therminator  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Therminator DNA Polymerase
    Description:
    Therminator DNA Polymerase 1 000 units
    Catalog Number:
    M0261L
    Price:
    414
    Category:
    Thermostable DNA Polymerases
    Size:
    1 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs therminator
    Therminator DNA Polymerase
    Therminator DNA Polymerase 1 000 units
    https://www.bioz.com/result/therminator/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    therminator - by Bioz Stars, 2021-05
    93/100 stars

    Images

    1) Product Images from "Synthesis and Enzymatic Incorporation of Modified Deoxyuridine Triphosphates"

    Article Title: Synthesis and Enzymatic Incorporation of Modified Deoxyuridine Triphosphates

    Journal: Molecules

    doi: 10.3390/molecules200813591

    Screening various DNA polymerases with compound 1A and T1 . Lane 1, primer only; lane 2, ddTTP (control); lane 3, dTTP (control); lane 4, Tth; lane 5, Tfl; lane 6, Thermosequenase; lane 7, Vent(exo-); lane 8, Therminator; lane 9, KOD DASH; lane 10, Klenow; lane 11, Sequenase v.2.0.
    Figure Legend Snippet: Screening various DNA polymerases with compound 1A and T1 . Lane 1, primer only; lane 2, ddTTP (control); lane 3, dTTP (control); lane 4, Tth; lane 5, Tfl; lane 6, Thermosequenase; lane 7, Vent(exo-); lane 8, Therminator; lane 9, KOD DASH; lane 10, Klenow; lane 11, Sequenase v.2.0.

    Techniques Used:

    Related Articles

    Amplification:

    Article Title: PAP-LMPCR for improved, allele-specific footprinting and automated chromatin fine structure analysis
    Article Snippet: .. Primers: For PAP-LMPCR the biotinylated extension primer contained a blocked dideoxy end, 5′Bio/TAAGTCTCTCAAACTCCATCATCTddC3′ (Integrated DNA Technologies Inc), the amplification primer was 5′TCTCCCTTCAGGATCAGTTTGAGCCT, LP25: generic linker primer was 5′GCGGTGACCCGGGAGATCTGAATTC3′ PAP-primer extension reactions were carried out in 1× reaction buffer [20 mM Tris pH 8, 10 mM KCl, 10 mM (NH4 )SO4 , 3 mM MgCl2 , 0.1% Triton, 60 µM Na pyrophosphate], 0.3 M Sulpholan (Sigma), 2 mM tetramethylammonium oxalate (TMA ox) (gift from Sachem Inc.), 1 pM biotinylated dideoxyterminated primer, 250 µM dNTPs, 2 U Therminator™ DNA polymerase (NEB) and 1 µg DNA. dH2 O was added to give a volume of 5 µl and the reaction mix was overlaid with 10 µl mineral oil. ..

    Synthesized:

    Article Title: High fidelity TNA synthesis by Therminator polymerase
    Article Snippet: .. DISCUSSION We have determined that TNA synthesized by the Therminator DNA polymerase can have an error rate of < 1%, as long as full-length material is purified after a short reaction time. .. The high fidelity obtained under these conditions means that it should be practical to use TNA pools as large as 200 nt for in vitro selection , provided that Therminator could polymerize enough 200 nt-long TNA.

    Purification:

    Article Title: High fidelity TNA synthesis by Therminator polymerase
    Article Snippet: .. DISCUSSION We have determined that TNA synthesized by the Therminator DNA polymerase can have an error rate of < 1%, as long as full-length material is purified after a short reaction time. .. The high fidelity obtained under these conditions means that it should be practical to use TNA pools as large as 200 nt for in vitro selection , provided that Therminator could polymerize enough 200 nt-long TNA.

    Concentration Assay:

    Article Title: Kinetic Analysis of an Efficient DNA-Dependent TNA Polymerase
    Article Snippet: The chimeric DNA−TNA primer used to measure the kinetics of tNTP extension from the TNA terminus of a DNA−TNA primer was constructed by template-directed synthesis using Therminator DNA polymerase to extend a DNA primer with five tNTP residues (see above). .. Polymerization reactions were initiated by adding 10 μL of 2 × dNTP or tNTP solution (0.01−10 μM) to an equal volume of the reaction mixture containing primer−template complex, 20 mM Tris-HCl, 10 mM KCl, 10 mM (NH4 )2 SO4 , 20 mM MgSO4 , 0.1% Triton X-100, 0.25 μg/μL BSA, 100 μM DTT, and either 0.05 units of Therminator DNA polymerase (final concentration 9.3 nM) (New England Biolabs, 2 u/μL) or 0.1 units of Deep Vent (exo-) DNA polymerase (final concentration 1.82 nM) (New England Biolabs, 2 u/μL). ..

