lambda exonuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Lambda Exonuclease
    Description:
    Lambda Exonuclease 5 000 units
    Catalog Number:
    m0262l
    Price:
    281
    Size:
    5 000 units
    Category:
    Exonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs lambda exonuclease
    Lambda Exonuclease
    Lambda Exonuclease 5 000 units
    https://www.bioz.com/result/lambda exonuclease/product/New England Biolabs
    Average 99 stars, based on 7112 article reviews
    Price from $9.99 to $1999.99
    lambda exonuclease - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints"

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    Journal: Nature biotechnology

    doi: 10.1038/nbt.3121

    Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.
    Figure Legend Snippet: Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.

    Techniques Used: Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Amplification, Functional Assay, Ligation, Purification, Polymerase Chain Reaction, Sequencing, Genomic Sequencing, Generated, In Vitro, Footprinting, In Vivo

    Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.
    Figure Legend Snippet: Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.

    Techniques Used: In Vivo, Chromatin Immunoprecipitation, Variant Assay, Binding Assay

    2) Product Images from "ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints"

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    Journal: Nature biotechnology

    doi: 10.1038/nbt.3121

    Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.
    Figure Legend Snippet: Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.

    Techniques Used: Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Amplification, Functional Assay, Ligation, Purification, Polymerase Chain Reaction, Sequencing, Genomic Sequencing, Generated, In Vitro, Footprinting, In Vivo

    Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.
    Figure Legend Snippet: Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.

    Techniques Used: In Vivo, Chromatin Immunoprecipitation, Variant Assay, Binding Assay

    3) Product Images from "ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints"

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    Journal: Nature biotechnology

    doi: 10.1038/nbt.3121

    Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.
    Figure Legend Snippet: Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.

    Techniques Used: Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Amplification, Functional Assay, Ligation, Purification, Polymerase Chain Reaction, Sequencing, Genomic Sequencing, Generated, In Vitro, Footprinting, In Vivo

    Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.
    Figure Legend Snippet: Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.

    Techniques Used: In Vivo, Chromatin Immunoprecipitation, Variant Assay, Binding Assay

    4) Product Images from "ExoCET: exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes"

    Article Title: ExoCET: exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx1249

    Concerted action of in vitro assembly and full length RecE/RecT improves the efficiency of direct cloning. ( A ) A schematic diagram illustrating direct cloning of the 14-kb lux gene cluster from Photobacterium phosphoreum ANT-2200. The linear p15A-cm vector and target genomic segment have identical sequences at both ends. ( B ) Longer homology arms increase the cloning efficiency of ExoCET. The linear vector flanked by 25-, 40- or 80-bp homology arms was mixed with genomic DNA and treated with 0.02 U μl −1 T4pol at 25°C for 20 min before annealing and electroporation into arabinose induced Escherichia coli GB05-dir. Error bars, s.d.; n = 3. ( C ) Titration of T4pol amount for ExoCET. The linear vector with 80-bp homology arms and genomic DNA were treated as in (B) except the amount of T4pol was altered as indicated. ( D ) Incubation time of T4pol on cloning efficiency. As for (C) using 0.02 U μl −1 T4pol except the incubation time was altered as indicated. ( E ) Higher copy number of ETgA increases ExoCET cloning efficiency. As for (D) using 1 h and electroporation into arabinose induced E. coli GB05-dir (one copy of ETgA on the chromosome), GB2005 harboring pSC101-BAD-ETgA-tet (approximately five copies of ETgA on pSC101 plasmids) or GB05-dir harboring pSC101-BAD-ETgA-tet (approximately six copies of ETgA ) as indicated. ( F ) ExoCET increases direct cloning efficiency. As for (E) using E. coli GB05-dir harboring pSC101-BAD-ETgA-tet (ExoCET) or omission of T4pol from the in vitro assembly (ETgA) or omission of the arabinose induction of pSC101-BAD-ETgA-tet (T4pol). ( G ) As for (F) except the 53 kb plu2670 gene cluster was directly cloned. Accuracy denotes the success of direct cloning as evaluated by restriction digestions ( Supplementary Figure S4 ). Each experiment was performed in triplicate ( n = 3) and error bars show standard deviation (s.d).
    Figure Legend Snippet: Concerted action of in vitro assembly and full length RecE/RecT improves the efficiency of direct cloning. ( A ) A schematic diagram illustrating direct cloning of the 14-kb lux gene cluster from Photobacterium phosphoreum ANT-2200. The linear p15A-cm vector and target genomic segment have identical sequences at both ends. ( B ) Longer homology arms increase the cloning efficiency of ExoCET. The linear vector flanked by 25-, 40- or 80-bp homology arms was mixed with genomic DNA and treated with 0.02 U μl −1 T4pol at 25°C for 20 min before annealing and electroporation into arabinose induced Escherichia coli GB05-dir. Error bars, s.d.; n = 3. ( C ) Titration of T4pol amount for ExoCET. The linear vector with 80-bp homology arms and genomic DNA were treated as in (B) except the amount of T4pol was altered as indicated. ( D ) Incubation time of T4pol on cloning efficiency. As for (C) using 0.02 U μl −1 T4pol except the incubation time was altered as indicated. ( E ) Higher copy number of ETgA increases ExoCET cloning efficiency. As for (D) using 1 h and electroporation into arabinose induced E. coli GB05-dir (one copy of ETgA on the chromosome), GB2005 harboring pSC101-BAD-ETgA-tet (approximately five copies of ETgA on pSC101 plasmids) or GB05-dir harboring pSC101-BAD-ETgA-tet (approximately six copies of ETgA ) as indicated. ( F ) ExoCET increases direct cloning efficiency. As for (E) using E. coli GB05-dir harboring pSC101-BAD-ETgA-tet (ExoCET) or omission of T4pol from the in vitro assembly (ETgA) or omission of the arabinose induction of pSC101-BAD-ETgA-tet (T4pol). ( G ) As for (F) except the 53 kb plu2670 gene cluster was directly cloned. Accuracy denotes the success of direct cloning as evaluated by restriction digestions ( Supplementary Figure S4 ). Each experiment was performed in triplicate ( n = 3) and error bars show standard deviation (s.d).

    Techniques Used: In Vitro, Clone Assay, Plasmid Preparation, Electroporation, Titration, Incubation, Standard Deviation

    Related Articles

    Amplification:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: This spacer was used as the template for PCR amplification using a primer that had a BsaI site and one target-specific sequence, and a second primer that had an MlyI site and the other target-specific sequence. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    Article Title: Transcription-generated torsional stress destabilizes nucleosomes
    Article Snippet: After ligation of PE barcode adapters, the 5′ strand was digested using 25 U of λ exonuclease (NEB) for 30 minutes at 37°C. .. The resulting 3′ strand was used as template for 10 rounds of primer extension in 1x HiFi Phusion buffer, 0.8 mM dNTP, 2 U Phusion DNA Polymerase (NEB), and 40 nM of P7 extension primer (CAAGCAGAAGACGGCATACGA*G - *denotes phosphorothioate linkage) in the following cycling conditions: 95°C for 3 minutes, 10 rounds of linear amplification (95°C for 1 minute, 57°C for 1 minute, 72°C for 3 minutes), 95°C for 1 minute, hold at 8°C.

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Synthesized:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA).

    Incubation:

    Article Title: The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair
    Article Snippet: .. The substrates were then incubated with lambda exonuclease (0.025 unit/μl; NEB, MA) or purified recombinant Xenopus Exo1 (0.25ng/μl) at 22ºC. .. To assay the effect of the MRN complexes on the nucleases, the reactions also contained recombinant wild-type or mutant MRN proteins at 16 ng/μl.

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints
    Article Snippet: .. For lambda exonuclease digestion, each sample was incubated in 0.2 u/μl lambda exonuclease (New England Biolabs, M0262), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEB Lambda exonuclease reaction buffer at 37 °C for 60 min with constant agitation, followed by washing steps as above. .. Finally, RecJf exonuclease digestion occurred in 0.75 u/μl RecJf exonuclease (New England Biolabs, M0264), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEBuffer 2 at 37 °C for 60 min with constant agitation.

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: Reactive aptamers against growth factors were dissociated from the cells by incubation with 10 mM dithiothreitol for 10 min at 25°C, which would reduce disulfide bonds between two subunits of agglutinin, thereby releasing Aga2 and the bound aptamers from the cells. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Article Title: The hSNM1 protein is a DNA 5?-exonuclease
    Article Snippet: .. In vitro nuclease assay The assay was similar to an assay for yeast SNM1 ( ) Briefly, 0.5 pmol of radiolabeled substrate was combined with indicated amounts of purified protein (see the figure legends) in 15 μl of 1× Buffer F (50 mM Tris-acetate pH 7.2, 10 mM Mg acetate, 75 mM Potassium acetate, 1 mM DTT) supplemented with 100 μg/ml BSA, and incubated at 37°C for 20 min. For control reactions, 10 units of Rec-Jf or λ-exonuclease (for double-stranded substrate) (New England Biolabs, Ipswich, MA, USA) were used as recommended by the supplier. ..

    Activity Assay:

    Article Title: The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair
    Article Snippet: Paragraph title: Analysis of MRN's effect on Exo1's activity towards 3′ avidin DNA ... The substrates were then incubated with lambda exonuclease (0.025 unit/μl; NEB, MA) or purified recombinant Xenopus Exo1 (0.25ng/μl) at 22ºC.

    Expressing:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: Procedure for yeast cell-SELEX An initial library of 1015 DNA aptamers was screened against yeast cells expressing target proteins. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Modification:

    Article Title: Nucleotidyl transferase assisted DNA labeling with different click chemistries
    Article Snippet: Paragraph title: Internal modification of DNA ... Splinted ligation was performed by first annealing tailed DNA2 with DNA5/6 and DNA7 by heating to 90°C for 30 s and cooling to room temperature for 5 min, adding all other components after this step [final concentrations: 10 μM DNA2, 22.5 μM DNA5/6, 25 μM blocked and phosphorylated DNA7, 50 μM ATP, 50 mM Tris-HCl (pH 7.4), 10 mM MgCl2 , 1.5 U/μl T4 DNA ligase] incubating at 37°C for 4 h and heating to 80°C for 10 min. DNA5/6 and DNA7 were optionally removed from reaction mixtures to obtain pure, ligated/extended ssDNA by adding λ-exonuclease (0.25 U/μl for primer extension or 0.5 U/μl for ligation; New England Biolabs) directly into the reaction mixture and incubating at 37°C for 1 h, followed by 80°C for 10 min. DNA was purified by ethanol precipitation in the presence of 0.3 M sodium acetate (pH 5.5).

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA). .. Hoechst 33342, propidium iodide (PI) and cell-counting kit (CCK-8) were all obtained from Dojindo Laboratories (Kumamoto, Japan). tert -Butyl hydroperoxide (TBHP) were purchased from Aladdin Industrial Inc. Dulbecco's modified Eagle's medium (DMEM) and Dulbecco's phosphate buffer solution without calcium and magnesium (DPBS) were purchased from Corning (Manassas, VA, USA).

    Derivative Assay:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The common spacer for all probes had a sequence devoid of MlyI and BsaI sites derived from bacteriophage lambda with two amplification primers that are used in the multiplex PCR. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    High Performance Liquid Chromatography:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA).

    Conjugation Assay:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C. .. To avoid chemical conjugation of aptamers with fluorescent dyes, we used phycoerythrin (PE)-conjugated streptavidin complexed with biotinylated oligonucleotides (which we call ‘capturing oligonucleotides’) complementary to the constant region of the aptamers.

    Flow Cytometry:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer. .. PCR products were eluted from the column using an acetonitrile gradient in a 0.1 M triethylamineacetate buffer (TEAA), pH 7, at a constant flow rate of 0.9 ml/min.

    Ligation:

    Article Title: Nucleotidyl transferase assisted DNA labeling with different click chemistries
    Article Snippet: .. Splinted ligation was performed by first annealing tailed DNA2 with DNA5/6 and DNA7 by heating to 90°C for 30 s and cooling to room temperature for 5 min, adding all other components after this step [final concentrations: 10 μM DNA2, 22.5 μM DNA5/6, 25 μM blocked and phosphorylated DNA7, 50 μM ATP, 50 mM Tris-HCl (pH 7.4), 10 mM MgCl2 , 1.5 U/μl T4 DNA ligase] incubating at 37°C for 4 h and heating to 80°C for 10 min. DNA5/6 and DNA7 were optionally removed from reaction mixtures to obtain pure, ligated/extended ssDNA by adding λ-exonuclease (0.25 U/μl for primer extension or 0.5 U/μl for ligation; New England Biolabs) directly into the reaction mixture and incubating at 37°C for 1 h, followed by 80°C for 10 min. DNA was purified by ethanol precipitation in the presence of 0.3 M sodium acetate (pH 5.5). .. Purified DNA (ds or ss) was subjected to CuAAC (1 μM DNA, 500 μM biotin azide, 500 μM CuSO4 , 2.5 mM THPTA, 5 mM sodium ascorbate) at 50°C for 2 h and reactions were purified by ethanol precipitation.

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints
    Article Snippet: The adapters were then ligated by incubation in 200 u/μl Quick T4 DNA ligase (New England Biolabs, M2200) and 60 nM/μl Nex_adapter in 50 μl 1x Quick Ligation Reaction Buffer at 25 °C for 60 min, followed by washing steps as above. .. For lambda exonuclease digestion, each sample was incubated in 0.2 u/μl lambda exonuclease (New England Biolabs, M0262), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEB Lambda exonuclease reaction buffer at 37 °C for 60 min with constant agitation, followed by washing steps as above.

    Article Title: Transcription-generated torsional stress destabilizes nucleosomes
    Article Snippet: .. After ligation of PE barcode adapters, the 5′ strand was digested using 25 U of λ exonuclease (NEB) for 30 minutes at 37°C. .. The DNA was purified using Ampure beads, and eluted in 35 μL of H2 O.

    other:

    Article Title: Human Heart Mitochondrial DNA Is Organized in Complex Catenated Networks Containing Abundant Four-way Junctions and Replication Forks *
    Article Snippet: Subsequent treatments with topoisomerase IV (John Innes Enterprises), topoisomerase I, T7 endonuclease I, or λ-exonuclease (all New England Biolabs) used the manufacturers' recommended conditions.

    Article Title: Detection of short repeated genomic sequences on metaphase chromosomes using padlock probes and target primed rolling circle DNA synthesis
    Article Snippet: Lambda exonuclease Exonuclease digestion was performed in a buffer containing 1× lambda exonuclease buffer (NEB), 0.2 μg/μl BSA (NEB) and 1u/μl lambda exonuclease (NEB) for 1 min at 37°C.

    Polymerase Chain Reaction:

    Article Title: Nucleotidyl transferase assisted DNA labeling with different click chemistries
    Article Snippet: Primer extension was performed by performing 5 cycles of a polymerase chain reaction (PCR)-like reaction [5 μM tailed DNA2, 5 μM blocked and phosphorylated DNA5/6, 3 mM MgCl2 , 0.5 mM dNTPs and ∼0.25 U/μl lab-prepared Taq Polymerase in 1x Taq polymerase buffer (Rapidozym); denaturation: 94°C, 1 min, annealing: 60°C, 1 min; extension: 72°C, 1 min]. .. Splinted ligation was performed by first annealing tailed DNA2 with DNA5/6 and DNA7 by heating to 90°C for 30 s and cooling to room temperature for 5 min, adding all other components after this step [final concentrations: 10 μM DNA2, 22.5 μM DNA5/6, 25 μM blocked and phosphorylated DNA7, 50 μM ATP, 50 mM Tris-HCl (pH 7.4), 10 mM MgCl2 , 1.5 U/μl T4 DNA ligase] incubating at 37°C for 4 h and heating to 80°C for 10 min. DNA5/6 and DNA7 were optionally removed from reaction mixtures to obtain pure, ligated/extended ssDNA by adding λ-exonuclease (0.25 U/μl for primer extension or 0.5 U/μl for ligation; New England Biolabs) directly into the reaction mixture and incubating at 37°C for 1 h, followed by 80°C for 10 min. DNA was purified by ethanol precipitation in the presence of 0.3 M sodium acetate (pH 5.5).

    Article Title: MassCode Liquid Arrays as a Tool for Multiplexed High-Throughput Genetic Profiling
    Article Snippet: MassCode hybrid synthesis reaction and clean-up An admixture (25 µl) containing lambda exonuclease (7.5 U, New England BioLabs), Paq 5000 polymerase (1.25 U, Agilent Technologies), MassCode probes (150 nM each), Paq 5000 10× hot start buffer (5.25 µl), and nuclease-free water was added directly into the entire post-PCR sample and placed back on the thermal cycler. .. Lambda exonuclease digested the reverse strand of double stranded PCR amplicons at 37°C for 10 min, lambda exonuclease was inactivated and polymerase activated at 95°C for 2 min, MassCode probes annealed and extended at 69°C for 1 min to form the dual-labeled MassCode hybrids, and hybrid extension was completed at 72°C for 3 min.

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer. .. The probes were phosphorylated with 5 units of T4 polynucleotide kinase (NEB) in 50 mM Tris·HCl, pH7.9; 10 mM MgCl2 . dHPLC analysis was used to monitor the efficiency of lambda exonuclease digestion.

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Recombinant:

    Article Title: The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair
    Article Snippet: .. The substrates were then incubated with lambda exonuclease (0.025 unit/μl; NEB, MA) or purified recombinant Xenopus Exo1 (0.25ng/μl) at 22ºC. .. To assay the effect of the MRN complexes on the nucleases, the reactions also contained recombinant wild-type or mutant MRN proteins at 16 ng/μl.

    Nucleic Acid Electrophoresis:

    Article Title: The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair
    Article Snippet: The substrates were then incubated with lambda exonuclease (0.025 unit/μl; NEB, MA) or purified recombinant Xenopus Exo1 (0.25ng/μl) at 22ºC. .. After the final time point was taken, samples were treated with proteinase K at 1 mg/ml at 22°C for 2 h and then analyzed by 1% TAE-agarose gel electrophoresis.

    Mutagenesis:

    Article Title: The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair
    Article Snippet: The substrates were then incubated with lambda exonuclease (0.025 unit/μl; NEB, MA) or purified recombinant Xenopus Exo1 (0.25ng/μl) at 22ºC. .. To assay the effect of the MRN complexes on the nucleases, the reactions also contained recombinant wild-type or mutant MRN proteins at 16 ng/μl.

    Avidin-Biotin Assay:

    Article Title: The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair
    Article Snippet: Paragraph title: Analysis of MRN's effect on Exo1's activity towards 3′ avidin DNA ... The substrates were then incubated with lambda exonuclease (0.025 unit/μl; NEB, MA) or purified recombinant Xenopus Exo1 (0.25ng/μl) at 22ºC.

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Avidin, streptavidin, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), N -hydroxysulfosuccinimide sodium salt (sulfo-NHS) and 7-nitroindole-2-carboxylic acid were purchased from Sigma Chemical Co. (St. Louis. .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA).

    Labeling:

    Article Title: Nucleotidyl transferase assisted DNA labeling with different click chemistries
    Article Snippet: Internal modification of DNA For internal labeling of DNA, DNA2 was TdT-reacted with 5-E -UTP or N6 -P -ATP (100 μM DNA, 100 μM NTP) at 37°C overnight. .. Splinted ligation was performed by first annealing tailed DNA2 with DNA5/6 and DNA7 by heating to 90°C for 30 s and cooling to room temperature for 5 min, adding all other components after this step [final concentrations: 10 μM DNA2, 22.5 μM DNA5/6, 25 μM blocked and phosphorylated DNA7, 50 μM ATP, 50 mM Tris-HCl (pH 7.4), 10 mM MgCl2 , 1.5 U/μl T4 DNA ligase] incubating at 37°C for 4 h and heating to 80°C for 10 min. DNA5/6 and DNA7 were optionally removed from reaction mixtures to obtain pure, ligated/extended ssDNA by adding λ-exonuclease (0.25 U/μl for primer extension or 0.5 U/μl for ligation; New England Biolabs) directly into the reaction mixture and incubating at 37°C for 1 h, followed by 80°C for 10 min. DNA was purified by ethanol precipitation in the presence of 0.3 M sodium acetate (pH 5.5).

    Purification:

    Article Title: Nucleotidyl transferase assisted DNA labeling with different click chemistries
    Article Snippet: .. Splinted ligation was performed by first annealing tailed DNA2 with DNA5/6 and DNA7 by heating to 90°C for 30 s and cooling to room temperature for 5 min, adding all other components after this step [final concentrations: 10 μM DNA2, 22.5 μM DNA5/6, 25 μM blocked and phosphorylated DNA7, 50 μM ATP, 50 mM Tris-HCl (pH 7.4), 10 mM MgCl2 , 1.5 U/μl T4 DNA ligase] incubating at 37°C for 4 h and heating to 80°C for 10 min. DNA5/6 and DNA7 were optionally removed from reaction mixtures to obtain pure, ligated/extended ssDNA by adding λ-exonuclease (0.25 U/μl for primer extension or 0.5 U/μl for ligation; New England Biolabs) directly into the reaction mixture and incubating at 37°C for 1 h, followed by 80°C for 10 min. DNA was purified by ethanol precipitation in the presence of 0.3 M sodium acetate (pH 5.5). .. Purified DNA (ds or ss) was subjected to CuAAC (1 μM DNA, 500 μM biotin azide, 500 μM CuSO4 , 2.5 mM THPTA, 5 mM sodium ascorbate) at 50°C for 2 h and reactions were purified by ethanol precipitation.

    Article Title: MassCode Liquid Arrays as a Tool for Multiplexed High-Throughput Genetic Profiling
    Article Snippet: MassCode hybrid synthesis reaction and clean-up An admixture (25 µl) containing lambda exonuclease (7.5 U, New England BioLabs), Paq 5000 polymerase (1.25 U, Agilent Technologies), MassCode probes (150 nM each), Paq 5000 10× hot start buffer (5.25 µl), and nuclease-free water was added directly into the entire post-PCR sample and placed back on the thermal cycler. .. Samples were purified using the silica-based StrataPrep or StrataPrep 96 PCR purification kit (Agilent Technologies).

    Article Title: The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair
    Article Snippet: .. The substrates were then incubated with lambda exonuclease (0.025 unit/μl; NEB, MA) or purified recombinant Xenopus Exo1 (0.25ng/μl) at 22ºC. .. To assay the effect of the MRN complexes on the nucleases, the reactions also contained recombinant wild-type or mutant MRN proteins at 16 ng/μl.

