lambda exonuclease (New England Biolabs)
New England Biolabs is a verified supplier 
90
|
Name:
Lambda Exonuclease
Description:
Lambda Exonuclease 5 000 units
Catalog Number:
m0262l
Price:
276
Size:
5 000 units
Category:
Exonucleases
|
Buy from Supplier |
Structured Review
New England Biolabs
lambda exonuclease
Lambda Exonuclease 5 000 units
https://www.bioz.com/result/lambda exonuclease/product/New England Biolabs
Average 90 stars, based on 110 article reviews
Price from $9.99 to $1999.99
Lambda Exonuclease 5 000 units
https://www.bioz.com/result/lambda exonuclease/product/New England Biolabs
Average 90 stars, based on 110 article reviews
Price from $9.99 to $1999.99
lambda exonuclease - by Bioz Stars,
2020-01
90/100 stars
Images
1) Product Images from "ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints"
Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints
Journal: Nature biotechnology
doi: 10.1038/nbt.3121
Figure Legend Snippet: Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.
Techniques Used: Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Amplification, Functional Assay, Ligation, Purification, Polymerase Chain Reaction, Sequencing, Genomic Sequencing, Generated, In Vitro, Footprinting, In Vivo
Figure Legend Snippet: Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.
Techniques Used: In Vivo, Chromatin Immunoprecipitation, Variant Assay, Binding Assay
Related Articles
Clone Assay:Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: Donor DNA templates were generated by digesting pAAV-P2A-EGFP (sequence below) with XbaI and EcoRI (New England Biolabs) and inserting three gblocks (LHA, P2A-EGFP or P2A-CreERT2, RHA, purchased from IDT, sequences below) using Gibson cloning (HIFI assembly mix, New England Biolabs) according to the manufacturers’ protocols. .. Amplification:Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences Article Snippet: This spacer was used as the template for PCR amplification using a primer that had a BsaI site and one target-specific sequence, and a second primer that had an MlyI site and the other target-specific sequence. .. The digested PCR product was treated with 0.1 units Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq Article Snippet: The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Article Title: SeqSharp Article Snippet: .. The single-step amplification/sequencing products were treated with 2.5 U of Article Title: SeqSharp Article Snippet: Paragraph title: SeqSharp for Sequencing PCR Amplified DNA Fragment ... After the sequencing reaction was completed, we treated the products with 2.5 U of Article Title: Light-regulated gene repositioning in Arabidopsis Article Snippet: After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex Article Snippet: First, a DNA fragment was amplified from pGsat4 by PCR using two primers, a 25mer forward primer (AGTAT ATATG AGTAA ACTTG GTCTG) and a 25mer reverse primer (CTCAT TTTTT AACCA ATAGG CCGAA). .. Second, the strand with the phosphorylated 5′-end was digested with Polymerase Chain Reaction:Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines Article Snippet: .. The PCR product was split into eight reactions with 10 units of Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae Article Snippet: .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells Article Snippet: Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences Article Snippet: .. The digested PCR product was treated with 0.1 units Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq Article Snippet: The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: The PCR product was highly purified with the Qiagen PCR purification kit and subject to digestion of the antisense strand. .. Article Title: SeqSharp Article Snippet: Paragraph title: SeqSharp for Sequencing PCR Amplified DNA Fragment ... After the sequencing reaction was completed, we treated the products with 2.5 U of Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex Article Snippet: The PCR product was fractionated on a 1% agarose gel in TAE buffer, and was purified as described above. .. Second, the strand with the phosphorylated 5′-end was digested with Construct:Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae Article Snippet: .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with SYBR Green Assay:Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines Article Snippet: Using a 96-well plate, a total of 9.6 ml PCR reaction was set up with 25 fmol template along with Platinum Taq supermix, 4.8 nmol of each primer, and 0.5× SYBR Green. .. The PCR product was split into eight reactions with 10 units of Article Title: A FRET-based analysis of SNPs without fluorescent probes Article Snippet: We obtained ddNTPs labeled with Cy5 from Amersham Biosciences, ddNTPs labeled with Rox from Perkin-Elmer, and SYBR Green I from Molecular Probes. .. We purchased E.coli exonuclease I and Incubation:Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines Article Snippet: .. The PCR product was split into eight reactions with 10 units of Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells Article Snippet: The control samples were subsequently incubated with 2 µL of 0.1 mg/mL Proteinase K to remove all proteins attached to the DNA. .. Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface Article Snippet: Reactive aptamers against growth factors were dissociated from the cells by incubation with 10 mM dithiothreitol for 10 min at 25°C, which would reduce disulfide bonds between two subunits of agglutinin, thereby releasing Aga2 and the bound aptamers from the cells. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq Article Snippet: The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Article Title: Light-regulated gene repositioning in Arabidopsis Article Snippet: After two washes in PBS, the slides were incubated with a DNA digestion solution containing 0.5 U μl−1 of restriction enzyme (New England Biolabs, Ipswich, MA) at 37 °C for 30 min; the specific restriction enzymes used for each target gene are listed in . .. After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex Article Snippet: Second, the strand with the phosphorylated 5′-end was digested with Expressing:Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface Article Snippet: Procedure for yeast cell-SELEX An initial library of 1015 DNA aptamers was screened against yeast cells expressing target proteins. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by Modification:Article Title: A method for high‐throughput production of sequence‐verified DNA libraries and strain collections Article Snippet: The product of this reaction was treated with Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), Derivative Assay:Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences Article Snippet: The common spacer for all probes had a sequence devoid of MlyI and BsaI sites derived from bacteriophage lambda with two amplification primers that are used in the multiplex PCR. .. The digested PCR product was treated with 0.1 units High Performance Liquid Chromatography:Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), Conjugation Assay:Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by Flow Cytometry:Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences Article Snippet: The digested PCR product was treated with 0.1 units Ligation:Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae Article Snippet: ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with Article Title: Light-regulated gene repositioning in Arabidopsis Article Snippet: After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ Synthesized:Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), Generated:Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae Article Snippet: Recombineering substrates were generated using pK18mobsacB , ΔPSPTO1203::neo or pZB111 as PCR templates. .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: Donor DNA templates were generated by digesting pAAV-P2A-EGFP (sequence below) with XbaI and EcoRI (New England Biolabs) and inserting three gblocks (LHA, P2A-EGFP or P2A-CreERT2, RHA, purchased from IDT, sequences below) using Gibson cloning (HIFI assembly mix, New England Biolabs) according to the manufacturers’ protocols. .. Sequencing:Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae Article Snippet: ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences Article Snippet: This spacer was used as the template for PCR amplification using a primer that had a BsaI site and one target-specific sequence, and a second primer that had an MlyI site and the other target-specific sequence. .. The digested PCR product was treated with 0.1 units Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq Article Snippet: Paragraph title: RNA-seq library construction and sequencing ... The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Article Title: SeqSharp Article Snippet: .. The single-step amplification/sequencing products were treated with 2.5 U of Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: Donor DNA templates were generated by digesting pAAV-P2A-EGFP (sequence below) with XbaI and EcoRI (New England Biolabs) and inserting three gblocks (LHA, P2A-EGFP or P2A-CreERT2, RHA, purchased from IDT, sequences below) using Gibson cloning (HIFI assembly mix, New England Biolabs) according to the manufacturers’ protocols. .. Article Title: SeqSharp Article Snippet: .. After the sequencing reaction was completed, we treated the products with 2.5 U of Article Title: Light-regulated gene repositioning in Arabidopsis Article Snippet: .. After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ RNA Sequencing Assay:Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq Article Snippet: Paragraph title: RNA-seq library construction and sequencing ... The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Avidin-Biotin Assay:Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells Article Snippet: Avidin, streptavidin, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), N -hydroxysulfosuccinimide sodium salt (sulfo-NHS) and 7-nitroindole-2-carboxylic acid were purchased from Sigma Chemical Co. (St. Louis. .