    Incubation:

    Article Title: Development of a sequencing system for spatial decoding of DNA barcode molecules at single-molecule resolution
    Article Snippet: Sequence procedure After the fill-and-lock step, each sequencing cycle was performed as follows. .. The flow cell was incubated at 37 °C for 2 min with VT incorporation buffer (20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM NaCl, 10 mM (NH4 )2 SO4 , 0.1% Triton X-100, 5 U/ml Therminator™ DNA polymerase (NEB) and 1 mM MgSO4 with either 125 nM VT-C, 125 nM VT-T, 200 nM VT-A, or 75 nM VT-G), followed by rinsing with Wash A and Wash B. .. Next, the flow cell was filled with freshly prepared imaging buffer, and fluorescence images were captured with a 200-ms exposure, after which the flow cell was rinsed with Wash A and Wash B.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs therminator dna polymerase
    Primer extension with amino acid phosphoramidates by <t>Therminator</t> <t>DNA</t> polymerase. Reactions conditions: primer (P1) was 5′-labelled with 33 P followed by annealing to a template T3; 125 nM primer/template (P1/T3), [AA-dAMP] = 500 μM; [dATP] = 50 μM; [Therminator] = 8 × 10 −4 U/μl; time points: 5, 15, 30, 60, 90 and 120 min. Blank: 125 nM primer/template (P1/T3), [Therminator] = 8 × 10 −4 U/μl, no nucleotide substrate.
    Therminator Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/therminator dna polymerase/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    therminator dna polymerase - by Bioz Stars, 2021-05
    93/100 stars
      Buy from Supplier

    Image Search Results


    Primer extension with amino acid phosphoramidates by Therminator DNA polymerase. Reactions conditions: primer (P1) was 5′-labelled with 33 P followed by annealing to a template T3; 125 nM primer/template (P1/T3), [AA-dAMP] = 500 μM; [dATP] = 50 μM; [Therminator] = 8 × 10 −4 U/μl; time points: 5, 15, 30, 60, 90 and 120 min. Blank: 125 nM primer/template (P1/T3), [Therminator] = 8 × 10 −4 U/μl, no nucleotide substrate.

    Journal: Nucleic Acids Research

    Article Title: Polymerase-catalyzed synthesis of DNA from phosphoramidate conjugates of deoxynucleotides and amino acids

    doi: 10.1093/nar/gkm498

    Figure Lengend Snippet: Primer extension with amino acid phosphoramidates by Therminator DNA polymerase. Reactions conditions: primer (P1) was 5′-labelled with 33 P followed by annealing to a template T3; 125 nM primer/template (P1/T3), [AA-dAMP] = 500 μM; [dATP] = 50 μM; [Therminator] = 8 × 10 −4 U/μl; time points: 5, 15, 30, 60, 90 and 120 min. Blank: 125 nM primer/template (P1/T3), [Therminator] = 8 × 10 −4 U/μl, no nucleotide substrate.

    Article Snippet: In the case of Therminator DNA polymerase, the enzyme was obtained from Westburg (NEB) (2 U/µl) and the reactions were carried out in a 10X Thermopol reaction buffer containing 20 mM TRIS-HCl, 10 mM KCl, 2 mM MgSO4 , 0.1% Triton X-100, pH 8.8.

    Techniques:

    Panel I: incorporation of Asp-dAMP ( 1 ) by Therminator DNA pol. Panel II: incorporation of dimethyl ester Asp-dAMP by Therminator. Reaction conditions: primer (P1) was 5′-labelled with 33 P followed by annealing to a template T1; 125 nM primer/template (P1/T1), [Therminator] = 0.03 U/μl, [primer] = 0.125 μM, time intervals: 5, 15, 30, 60, 90 and 120 min.

    Journal: Nucleic Acids Research

    Article Title: Polymerase-catalyzed synthesis of DNA from phosphoramidate conjugates of deoxynucleotides and amino acids

    doi: 10.1093/nar/gkm498

    Figure Lengend Snippet: Panel I: incorporation of Asp-dAMP ( 1 ) by Therminator DNA pol. Panel II: incorporation of dimethyl ester Asp-dAMP by Therminator. Reaction conditions: primer (P1) was 5′-labelled with 33 P followed by annealing to a template T1; 125 nM primer/template (P1/T1), [Therminator] = 0.03 U/μl, [primer] = 0.125 μM, time intervals: 5, 15, 30, 60, 90 and 120 min.