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The purified PCR product was digested with BsaI (New England Biolabs) in buffer 3 (100 mM NaCl; 50 mM Tris·HCl, pH 7.9; 10 mM MgCl2 ; 1 mM DTT) at 50°C, followed by digestion with five units of shrimp alkaline phosphatase (USB Corporation) at 37°C. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    Article Title: The hSNM1 protein is a DNA 5?-exonuclease
    Article Snippet: .. In vitro nuclease assay The assay was similar to an assay for yeast SNM1 ( ) Briefly, 0.5 pmol of radiolabeled substrate was combined with indicated amounts of purified protein (see the figure legends) in 15 μl of 1× Buffer F (50 mM Tris-acetate pH 7.2, 10 mM Mg acetate, 75 mM Potassium acetate, 1 mM DTT) supplemented with 100 μg/ml BSA, and incubated at 37°C for 20 min. For control reactions, 10 units of Rec-Jf or λ-exonuclease (for double-stranded substrate) (New England Biolabs, Ipswich, MA, USA) were used as recommended by the supplier. ..

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Chemical reagents and materials The DNA oligonucleotides were synthesized and purified by HPLC (Sangon Biotech Co., China). .. Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA).

    Sequencing:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: This spacer was used as the template for PCR amplification using a primer that had a BsaI site and one target-specific sequence, and a second primer that had an MlyI site and the other target-specific sequence. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    Nuclease Assay:

    Article Title: The hSNM1 protein is a DNA 5?-exonuclease
    Article Snippet: .. In vitro nuclease assay The assay was similar to an assay for yeast SNM1 ( ) Briefly, 0.5 pmol of radiolabeled substrate was combined with indicated amounts of purified protein (see the figure legends) in 15 μl of 1× Buffer F (50 mM Tris-acetate pH 7.2, 10 mM Mg acetate, 75 mM Potassium acetate, 1 mM DTT) supplemented with 100 μg/ml BSA, and incubated at 37°C for 20 min. For control reactions, 10 units of Rec-Jf or λ-exonuclease (for double-stranded substrate) (New England Biolabs, Ipswich, MA, USA) were used as recommended by the supplier. ..

    Chromatin Immunoprecipitation:

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints
    Article Snippet: Paragraph title: ChIP-nexus digestion steps ... For lambda exonuclease digestion, each sample was incubated in 0.2 u/μl lambda exonuclease (New England Biolabs, M0262), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEB Lambda exonuclease reaction buffer at 37 °C for 60 min with constant agitation, followed by washing steps as above.

    Multiplex Assay:

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The common spacer for all probes had a sequence devoid of MlyI and BsaI sites derived from bacteriophage lambda with two amplification primers that are used in the multiplex PCR. .. The digested PCR product was treated with 0.1 units lambda exonuclease (New England Biolabs) at 37°C for 15 min in the same restriction enzyme buffer.

    In Vitro:

    Article Title: The hSNM1 protein is a DNA 5?-exonuclease
    Article Snippet: .. In vitro nuclease assay The assay was similar to an assay for yeast SNM1 ( ) Briefly, 0.5 pmol of radiolabeled substrate was combined with indicated amounts of purified protein (see the figure legends) in 15 μl of 1× Buffer F (50 mM Tris-acetate pH 7.2, 10 mM Mg acetate, 75 mM Potassium acetate, 1 mM DTT) supplemented with 100 μg/ml BSA, and incubated at 37°C for 20 min. For control reactions, 10 units of Rec-Jf or λ-exonuclease (for double-stranded substrate) (New England Biolabs, Ipswich, MA, USA) were used as recommended by the supplier. ..

    Ethanol Precipitation:

    Article Title: Nucleotidyl transferase assisted DNA labeling with different click chemistries
    Article Snippet: .. Splinted ligation was performed by first annealing tailed DNA2 with DNA5/6 and DNA7 by heating to 90°C for 30 s and cooling to room temperature for 5 min, adding all other components after this step [final concentrations: 10 μM DNA2, 22.5 μM DNA5/6, 25 μM blocked and phosphorylated DNA7, 50 μM ATP, 50 mM Tris-HCl (pH 7.4), 10 mM MgCl2 , 1.5 U/μl T4 DNA ligase] incubating at 37°C for 4 h and heating to 80°C for 10 min. DNA5/6 and DNA7 were optionally removed from reaction mixtures to obtain pure, ligated/extended ssDNA by adding λ-exonuclease (0.25 U/μl for primer extension or 0.5 U/μl for ligation; New England Biolabs) directly into the reaction mixture and incubating at 37°C for 1 h, followed by 80°C for 10 min. DNA was purified by ethanol precipitation in the presence of 0.3 M sodium acetate (pH 5.5). .. Purified DNA (ds or ss) was subjected to CuAAC (1 μM DNA, 500 μM biotin azide, 500 μM CuSO4 , 2.5 mM THPTA, 5 mM sodium ascorbate) at 50°C for 2 h and reactions were purified by ethanol precipitation.

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The mixture containing the aptamer complex was then cleaned up by a standard phenol-chloroform extraction and ethanol precipitation protocol , and amplified by PCR. .. The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C.

    Next-Generation Sequencing:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C. .. After 4–10 rounds of SELEX, the aptamer pools were subject to high-throughput, next-generation sequencing for bioinformatics analysis (see below).

    CCK-8 Assay:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA). .. Hoechst 33342, propidium iodide (PI) and cell-counting kit (CCK-8) were all obtained from Dojindo Laboratories (Kumamoto, Japan). tert -Butyl hydroperoxide (TBHP) were purchased from Aladdin Industrial Inc. Dulbecco's modified Eagle's medium (DMEM) and Dulbecco's phosphate buffer solution without calcium and magnesium (DPBS) were purchased from Corning (Manassas, VA, USA).

    Cell Counting:

    Article Title: A specific DNA-nanoprobe for tracking the activities of human apurinic/apyrimidinic endonuclease 1 in living cells
    Article Snippet: Apurinic/apyrimidinic endonuclease I (APE1), uracil–DNA glycocasylase (UDG), deoxyribonuclease I (DNase I), exonuclease III (Exo III), exonuclease I (Exo I), lambda exonuclease (λ exo), T5 exonuclease (T5 Exo), T7 exonuclease (T7 Exo) and their corresponding buffers ( ) were all purchased from New England Biolabs (NEB, USA). .. Hoechst 33342, propidium iodide (PI) and cell-counting kit (CCK-8) were all obtained from Dojindo Laboratories (Kumamoto, Japan). tert -Butyl hydroperoxide (TBHP) were purchased from Aladdin Industrial Inc. Dulbecco's modified Eagle's medium (DMEM) and Dulbecco's phosphate buffer solution without calcium and magnesium (DPBS) were purchased from Corning (Manassas, VA, USA).

    DNA Purification:

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints
    Article Snippet: For lambda exonuclease digestion, each sample was incubated in 0.2 u/μl lambda exonuclease (New England Biolabs, M0262), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEB Lambda exonuclease reaction buffer at 37 °C for 60 min with constant agitation, followed by washing steps as above. .. DNA elution, reverse cross-linking, DNA purification and precipitation were performed as previously described , .

    High Throughput Screening Assay:

    Article Title: Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface
    Article Snippet: The primer for the anti-sense strands to aptamers was phosphorylated at the 5′ end and was digested by lambda exonuclease (NEB) for 30 minutes at 37°C. .. After 4–10 rounds of SELEX, the aptamer pools were subject to high-throughput, next-generation sequencing for bioinformatics analysis (see below).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs lambda exonuclease
    Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for <t>lambda</t> exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.
    Lambda Exonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 88 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lambda exonuclease/product/New England Biolabs
    Average 99 stars, based on 88 article reviews
    Price from $9.99 to $1999.99
    lambda exonuclease - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.