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), Labeling:Article Title: A FRET-based analysis of SNPs without fluorescent probes Article Snippet: We obtained ddNTPs labeled with Cy5 from Amersham Biosciences, ddNTPs labeled with Rox from Perkin-Elmer, and SYBR Green I from Molecular Probes. .. We purchased E.coli exonuclease I and Size-exclusion Chromatography:Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines Article Snippet: The PCR program was: 95°C for 5 min, 15 cycles of 95°C 30 sec / 58°C 1 min / 72°C 1 min, and finally 72°C for 5 min. .. The PCR product was split into eight reactions with 10 units of ALP Assay:Article Title: An Allosteric-Probe for Detection of Alkaline Phosphatase Activity and Its Application in Immunoassay Article Snippet: Materials Alkaline phosphatase (ALP, 1000 U/mL) and p-nitrophenyl phosphate (PNPP) were purchased from Thermo Fisher Scientific Inc (Shanghai, China). .. CRISPR:Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: Paragraph title: Generation of transgenic animals using CRISPR/Cas9 ... IA:Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae Article Snippet: ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro . .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with Purification:Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines Article Snippet: .. The PCR product was split into eight reactions with 10 units of Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells Article Snippet: All samples, including the one treated with Proteinase K, were purified with RNaesy mini elute clean-up kit. .. Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences Article Snippet: The purified PCR product was digested with BsaI (New England Biolabs) in buffer 3 (100 mM NaCl; 50 mM Tris·HCl, pH 7.9; 10 mM MgCl2 ; 1 mM DTT) at 50°C, followed by digestion with five units of shrimp alkaline phosphatase (USB Corporation) at 37°C. .. The digested PCR product was treated with 0.1 units Article Title: SeqSharp Article Snippet: .. The single-step amplification/sequencing products were treated with 2.5 U of Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: The PCR product was highly purified with the Qiagen PCR purification kit and subject to digestion of the antisense strand. .. Article Title: SeqSharp Article Snippet: After the sequencing reaction was completed, we treated the products with 2.5 U of Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex Article Snippet: The PCR product was fractionated on a 1% agarose gel in TAE buffer, and was purified as described above. .. Second, the strand with the phosphorylated 5′-end was digested with Plasmid Preparation:Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: For CreERT2, the highly purified dsDNA plasmid was directly used as donor DNA in injections. .. Multiplex Assay:Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences Article Snippet: The common spacer for all probes had a sequence devoid of MlyI and BsaI sites derived from bacteriophage lambda with two amplification primers that are used in the multiplex PCR. .. The digested PCR product was treated with 0.1 units Agarose Gel Electrophoresis:Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells Article Snippet: Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: Article Title: SeqSharp Article Snippet: Amplification of the 16S gene fragment was confirmed by agarose gel electrophoresis, and 2 μl of the PCR product was used in a 10-μl sequencing reaction using ABI BigDye (version 3.1) reagent (Applied Biosystems). .. After the sequencing reaction was completed, we treated the products with 2.5 U of Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex Article Snippet: The PCR product was fractionated on a 1% agarose gel in TAE buffer, and was purified as described above. .. Second, the strand with the phosphorylated 5′-end was digested with In Vitro:Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae Article Snippet: .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with Transgenic Assay:Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: Paragraph title: Generation of transgenic animals using CRISPR/Cas9 ... Ethanol Precipitation:Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by Next-Generation Sequencing:Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by CCK-8 Assay:Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), Produced:Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia Article Snippet: For EGFP, single strand DNA (ssDNA) was produced using PCR with forward primers for left homology arms between 55 and 300 bp (5′-A*G*C* AACTGGTCCTCCTGAAA -3′ and 5′- CAAAGCCTGTGAAGGGTGGG -3′, respectively; * denoting phosphorothioate) and a reverse primer for a 55 bp right homology arm (5′- CAAAGAGGTGACCCTCAAGG -3′, with 5′ phosphorylation for lambda digest of antisense strand). .. Concentration Assay:Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells Article Snippet: Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL Article Title: SeqSharp Article Snippet: Extra dNTPs to a final concentration of 125 μmol/L was added to favor amplification over chain termination during initial temperature cycles. .. The single-step amplification/sequencing products were treated with 2.5 U of Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex Article Snippet: Second, the strand with the phosphorylated 5′-end was digested with Cell Counting:Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), High Throughput Screening Assay:Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by Fluorescence In Situ Hybridization:Article Title: Light-regulated gene repositioning in Arabidopsis Article Snippet: Paragraph title: Padlock FISH ... After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ |