lambda exonuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Lambda Exonuclease
    Description:
    Lambda Exonuclease 5 000 units
    Catalog Number:
    m0262l
    Price:
    276
    Size:
    5 000 units
    Category:
    Exonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs lambda exonuclease
    Lambda Exonuclease
    Lambda Exonuclease 5 000 units
    https://www.bioz.com/result/lambda exonuclease/product/New England Biolabs
    Average 90 stars, based on 110 article reviews
    Price from $9.99 to $1999.99
    lambda exonuclease - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints"

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    Journal: Nature biotechnology

    doi: 10.1038/nbt.3121

    Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.
    Figure Legend Snippet: Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.

    Techniques Used: Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Amplification, Functional Assay, Ligation, Purification, Polymerase Chain Reaction, Sequencing, Genomic Sequencing, Generated, In Vitro, Footprinting, In Vivo

    Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.
    Figure Legend Snippet: Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.

    Techniques Used: In Vivo, Chromatin Immunoprecipitation, Variant Assay, Binding Assay

    Related Articles

    Clone Assay:

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: Donor DNA templates were generated by digesting pAAV-P2A-EGFP (sequence below) with XbaI and EcoRI (New England Biolabs) and inserting three gblocks (LHA, P2A-EGFP or P2A-CreERT2, RHA, purchased from IDT, sequences below) using Gibson cloning (HIFI assembly mix, New England Biolabs) according to the manufacturers’ protocols. .. Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    Amplification:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: This spacer was used as the template for PCR amplification using a primer that had a BsaI site and one target-specific sequence, and a second primer that had an MlyI site and the other target-specific sequence. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq
    Article Snippet: The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Lambda Exonuclease (NEB) for 30 min at 37°C. .. The treated cDNA was then amplified using KAPA Hifi Readymix 2× (KAPA) and incubated at 95°C for 3 min, followed by 15 cycles (GM12878) or 27 cycles (single B cells) of (98°C for 20 s, 67°C for 15 s, 72°C for 4 min), with a final extenssion at 72°C for 5 min. For our Tn5Prime method, the cDNA amplification requires both the ISPCR primer and a Nextera A Index primer.

    Article Title: SeqSharp
    Article Snippet: .. The single-step amplification/sequencing products were treated with 2.5 U of lambda exonuclease (New England Biolabs) for 30 minutes at 37°C and purified with X-terminator kit (Applied Biosystems) before loading on to Applied Biosystems' 3130 Genetic Analyzer as described for 16S sequencing. .. For sequencing 16S ribosomal RNA (rRNA) gene, 16SF and 16SR primers were used instead of spa primers.

    Article Title: SeqSharp
    Article Snippet: Paragraph title: SeqSharp for Sequencing PCR Amplified DNA Fragment ... After the sequencing reaction was completed, we treated the products with 2.5 U of lambda exonuclease (New England Biolabs, Ipswich, MA) at 37°C for 30 minutes.

    Article Title: Light-regulated gene repositioning in Arabidopsis
    Article Snippet: After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ Lambda exonuclease (New England Biolabs) in Lambda exonuclease buffer containing 0.2 μg μl−1 BSA and 10% glycerol at 37 °C for 30 min to generate a single-stranded target sequence ( ). .. After one wash in buffer B (2 × saline-sodium citrate buffer and 0.05% Tween-20), the slides were incubated in 1 U μl−1 of phi29 DNA polymerase (Fermentas, Burlington, Canada) in 1 × phi29 buffer supplemented with 0.25 mM dNTPs, 0.2 μg μl−1 BSA and 10% glycerol at 37 °C for 2 h. In this step, the padlock probe sequence was amplified by rolling-circle amplification ( ).

    Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex
    Article Snippet: First, a DNA fragment was amplified from pGsat4 by PCR using two primers, a 25mer forward primer (AGTAT ATATG AGTAA ACTTG GTCTG) and a 25mer reverse primer (CTCAT TTTTT AACCA ATAGG CCGAA). .. Second, the strand with the phosphorylated 5′-end was digested with lambda exonuclease (New England Biolabs) to produce the linear ssDNA.