    Journal: Nature biotechnology

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    doi: 10.1038/nbt.3121

    Figure Lengend Snippet: Superior performance of ChIP-nexus in discovering relevant binding footprints for transcription factors (a) Outline of ChIP-nexus 1) The transcription factor of interest (brown) is immunoprecipitated from chromatin fragments with antibodies in the same way as during conventional ChIP-seq experiments. 2) While still bound to the antibodies, the DNA ends are repaired, dA-tailed and then ligated to a special adaptor that contains a pair of sequences for library amplification (arrows indicate the correct orientation for them to be functional), a BamHI site (black dot) for linearization, and a 9-nucleotide barcode containing 5 random bases and 4 fixed bases to remove reads resulting from over-amplification of library DNA. The barcode is part of a 5′ overhang, which reduces adaptor-adaptor ligation. 3) After the adaptor ligation step, the 5′ overhang is filled, copying the random barcode and generating blunt ends for lambda exonuclease digestion. 4) Lambda exonuclease (blue Pacman) digests until it encounters a physical barrier such as a cross-linked protein-DNA complex (‘Do not enter’ sign = ‘stop base’). 5) Single-stranded DNA is eluted and purified. 6) Self-circularization places the barcode next to the ‘stop base’. 7) An oligonucleotide (red arc) is paired with the region around the BamHI site for BamHI digestion (black scissors). 8) The digestion results in re-linearized DNA fragments with suitable Illumina sequences on both ends, ready for PCR library amplification. 9) Using single-end sequencing with the standard Illumina primer, each fragment is sequenced: first the barcode, then the genomic sequence starting with the ‘stop base’. 10) After alignment of the genomic sequences, reads with identical start positions and identical barcodes are removed. The final output is the position, number and strand orientation of the ‘stop’ bases. The frequencies of ‘stop’ bases on the positive strand are shown in red, while those on the negative strand are shown in blue. (b–e) Comparison of conventional ChIP-seq data (extended reads), ChIP-nexus data (raw stop base reads) and data generated using the original ChIP-exo protocol (raw stop base reads). (b) TBP profiles in human K562 cells at the RPS12 promoter. Although ChIP-nexus and ChIP-exo generally agree on TBP binding footprints, ChIP-nexus provides better coverage and richer details than ChIP-exo, which shows signs of over-amplification as large numbers of reads accumulate at a few discreet bases. (c) Dorsal profiles at the D. melanogaster decapentaplegic (dpp) enhancer. Five “Strong” dorsal binding sites (S1–S5) were previously mapped by in vitro DNase footprinting 12 . Note that ChIP-nexus identifies S4 as the only site with significant Dorsal binding in vivo . At the same time, ChIP-exo performed by Peconic did not detect any clear Dorsal footprint within the enhancer, in part due to the low read counts obtained. (d) Dorsal profiles at the rhomboid (rho) NEE enhancer. Four Dorsal binding sites (d1–d4) were previously mapped by in vitro DNase footprinting 14 . Note that ChIP-nexus identifies d3 as the strongest dorsal binding site in vivo , consistent with its close proximity to two Twist binding sites. Again, the original ChIP-exo protocol did not detect any clear Dorsal footprint within the enhancer. (e) Twist profiles at the same rho enhancer. Note that ChIP-nexus shows strong Twist footprints surrounding the two Twist binding sites (t1, t2) 14 . In this case, ChIP-exo performed by Peconic identified a similar Twist footprint. This shows that the Peconic experiments, which were performed with the same chromatin extracts as the Dorsal experiments, worked in principle but were less robust than our ChIP-nexus experiments.

    Article Snippet: For lambda exonuclease digestion, each sample was incubated in 0.2 u/μl lambda exonuclease (New England Biolabs, M0262), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEB Lambda exonuclease reaction buffer at 37 °C for 60 min with constant agitation, followed by washing steps as above.

    Techniques: Chromatin Immunoprecipitation, Binding Assay, Immunoprecipitation, Amplification, Functional Assay, Ligation, Purification, Polymerase Chain Reaction, Sequencing, Genomic Sequencing, Generated, In Vitro, Footprinting, In Vivo

    Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.

    Journal: Nature biotechnology

    Article Title: ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    doi: 10.1038/nbt.3121

    Figure Lengend Snippet: Analysis of the Dorsal, Twist and Max in vivo footprint (a–c) For each factor, the top 200 motifs with the highest ChIP-nexus read counts were selected and are shown in descending order as heat map. The footprints show a consistent boundary on the positive strand (red) and negative strand (blue) around each motif. The zoomed-in average profile below reveals that the footprints are wider than the motif. A schematic representation of the digestion pattern is shown below using Pacman symbols for lambda exonuclease. (a) The ChIP-nexus footprint for Dorsal (NFkB) on its canonical motif (GGRWWTTCC with up to one mismatch) extends on average 5 bp away from the motif edge. Thus, the average dorsal footprint is 18 bp long (horizontal black bar). (b) The Twist ChIP-nexus footprint on the E-box motif CABATG (no mismatch) has two outside boundaries, one at 11 bp, and one at 2 bp away from the motif edge, suggesting interactions with flanking DNA sequences. Each portion of the footprint is around 8–9bp long (horizontal black bar). (c) The Max ChIP-nexus footprint on its canonical E-box motif (CACGTG, no mismatch) has an outside boundary at 8 bp away from the motif edge, as well as a boundary inside the motif (at the A/T base), suggesting two partial footprints (horizontal black bars). (d, e) Average Max and Twist ChIP-nexus footprints at the top 200 sites for all possible E-box variants (CANNTG). Each variant profile includes its reverse complement. (d) Max binds specifically to the canonical CACGTG motif and to a lesser extent to the CACATG motif. Note that the Max footprint shape looks identical between the two motifs. (e) In contrast, the Twist binding specificity and the footprint shape is more complex. Notably, the outer boundary at -11bp is stronger at the CATATG and CACATG motif, whereas the inner boundary at -2 bp is stronger at the CAGATG motif.

    Article Snippet: For lambda exonuclease digestion, each sample was incubated in 0.2 u/μl lambda exonuclease (New England Biolabs, M0262), 5% DMSO and 0.1% triton X-100 in 100 μl 1x NEB Lambda exonuclease reaction buffer at 37 °C for 60 min with constant agitation, followed by washing steps as above.

    Techniques: In Vivo, Chromatin Immunoprecipitation, Variant Assay, Binding Assay