 20 min. .. The primer pairs were as follows: sense 1 (–1,208 bp from transcription start site) 5'-GCT GGT AAC TAA GTC ACC CA-3' and sense 2 (–278 bp) 5'-CTG AAG GTC ACT GGC TAC AA-3' ; antisense 1 (–764 bp) 5'-TGT TGT CTG GGA GAA CTA GG-3' and antisense 2 (+51 bp) 5'-TAG CAC CCA CCT TTC CAG C-3'.

    Plasmid Preparation:

    Article Title: Directed Evolution of Improved Zinc Finger Methyltransferases
    Article Snippet: .. Plasmid DNA was isolated via QIAprep Spin Miniprep Kit and digested for 3 hours at 37°C with McrBC (10 units/µg DNA), FspI (2.5–5 units/µg DNA) in 1X NEBuffer 2 supplemented with 100 µg/ml BSA and 1 mM GTP. .. Reactions were halted by incubation at 65°C for over 20 min to which ExoIII (30 units/µg DNA) was added and the solution incubated at 37°C for 60 min. ExoIII digestion was halted by incubation at 80°C for over 30 min and the DNA was desalted using Zymo Clean and Concentrator-5 kits per manufacturer’s instructions.

    Article Title: The Genome of the Stick Insect Medauroidea extradentata Is Strongly Methylated within Genes and Repetitive DNA
    Article Snippet: Digestion using MspI, HpaII, MboI, Bsp143I (all from Fermentas) and McrBC (New England Biolabs) has been performed according to the conditions required by the supplier at 37°C for 16 h using 1 U/µg DNA at least three times independently using the same DNA preparations for all enzymes. .. The resulting fragments were isolated using glass milk, cloned in a pBSII vector (Stratagene) linearized with BamHI and sequenced.

    Software:

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C. .. The results were analyzed and cycle threshold (Ct) values of transcripts were quantified using CFX manager software (BioRad).

    Real-time Polymerase Chain Reaction:

    Article Title: Changes in gene methylation patterns in neonatal murine hearts: Implications for the regenerative potential
    Article Snippet: .. Validation of CpG methylation CpG methylation levels were examined by using Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) with McrBC restriction endonuclease (NEB, cat. no. M0272). ..

    Article Title: Exendin-4 promotes extracellular-superoxide dismutase expression in A549 cells through DNA demethylation
    Article Snippet: Cleaved genomic DNA (500 ng) was further cleaved with McrBC (New England BioLabs, Beverly, MA), an endonuclease that cleaves DNA containing methylcytosine, in a final reaction volume of 10 µl at 37°C for 1 h followed by an incubation at 65°C for 20 min. .. Real-time RT-PCR was carried out using ThunderbirdTM SYBR qPCR Mix according to the manufacturer’s protocols.

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: .. About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in . .. Total DNA (500 ng) from parents and hybrids was treated with sodium bisulphite using EZ-DNA methylation gold kit (Zymo Research) as per manufacturer's instructions.

    Article Title: SOXC transcription factors in mantle cell lymphoma: the role of promoter methylation in SOX11 expression
    Article Snippet: 800 ng DNA was incubated with the mastermix containing McrBC or mock-mastermix (according to the manufacturer's guidance, New England Biolabs) for 2 hours at 37°C, followed by 15 min at 65°C. .. Then the selected DNA fragments ( ) were amplified by qPCR using SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: SUVH1, a Su(var)3–9 family member, promotes the expression of genes targeted by DNA methylation
    Article Snippet: One hundred nanogram DNA was treated with 2 units of McrBC (New England Biolabs, M0272S) at 37°C for 30 min, and a mix without McrBC was performed in parallel as the control. .. The mixtures were incubated at 65°C for 20 min to inactivate the McrBC. qPCR was performed using iQ™ SYBR® (Bio-Rad, 170-8880) to quantify the remaining DNA, with the ratio between the McrBC mix and the mix without McrBC as an indicator of the methylation level.