    Polymerase Chain Reaction:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: .. The PCR product was split into eight reactions with 10 units of lambda exonuclease (NEB) in 1× lambda exonuclease reaction buffer and incubated at 37°C 45 min then 75°C 15 min. After being purified with QiaQuick coloumns the ssDNA was quantified with Nanodrop to be 33 ng/µl in 200 µl total. ..

    Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae
    Article Snippet: .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro . .. Note, lambda Exo was not used to pre-digest any other substrates described in this manuscript. pZB111 was constructed by ligation of Bsu36I digested pACYC184 to the Bsu36I digested PCR product of oSWC4347/4349 using pK18mobsacB as template.

    Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells
    Article Snippet: Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL lambda exonuclease (5 U/µL, New England Biolabs) in a final volume of 20 µL. .. Concentration of the TP-capped oriLR-p2-p3 DNA was estimated on an agarose gel post-stained with SybrGold (Thermo Fisher Scientific), comparing the band volume of TP-capped DNA to a known concentration of oriLR-p2-p3 PCR product loaded on the same gel (Supplementary Fig. ).

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer. .. The probes were phosphorylated with 5 units of T4 polynucleotide kinase (NEB) in 50 mM Tris·HCl, pH7.9; 10 mM MgCl2 . dHPLC analysis was used to monitor the efficiency of lambda exonuclease digestion.

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq
    Article Snippet: The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Lambda Exonuclease (NEB) for 30 min at 37°C. .. The resulting polymerase chain reaction (PCR) product was then treated with our Tn5 enzyme ( ) custom loaded with either Tn5ME-A/R and Tn5ME-B/R (Smart-seq2) or Tn5ME-B/R adapters only (Tn5Prime).

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: The PCR product was highly purified with the Qiagen PCR purification kit and subject to digestion of the antisense strand. .. Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    Article Title: SeqSharp
    Article Snippet: Paragraph title: SeqSharp for Sequencing PCR Amplified DNA Fragment ... After the sequencing reaction was completed, we treated the products with 2.5 U of lambda exonuclease (New England Biolabs, Ipswich, MA) at 37°C for 30 minutes.

    Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex
    Article Snippet: The PCR product was fractionated on a 1% agarose gel in TAE buffer, and was purified as described above. .. Second, the strand with the phosphorylated 5′-end was digested with lambda exonuclease (New England Biolabs) to produce the linear ssDNA.

    Construct:

    Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae
    Article Snippet: .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro . .. Note, lambda Exo was not used to pre-digest any other substrates described in this manuscript. pZB111 was constructed by ligation of Bsu36I digested pACYC184 to the Bsu36I digested PCR product of oSWC4347/4349 using pK18mobsacB as template.

    SYBR Green Assay:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: Using a 96-well plate, a total of 9.6 ml PCR reaction was set up with 25 fmol template along with Platinum Taq supermix, 4.8 nmol of each primer, and 0.5× SYBR Green. .. The PCR product was split into eight reactions with 10 units of lambda exonuclease (NEB) in 1× lambda exonuclease reaction buffer and incubated at 37°C 45 min then 75°C 15 min. After being purified with QiaQuick coloumns the ssDNA was quantified with Nanodrop to be 33 ng/µl in 200 µl total.

    Article Title: A FRET-based analysis of SNPs without fluorescent probes
    Article Snippet: We obtained ddNTPs labeled with Cy5 from Amersham Biosciences, ddNTPs labeled with Rox from Perkin-Elmer, and SYBR Green I from Molecular Probes. .. We purchased E.coli exonuclease I and lambda exonuclease from New England Biolabs.

    Incubation:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: .. The PCR product was split into eight reactions with 10 units of lambda exonuclease (NEB) in 1× lambda exonuclease reaction buffer and incubated at 37°C 45 min then 75°C 15 min. After being purified with QiaQuick coloumns the ssDNA was quantified with Nanodrop to be 33 ng/µl in 200 µl total. ..

    Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells
    Article Snippet: The control samples were subsequently incubated with 2 µL of 0.1 mg/mL Proteinase K to remove all proteins attached to the DNA. .. Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL lambda exonuclease (5 U/µL, New England Biolabs) in a final volume of 20 µL.

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: Reactive aptamers against growth factors were dissociated from the cells by incubation with 10 mM dithiothreitol for 10 min at 25°C, which would reduce disulfide bonds between two subunits of agglutinin, thereby releasing Aga2 and the bound aptamers from the cells. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq
    Article Snippet: The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Lambda Exonuclease (NEB) for 30 min at 37°C. .. The treated cDNA was then amplified using KAPA Hifi Readymix 2× (KAPA) and incubated at 95°C for 3 min, followed by 15 cycles (GM12878) or 27 cycles (single B cells) of (98°C for 20 s, 67°C for 15 s, 72°C for 4 min), with a final extenssion at 72°C for 5 min. For our Tn5Prime method, the cDNA amplification requires both the ISPCR primer and a Nextera A Index primer.

    Article Title: Light-regulated gene repositioning in Arabidopsis
    Article Snippet: After two washes in PBS, the slides were incubated with a DNA digestion solution containing 0.5 U μl−1 of restriction enzyme (New England Biolabs, Ipswich, MA) at 37 °C for 30 min; the specific restriction enzymes used for each target gene are listed in . .. After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ Lambda exonuclease (New England Biolabs) in Lambda exonuclease buffer containing 0.2 μg μl−1 BSA and 10% glycerol at 37 °C for 30 min to generate a single-stranded target sequence ( ).

    Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex
    Article Snippet: Second, the strand with the phosphorylated 5′-end was digested with lambda exonuclease (New England Biolabs) to produce the linear ssDNA. .. The reaction mixture, containing 67 mM glycine-KOH (pH 9.4), 2.5 mM MgCl2 , 50 µg/ml BSA, 30 µM DNA fragment and 100 U/ml lambda exonuclease, was incubated at 37°C for 2 h. When the DNA concentration was higher than 30 µM, the digestion by the lambda exonuclease was incomplete.

    Expressing:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: Procedure for yeast cell-SELEX An initial library of 1015 DNA aptamers was screened against yeast cells expressing target proteins. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Modification:

    Article Title: A method for high‐throughput production of sequence‐verified DNA libraries and strain collections
    Article Snippet: The product of this reaction was treated with Lambda exonuclease (New England Biolabs) for 15 min at 37°C to generate the desired single‐stranded 105‐mer DNA molecules. .. Following enzymatic modification of the DNA, removal of the common priming sites was confirmed using a Bioanalyzer (Agilent).

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA). .. Hoechst 33342, propidium iodide (PI) and cell-counting kit (CCK-8) were all obtained from Dojindo Laboratories (Kumamoto, Japan). tert -Butyl hydroperoxide (TBHP) were purchased from Aladdin Industrial Inc. Dulbecco's modified Eagle's medium (DMEM) and Dulbecco's phosphate buffer solution without calcium and magnesium (DPBS) were purchased from Corning (Manassas, VA, USA).

    Derivative Assay:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The common spacer for all probes had a sequence devoid of MlyI and BsaI sites derived from bacteriophage lambda with two amplification primers that are used in the multiplex PCR. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    High Performance Liquid Chromatography:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA).

    Conjugation Assay:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C. .. To avoid chemical conjugation of aptamers with fluorescent dyes, we used phycoerythrin (PE)-conjugated streptavidin complexed with biotinylated oligonucleotides (which we call ‘capturing oligonucleotides’) complementary to the constant region of the aptamers.

    Flow Cytometry:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer. .. PCR products were eluted from the column using an acetonitrile gradient in a 0.1 M triethylamineacetate buffer (TEAA), pH 7, at a constant flow rate of 0.9 ml/min.

    Ligation:

    Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae
    Article Snippet: ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro . .. Note, lambda Exo was not used to pre-digest any other substrates described in this manuscript. pZB111 was constructed by ligation of Bsu36I digested pACYC184 to the Bsu36I digested PCR product of oSWC4347/4349 using pK18mobsacB as template.

    Article Title: Light-regulated gene repositioning in Arabidopsis
    Article Snippet: After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ Lambda exonuclease (New England Biolabs) in Lambda exonuclease buffer containing 0.2 μg μl−1 BSA and 10% glycerol at 37 °C for 30 min to generate a single-stranded target sequence ( ). .. The ligation reaction was carried out at 37 °C for 30 min, which allowed the padlock probes to anneal to the target sequence and to circularize ( ).

    Synthesized:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA).

    Generated:

    Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae
    Article Snippet: Recombineering substrates were generated using pK18mobsacB , ΔPSPTO1203::neo or pZB111 as PCR templates. .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro .

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: Donor DNA templates were generated by digesting pAAV-P2A-EGFP (sequence below) with XbaI and EcoRI (New England Biolabs) and inserting three gblocks (LHA, P2A-EGFP or P2A-CreERT2, RHA, purchased from IDT, sequences below) using Gibson cloning (HIFI assembly mix, New England Biolabs) according to the manufacturers’ protocols. .. Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    Sequencing:

    Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae
    Article Snippet: ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro . .. All constructs and strains used as templates to produce recombineering substrates were confirmed by restriction digestion and/or sequencing.

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: This spacer was used as the template for PCR amplification using a primer that had a BsaI site and one target-specific sequence, and a second primer that had an MlyI site and the other target-specific sequence. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq
    Article Snippet: Paragraph title: RNA-seq library construction and sequencing ... The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Lambda Exonuclease (NEB) for 30 min at 37°C.

    Article Title: SeqSharp
    Article Snippet: .. The single-step amplification/sequencing products were treated with 2.5 U of lambda exonuclease (New England Biolabs) for 30 minutes at 37°C and purified with X-terminator kit (Applied Biosystems) before loading on to Applied Biosystems' 3130 Genetic Analyzer as described for 16S sequencing. .. For sequencing 16S ribosomal RNA (rRNA) gene, 16SF and 16SR primers were used instead of spa primers.

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: Donor DNA templates were generated by digesting pAAV-P2A-EGFP (sequence below) with XbaI and EcoRI (New England Biolabs) and inserting three gblocks (LHA, P2A-EGFP or P2A-CreERT2, RHA, purchased from IDT, sequences below) using Gibson cloning (HIFI assembly mix, New England Biolabs) according to the manufacturers’ protocols. .. Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    Article Title: SeqSharp
    Article Snippet: .. After the sequencing reaction was completed, we treated the products with 2.5 U of lambda exonuclease (New England Biolabs, Ipswich, MA) at 37°C for 30 minutes. .. BigDye reaction products were purified by using the X-terminator kit (Applied Biosystems) before loading onto Applied Biosystems' 3130 Genetic Analyzer.

    Article Title: Light-regulated gene repositioning in Arabidopsis
    Article Snippet: .. After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ Lambda exonuclease (New England Biolabs) in Lambda exonuclease buffer containing 0.2 μg μl−1 BSA and 10% glycerol at 37 °C for 30 min to generate a single-stranded target sequence ( ). .. Then, the slides were briefly washed twice in buffer A and incubated with T4 ligase buffer supplemented with 0.1 μM gene-specific padlock probes , 0.1 U μl−1 T4 ligase (New England Biolabs), 1 mM ATP, 250 mM NaCl and 0.2 μg μl−1 BSA.

    RNA Sequencing Assay:

    Article Title: Tn5Prime, a Tn5 based 5′ capture method for single cell RNA-seq
    Article Snippet: Paragraph title: RNA-seq library construction and sequencing ... The resulting cDNA was treated with 1 µl of 1:10 dilutions of RNAse A (Thermo) and Lambda Exonuclease (NEB) for 30 min at 37°C.

    Avidin-Biotin Assay:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Avidin, streptavidin, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), N -hydroxysulfosuccinimide sodium salt (sulfo-NHS) and 7-nitroindole-2-carboxylic acid were purchased from Sigma Chemical Co. (St. Louis. .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA).

    Labeling:

    Article Title: A FRET-based analysis of SNPs without fluorescent probes
    Article Snippet: We obtained ddNTPs labeled with Cy5 from Amersham Biosciences, ddNTPs labeled with Rox from Perkin-Elmer, and SYBR Green I from Molecular Probes. .. We purchased E.coli exonuclease I and lambda exonuclease from New England Biolabs.

    Size-exclusion Chromatography:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: The PCR program was: 95°C for 5 min, 15 cycles of 95°C 30 sec / 58°C 1 min / 72°C 1 min, and finally 72°C for 5 min. .. The PCR product was split into eight reactions with 10 units of lambda exonuclease (NEB) in 1× lambda exonuclease reaction buffer and incubated at 37°C 45 min then 75°C 15 min. After being purified with QiaQuick coloumns the ssDNA was quantified with Nanodrop to be 33 ng/µl in 200 µl total.

    ALP Assay:

    Article Title: An Allosteric-Probe for Detection of Alkaline Phosphatase Activity and Its Application in Immunoassay
    Article Snippet: Materials Alkaline phosphatase (ALP, 1000 U/mL) and p-nitrophenyl phosphate (PNPP) were purchased from Thermo Fisher Scientific Inc (Shanghai, China). .. Lambda exonuclease (λ exo, 5000 U/mL) and T4 ligase were obtained from New England Biolabs (Ipswich, MA, USA).

    CRISPR:

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: Paragraph title: Generation of transgenic animals using CRISPR/Cas9 ... Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    IA:

    Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae
    Article Snippet: ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro . .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro .

    Purification:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: .. The PCR product was split into eight reactions with 10 units of lambda exonuclease (NEB) in 1× lambda exonuclease reaction buffer and incubated at 37°C 45 min then 75°C 15 min. After being purified with QiaQuick coloumns the ssDNA was quantified with Nanodrop to be 33 ng/µl in 200 µl total. ..

    Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells
    Article Snippet: All samples, including the one treated with Proteinase K, were purified with RNaesy mini elute clean-up kit. .. Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL lambda exonuclease (5 U/µL, New England Biolabs) in a final volume of 20 µL.

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The purified PCR product was digested with BsaI (New England Biolabs) in buffer 3 (100 mM NaCl; 50 mM Tris·HCl, pH 7.9; 10 mM MgCl2 ; 1 mM DTT) at 50°C, followed by digestion with five units of shrimp alkaline phosphatase (USB Corporation) at 37°C. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    Article Title: SeqSharp
    Article Snippet: .. The single-step amplification/sequencing products were treated with 2.5 U of lambda exonuclease (New England Biolabs) for 30 minutes at 37°C and purified with X-terminator kit (Applied Biosystems) before loading on to Applied Biosystems' 3130 Genetic Analyzer as described for 16S sequencing. .. For sequencing 16S ribosomal RNA (rRNA) gene, 16SF and 16SR primers were used instead of spa primers.

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: The PCR product was highly purified with the Qiagen PCR purification kit and subject to digestion of the antisense strand. .. Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    Article Title: SeqSharp
    Article Snippet: After the sequencing reaction was completed, we treated the products with 2.5 U of lambda exonuclease (New England Biolabs, Ipswich, MA) at 37°C for 30 minutes. .. BigDye reaction products were purified by using the X-terminator kit (Applied Biosystems) before loading onto Applied Biosystems' 3130 Genetic Analyzer.

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA).

    Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex
    Article Snippet: The PCR product was fractionated on a 1% agarose gel in TAE buffer, and was purified as described above. .. Second, the strand with the phosphorylated 5′-end was digested with lambda exonuclease (New England Biolabs) to produce the linear ssDNA.