    Article Title: Tempered mlo broad-spectrum resistance to barley powdery mildew in an Ethiopian landrace
    Article Snippet: Cytosine methylation by McrBC-quantitative PCR Methylation of the promoter region of Mlo and the mlo-11 repeat units were detected by McrBC (NEB, Ipswich, MA) digestion followed by qRT-PCR. .. Undigested controls were treated with water. qPCR was performed with four technical replicates per sample and DNA methylation levels quantitatively calculated by the ∆∆Ct method.

    Negative Control:

    Article Title: PbGA2ox8 induces vascular-related anthocyanin accumulation and contributes to red stripe formation on pear fruit
    Article Snippet: .. The isolated DNA was then digested with 40 units of the methylation-sensitive restriction enzyme McrBC (New England Biolabs; M0272L) for 2 h, and the digestion buffer without GTPase was used as the negative control. .. The methylation level in the digested DNA templates was measured by semiquantitative PCR.

    Article Title: High-resolution spatiotemporal transcriptome mapping of tomato fruit development and ripening
    Article Snippet: .. A total of 0.5 μg DNA was digested with 7.5 U McrBC (NEB) according to the manufacturer’s recommendations for 6 h at 37 °C, or the same reaction without GTP as a negative control. .. PCR was performed using 40 ng McrBC-treated DNA.

    Selection:

    Article Title: Directed Evolution of Improved Zinc Finger Methyltransferases
    Article Snippet: Paragraph title: Library Selection ... Plasmid DNA was isolated via QIAprep Spin Miniprep Kit and digested for 3 hours at 37°C with McrBC (10 units/µg DNA), FspI (2.5–5 units/µg DNA) in 1X NEBuffer 2 supplemented with 100 µg/ml BSA and 1 mM GTP.

    Agarose Gel Electrophoresis:

    Article Title: The Genome of the Stick Insect Medauroidea extradentata Is Strongly Methylated within Genes and Repetitive DNA
    Article Snippet: Digestion using MspI, HpaII, MboI, Bsp143I (all from Fermentas) and McrBC (New England Biolabs) has been performed according to the conditions required by the supplier at 37°C for 16 h using 1 U/µg DNA at least three times independently using the same DNA preparations for all enzymes. .. Applying the programs Object Image and Graphic Converter, a two-color-plot was made from the intensity of ethidium bromide fluorescence of MspI/HpaII digested probes running side by side at a 0.8% agarose gel.

    Article Title: High-resolution spatiotemporal transcriptome mapping of tomato fruit development and ripening
    Article Snippet: Genomic DNA extracted from fruit of cv M82 plants was quantified using a Nanodrop (Thermo Fisher Scientific) and fractionated on a 1% agarose gel to check integrity. .. A total of 0.5 μg DNA was digested with 7.5 U McrBC (NEB) according to the manufacturer’s recommendations for 6 h at 37 °C, or the same reaction without GTP as a negative control.

    Article Title: Independent functions of DNMT1 and USP7 at replication foci
    Article Snippet: Genomic DNA was digested for two rounds with methylation-sensitive enzyme HpaII, its isoschizomer MspI as a control, or McrBC (all from NEB). .. DNA was quantified and ran on 0.8% agarose gel, which was stained with ethidium bromide.

    In Vitro:

    Article Title: DNA Methylation Affects the SP1-regulated Transcription of FOXF2 in Breast Cancer Cells *
    Article Snippet: The enriched fragments were removed from pGL3-Basic and methylated in vitro using SssI, HhaI, and HpaII methylases (New England Biolabs) or no enzyme (mock) according to the manufacturer's instructions. .. The methylation efficiency was confirmed by restriction enzyme digestion using McrBC, HhaI, and HpaII (New England Biolabs).

    Ethanol Precipitation:

    Article Title: Exendin-4 promotes extracellular-superoxide dismutase expression in A549 cells through DNA demethylation
    Article Snippet: Genomic DNA was cleaved with EcoRI at 37°C for 2 h followed by phenol-chloroform extraction and ethanol precipitation. .. Cleaved genomic DNA (500 ng) was further cleaved with McrBC (New England BioLabs, Beverly, MA), an endonuclease that cleaves DNA containing methylcytosine, in a final reaction volume of 10 µl at 37°C for 1 h followed by an incubation at 65°C for 20 min.