    Plasmid Preparation:

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: For CreERT2, the highly purified dsDNA plasmid was directly used as donor DNA in injections. .. Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    Multiplex Assay:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The common spacer for all probes had a sequence devoid of MlyI and BsaI sites derived from bacteriophage lambda with two amplification primers that are used in the multiplex PCR. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    Agarose Gel Electrophoresis:

    Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells
    Article Snippet: Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL lambda exonuclease (5 U/µL, New England Biolabs) in a final volume of 20 µL. .. Concentration of the TP-capped oriLR-p2-p3 DNA was estimated on an agarose gel post-stained with SybrGold (Thermo Fisher Scientific), comparing the band volume of TP-capped DNA to a known concentration of oriLR-p2-p3 PCR product loaded on the same gel (Supplementary Fig. ).

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min. .. Complete digestion of dsDNA was confirmed by agarose gel electrophoresis and Sanger sequencing with sense- and antisense-binding primers.

    Article Title: SeqSharp
    Article Snippet: Amplification of the 16S gene fragment was confirmed by agarose gel electrophoresis, and 2 μl of the PCR product was used in a 10-μl sequencing reaction using ABI BigDye (version 3.1) reagent (Applied Biosystems). .. After the sequencing reaction was completed, we treated the products with 2.5 U of lambda exonuclease (New England Biolabs, Ipswich, MA) at 37°C for 30 minutes.

    Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex
    Article Snippet: The PCR product was fractionated on a 1% agarose gel in TAE buffer, and was purified as described above. .. Second, the strand with the phosphorylated 5′-end was digested with lambda exonuclease (New England Biolabs) to produce the linear ssDNA.

    In Vitro:

    Article Title: Substrate and Target Sequence Length Influence RecTEPsy Recombineering Efficiency in Pseudomonas syringae
    Article Snippet: .. ΔPSPTO1203::neo was constructed by RecTEPsy recombineering using 1 µg of PCR product (oSWC2648/2649 with pK18mobsacB as template) that had been digested with lambda exonuclease (NEB, Ipswich, MA) in vitro . .. Note, lambda Exo was not used to pre-digest any other substrates described in this manuscript. pZB111 was constructed by ligation of Bsu36I digested pACYC184 to the Bsu36I digested PCR product of oSWC4347/4349 using pK18mobsacB as template.

    Transgenic Assay:

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: Paragraph title: Generation of transgenic animals using CRISPR/Cas9 ... Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    Ethanol Precipitation:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Next-Generation Sequencing:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C. .. After 4–10 rounds of SELEX, the aptamer pools were subject to high-throughput, next-generation sequencing for bioinformatics analysis (see below).

    CCK-8 Assay:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA). .. Hoechst 33342, propidium iodide (PI) and cell-counting kit (CCK-8) were all obtained from Dojindo Laboratories (Kumamoto, Japan). tert -Butyl hydroperoxide (TBHP) were purchased from Aladdin Industrial Inc. Dulbecco's modified Eagle's medium (DMEM) and Dulbecco's phosphate buffer solution without calcium and magnesium (DPBS) were purchased from Corning (Manassas, VA, USA).

    Produced:

    Article Title: Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia
    Article Snippet: For EGFP, single strand DNA (ssDNA) was produced using PCR with forward primers for left homology arms between 55 and 300 bp (5′-A*G*C* AACTGGTCCTCCTGAAA -3′ and 5′- CAAAGCCTGTGAAGGGTGGG -3′, respectively; * denoting phosphorothioate) and a reverse primer for a 55 bp right homology arm (5′- CAAAGAGGTGACCCTCAAGG -3′, with 5′ phosphorylation for lambda digest of antisense strand). .. Lambda exonuclease (New England Biolabs) was used to digest 20 μg of dsDNA at 37°C for 60 min.

    Concentration Assay:

    Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells
    Article Snippet: Uncapped DNA was removed by lambda exonuclease treatment by adding 2 µL 10× lambda exonuclease buffer and 1 µL of 5 U/µL lambda exonuclease (5 U/µL, New England Biolabs) in a final volume of 20 µL. .. Concentration of the TP-capped oriLR-p2-p3 DNA was estimated on an agarose gel post-stained with SybrGold (Thermo Fisher Scientific), comparing the band volume of TP-capped DNA to a known concentration of oriLR-p2-p3 PCR product loaded on the same gel (Supplementary Fig. ).

    Article Title: SeqSharp
    Article Snippet: Extra dNTPs to a final concentration of 125 μmol/L was added to favor amplification over chain termination during initial temperature cycles. .. The single-step amplification/sequencing products were treated with 2.5 U of lambda exonuclease (New England Biolabs) for 30 minutes at 37°C and purified with X-terminator kit (Applied Biosystems) before loading on to Applied Biosystems' 3130 Genetic Analyzer as described for 16S sequencing.

    Article Title: Preferential binding to branched DNA strands and strand-annealing activity of the human Rad51B, Rad51C, Rad51D and Xrcc2 protein complex
    Article Snippet: Second, the strand with the phosphorylated 5′-end was digested with lambda exonuclease (New England Biolabs) to produce the linear ssDNA. .. The reaction mixture, containing 67 mM glycine-KOH (pH 9.4), 2.5 mM MgCl2 , 50 µg/ml BSA, 30 µM DNA fragment and 100 U/ml lambda exonuclease, was incubated at 37°C for 2 h. When the DNA concentration was higher than 30 µM, the digestion by the lambda exonuclease was incomplete.

    Cell Counting:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA). .. Hoechst 33342, propidium iodide (PI) and cell-counting kit (CCK-8) were all obtained from Dojindo Laboratories (Kumamoto, Japan). tert -Butyl hydroperoxide (TBHP) were purchased from Aladdin Industrial Inc. Dulbecco's modified Eagle's medium (DMEM) and Dulbecco's phosphate buffer solution without calcium and magnesium (DPBS) were purchased from Corning (Manassas, VA, USA).

    High Throughput Screening Assay:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C. .. After 4–10 rounds of SELEX, the aptamer pools were subject to high-throughput, next-generation sequencing for bioinformatics analysis (see below).

    Fluorescence In Situ Hybridization:

    Article Title: Light-regulated gene repositioning in Arabidopsis
    Article Snippet: Paragraph title: Padlock FISH ... After two washes in buffer A (100 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.05% Tween-20), the slides were treated with 0.2 U μl−1 of 5′–3′ Lambda exonuclease (New England Biolabs) in Lambda exonuclease buffer containing 0.2 μg μl−1 BSA and 10% glycerol at 37 °C for 30 min to generate a single-stranded target sequence ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs lambda exonuclease
    Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for <t>lambda</t> exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.
    Lambda Exonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lambda exonuclease/product/New England Biolabs
    Average 90 stars, based on 80 article reviews
    Price from $9.99 to $1999.99
    lambda exonuclease - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.

    Journal: Nature biotechnology

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    doi: 10.1038/nbt.3121

    Figure Lengend Snippet: Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.

    Article Snippet: For lambda exonuclease digestion, each sample was incubated in 0.2 u/μl lambda exonuclease (New England Biolabs, M0262), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEB Lambda exonuclease reaction buffer at 37 °C for 60 min with constant agitation, followed by washing steps as above.

    Techniques: Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Amplification, Functional Assay, Ligation, Purification, Polymerase Chain Reaction, Sequencing, Genomic Sequencing, Generated, In Vitro, Footprinting, In Vivo

    Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.

    Journal: Nature biotechnology

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    doi: 10.1038/nbt.3121

    Figure Lengend Snippet: Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.

    Article Snippet: For lambda exonuclease digestion, each sample was incubated in 0.2 u/μl lambda exonuclease (New England Biolabs, M0262), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEB Lambda exonuclease reaction buffer at 37 °C for 60 min with constant agitation, followed by washing steps as above.

    Techniques: In Vivo, Chromatin Immunoprecipitation, Variant Assay, Binding Assay