    Article Title: Genes and Transposons Are Differentially Methylated in Plants, but Not in Mammals
    Article Snippet: Genomic DNA was prepared by phenol-chloroform extraction and ethanol precipitation, and was then nebulized as described ( ). .. Sss I pre-treatment and McrBC digestion was performed as recommended by the supplier (New England Biolabs).

    Article Title: Chromatin and sequence features that define the fine and gross structure of genomic methylation patterns
    Article Snippet: Unmethylated and methylated compartments were obtained by limit digestions of 10–15 μg of DNA with McrBC or five tetranucleotide methylation-sensitive restriction endonucleases (referred to as RE), respectively (New England BioLabs). .. Each round of digestion was followed by phenol-choloroform extraction (phenol:chloroform:isoamyl alcohol [25:24:1] at pH 8) and ethanol precipitation (add 1 mg/mL glycogen [0.01 vol], 3 M sodium acetate at pH 5.3 [0.1 vol], and ethanol [2 vol]; incubate at −20°C for 15 min; centrifuge at 20,800 g at 4°C for 15 min; wash with 600 μL of cold 70% ethanol, and centrifuge at 20,800 g at 4°C for 5 min; air dry and resuspended in 1× TE [10 mM Tris, 1 mM EDTA at pH 8]).

    Spectrophotometry:

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: The concentration of the purified DNA was estimated using a Nanodrop spectrophotometer. .. About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in .

    DNA Methylation Assay:

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: Paragraph title: DNA methylation assay and bisulphite sequencing ... About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in .

    Article Title: PbGA2ox8 induces vascular-related anthocyanin accumulation and contributes to red stripe formation on pear fruit
    Article Snippet: McrBC-PCR analysis The DNA methylation level was analyzed using McrBC-PCR. .. The isolated DNA was then digested with 40 units of the methylation-sensitive restriction enzyme McrBC (New England Biolabs; M0272L) for 2 h, and the digestion buffer without GTPase was used as the negative control.

    Article Title: Tempered mlo broad-spectrum resistance to barley powdery mildew in an Ethiopian landrace
    Article Snippet: Cytosine methylation by McrBC-quantitative PCR Methylation of the promoter region of Mlo and the mlo-11 repeat units were detected by McrBC (NEB, Ipswich, MA) digestion followed by qRT-PCR. .. Undigested controls were treated with water. qPCR was performed with four technical replicates per sample and DNA methylation levels quantitatively calculated by the ∆∆Ct method.

    Concentration Assay:

    Article Title: Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs
    Article Snippet: The concentration of the purified DNA was estimated using a Nanodrop spectrophotometer. .. About 500 ng of DNA at 20 ng/μl was incubated with 20 U McrBC (New England Biolabs) or an equivalent volume of 50% glycerol for 2 h at 37°C followed by heat inactivation at 80°C for 20 min. Target regions were amplified by qPCR from 40-ng digested DNA using SYBR Green JumpStart Taq ReadyMix (Sigma S9194), using primers described in .

    Fractionation:

    Article Title: Chromatin and sequence features that define the fine and gross structure of genomic methylation patterns
    Article Snippet: Paragraph title: Enzymatic fractionation by methylation state ... Unmethylated and methylated compartments were obtained by limit digestions of 10–15 μg of DNA with McrBC or five tetranucleotide methylation-sensitive restriction endonucleases (referred to as RE), respectively (New England BioLabs).

    CTG Assay:

    Article Title: Exendin-4 promotes extracellular-superoxide dismutase expression in A549 cells through DNA demethylation
    Article Snippet: Cleaved genomic DNA (500 ng) was further cleaved with McrBC (New England BioLabs, Beverly, MA), an endonuclease that cleaves DNA containing methylcytosine, in a final reaction volume of 10 µl at 37°C for 1 h followed by an incubation at 65°C for 20 min. .. The primer pairs were as follows: sense 1 (–1,208 bp from transcription start site) 5'-GCT GGT AAC TAA GTC ACC CA-3' and sense 2 (–278 bp) 5'-CTG AAG GTC ACT GGC TAC AA-3' ; antisense 1 (–764 bp) 5'-TGT TGT CTG GGA GAA CTA GG-3' and antisense 2 (+51 bp) 5'-TAG CAC CCA CCT TTC CAG C-3'.

    Staining:

    Article Title: Independent functions of DNMT1 and USP7 at replication foci
    Article Snippet: Genomic DNA was digested for two rounds with methylation-sensitive enzyme HpaII, its isoschizomer MspI as a control, or McrBC (all from NEB). .. DNA was quantified and ran on 0.8% agarose gel, which was stained with ethidium bromide.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs mcrbc restriction endonuclease
    qPCR validation of microarray results for remarkable genes showing significant changes in DNA methylation and transcript levels between d1 and d7 in neonatal murine hearts. The left panels show DNA methylation and gene expression microarray results represented by red bars and black markers, respectively; DNA methylation is expressed as MeDIP enrichment and gene expression levels as normalized microarray signals. The black markers preceding that indicating the neonatal d1 represent gene expression levels in embryonic hearts E16, E18, E19, E20. The middle panels present CpG methylation estimated with Methylation Dependent Restriction Digestion followed by quantitative <t>PCR</t> (MDRE-qPCR) where the DNA methylation levels correspond to the amounts of DNA undigested by CpG methylation dependent <t>McrBC</t> enzyme (1-(McrBC/Input). The right panels demonstrate transcript levels determined with qPCR as the ratios to the reference transcript of the Tbp gene (TATA binding protein gene). The microarray results were determined for pooled samples of 3 mice. The qPCR results represent average values obtained for three individuals for each developmental time-point. The statistical significance has been determined with two-tailed heteroscedastic Student’s t -test. The complete results of qPCR validation are collected in Additional file 2 : F2
    Mcrbc Restriction Endonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcrbc restriction endonuclease/product/New England Biolabs
    Average 99 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    mcrbc restriction endonuclease - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    qPCR validation of microarray results for remarkable genes showing significant changes in DNA methylation and transcript levels between d1 and d7 in neonatal murine hearts. The left panels show DNA methylation and gene expression microarray results represented by red bars and black markers, respectively; DNA methylation is expressed as MeDIP enrichment and gene expression levels as normalized microarray signals. The black markers preceding that indicating the neonatal d1 represent gene expression levels in embryonic hearts E16, E18, E19, E20. The middle panels present CpG methylation estimated with Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) where the DNA methylation levels correspond to the amounts of DNA undigested by CpG methylation dependent McrBC enzyme (1-(McrBC/Input). The right panels demonstrate transcript levels determined with qPCR as the ratios to the reference transcript of the Tbp gene (TATA binding protein gene). The microarray results were determined for pooled samples of 3 mice. The qPCR results represent average values obtained for three individuals for each developmental time-point. The statistical significance has been determined with two-tailed heteroscedastic Student’s t -test. The complete results of qPCR validation are collected in Additional file 2 : F2

    Journal: BMC Genomics

    Article Title: Changes in gene methylation patterns in neonatal murine hearts: Implications for the regenerative potential

    doi: 10.1186/s12864-016-2545-1

    Figure Lengend Snippet: qPCR validation of microarray results for remarkable genes showing significant changes in DNA methylation and transcript levels between d1 and d7 in neonatal murine hearts. The left panels show DNA methylation and gene expression microarray results represented by red bars and black markers, respectively; DNA methylation is expressed as MeDIP enrichment and gene expression levels as normalized microarray signals. The black markers preceding that indicating the neonatal d1 represent gene expression levels in embryonic hearts E16, E18, E19, E20. The middle panels present CpG methylation estimated with Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) where the DNA methylation levels correspond to the amounts of DNA undigested by CpG methylation dependent McrBC enzyme (1-(McrBC/Input). The right panels demonstrate transcript levels determined with qPCR as the ratios to the reference transcript of the Tbp gene (TATA binding protein gene). The microarray results were determined for pooled samples of 3 mice. The qPCR results represent average values obtained for three individuals for each developmental time-point. The statistical significance has been determined with two-tailed heteroscedastic Student’s t -test. The complete results of qPCR validation are collected in Additional file 2 : F2

    Article Snippet: Validation of CpG methylation CpG methylation levels were examined by using Methylation Dependent Restriction Digestion followed by quantitative PCR (MDRE-qPCR) with McrBC restriction endonuclease (NEB, cat. no. M0272).

    Techniques: Real-time Polymerase Chain Reaction, Microarray, DNA Methylation Assay, Expressing, Methylated DNA Immunoprecipitation, CpG Methylation Assay, Methylation, Binding Assay, Mouse Assay, Two Tailed Test

    The suvh1–1 mutation does not affect DNA methylation. ( A and B ) McrBC-qPCR analysis of DNA methylation levels at the d35S promoter and the LUC coding region in YJ (A) and LUCH (B). qPCR was performed using genomic DNA treated with or without McrBC. The relative levels of amplified DNA for UBQ5, LUC and d35S in samples treated with McrBC compared to untreated samples were shown. Error bars were from three technical replicates. Two biological replicates were performed and gave similar results. ( C and D ) The levels of CG, CHG and CHH DNA methylation at the d35S promoter (C) and LUC coding region (D) in YJ and YJ suvh1–1 as determined through MethylC sequencing. Results from two biological replicates (rep) are shown. (E) Total genomic CG, CHG and CHH DNA methylation in YJ and YJ suvh1–1 as determined through MethylC-seq. Results from two biological replicates (rep) are shown.

    Journal: Nucleic Acids Research

    Article Title: SUVH1, a Su(var)3–9 family member, promotes the expression of genes targeted by DNA methylation

    doi: 10.1093/nar/gkv958

    Figure Lengend Snippet: The suvh1–1 mutation does not affect DNA methylation. ( A and B ) McrBC-qPCR analysis of DNA methylation levels at the d35S promoter and the LUC coding region in YJ (A) and LUCH (B). qPCR was performed using genomic DNA treated with or without McrBC. The relative levels of amplified DNA for UBQ5, LUC and d35S in samples treated with McrBC compared to untreated samples were shown. Error bars were from three technical replicates. Two biological replicates were performed and gave similar results. ( C and D ) The levels of CG, CHG and CHH DNA methylation at the d35S promoter (C) and LUC coding region (D) in YJ and YJ suvh1–1 as determined through MethylC sequencing. Results from two biological replicates (rep) are shown. (E) Total genomic CG, CHG and CHH DNA methylation in YJ and YJ suvh1–1 as determined through MethylC-seq. Results from two biological replicates (rep) are shown.

    Article Snippet: One hundred nanogram DNA was treated with 2 units of McrBC (New England Biolabs, M0272S) at 37°C for 30 min, and a mix without McrBC was performed in parallel as the control.

    Techniques: Mutagenesis, DNA Methylation Assay, Real-time Polymerase Chain Reaction, Amplification, Sequencing

    Gene expression (A) and cytosine methylation (B) analyses of HDA6-regulated TEs in met1-3 plants. d, McrBC-digested DNA input; u, undigested DNA input.

    Journal: Plant Physiology

    Article Title: HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1 [W]HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis 1 [W] [OA]

    doi: 10.1104/pp.111.184275

    Figure Lengend Snippet: Gene expression (A) and cytosine methylation (B) analyses of HDA6-regulated TEs in met1-3 plants. d, McrBC-digested DNA input; u, undigested DNA input.

    Article Snippet: A total of 100 ng of genomic DNA from 18-d-old Col, axe1-5 , and met1-3 plants, growing in long-day conditions, was digested with 20 units of McrBC endonuclease (catalogue no. M0272S; New England Biolabs) for 8 h at 37°C.

    Techniques: Expressing, Methylation