    Article Snippet: In the case of Therminator DNA polymerase, the enzyme was obtained from Westburg (NEB) (2 U/µl) and the reactions were carried out in a 10X Thermopol reaction buffer containing 20 mM TRIS-HCl, 10 mM KCl, 2 mM MgSO4 , 0.1% Triton X-100, pH 8.8.

    Techniques:

    Efficiency of phosphoramidate incorporation by Therminator DNA polymerase.

    Journal: Nucleic Acids Research

    Article Title: Polymerase-catalyzed synthesis of DNA from phosphoramidate conjugates of deoxynucleotides and amino acids

    doi: 10.1093/nar/gkm498

    Figure Lengend Snippet: Efficiency of phosphoramidate incorporation by Therminator DNA polymerase.

    Article Snippet: In the case of Therminator DNA polymerase, the enzyme was obtained from Westburg (NEB) (2 U/µl) and the reactions were carried out in a 10X Thermopol reaction buffer containing 20 mM TRIS-HCl, 10 mM KCl, 2 mM MgSO4 , 0.1% Triton X-100, pH 8.8.

    Techniques:

    Primer extension efficiency of Therminator DNA polymerase.

    Journal: Nucleic Acids Research

    Article Title: Polymerase-catalyzed synthesis of DNA from phosphoramidate conjugates of deoxynucleotides and amino acids

    doi: 10.1093/nar/gkm498

    Figure Lengend Snippet: Primer extension efficiency of Therminator DNA polymerase.

    Article Snippet: In the case of Therminator DNA polymerase, the enzyme was obtained from Westburg (NEB) (2 U/µl) and the reactions were carried out in a 10X Thermopol reaction buffer containing 20 mM TRIS-HCl, 10 mM KCl, 2 mM MgSO4 , 0.1% Triton X-100, pH 8.8.

    Techniques:

    ( A ) Sequences of the 25 nt template ( III ) and 20 nt primer ( IV ). ( B ) PAGE of extension reactions beyond the 1-deaza-dG residue in the template. ( C ) PAGE of extension reactions subsequent to 1-deaza-dG in the primer with Therminator™ DNA polymerase and ( D ) with AMV reverse transcriptase. Conditions used are described in Materials and Methods. Added dNTPs are indicated at the top of each gel. Z indicates 1-deaza-dGTP; P indicates reaction without dNTP.

    Journal: Nucleic Acids Research

    Article Title: A new, but old, nucleoside analog: the first synthesis of 1-deaza-2?-deoxyguanosine and its properties as a nucleoside and as oligodeoxynucleotides

    doi: 10.1093/nar/gkh154

    Figure Lengend Snippet: ( A ) Sequences of the 25 nt template ( III ) and 20 nt primer ( IV ). ( B ) PAGE of extension reactions beyond the 1-deaza-dG residue in the template. ( C ) PAGE of extension reactions subsequent to 1-deaza-dG in the primer with Therminator™ DNA polymerase and ( D ) with AMV reverse transcriptase. Conditions used are described in Materials and Methods. Added dNTPs are indicated at the top of each gel. Z indicates 1-deaza-dGTP; P indicates reaction without dNTP.

    Article Snippet: Klenow fragment (exo– ) and Therminator™ DNA polymerase were purchased from New England BioLabs (Beverly, MA).

    Techniques: Polyacrylamide Gel Electrophoresis

    PAGE of single nucleotide insertion studies ( A ) with Therminator™ DNA polymerase (reaction mixtures being incubated at 74°C for 10 min), ( B ) with AMV reverse transcriptase (reaction mixtures being incubated at 37°C for 30 min) and ( C ) with M-MLV reverse transcriptase (reactions mixture being incubated at 37°C for 30 min). Conditions used are described in Materials and Methods. Both X in the template sequence and added dNTP are indicated at the top of each gel. Z indicates 1-deaza-dGTP; P indicates reaction without dNTP.

    Journal: Nucleic Acids Research

    Article Title: A new, but old, nucleoside analog: the first synthesis of 1-deaza-2?-deoxyguanosine and its properties as a nucleoside and as oligodeoxynucleotides

    doi: 10.1093/nar/gkh154

    Figure Lengend Snippet: PAGE of single nucleotide insertion studies ( A ) with Therminator™ DNA polymerase (reaction mixtures being incubated at 74°C for 10 min), ( B ) with AMV reverse transcriptase (reaction mixtures being incubated at 37°C for 30 min) and ( C ) with M-MLV reverse transcriptase (reactions mixture being incubated at 37°C for 30 min). Conditions used are described in Materials and Methods. Both X in the template sequence and added dNTP are indicated at the top of each gel. Z indicates 1-deaza-dGTP; P indicates reaction without dNTP.

    Article Snippet: Klenow fragment (exo– ) and Therminator™ DNA polymerase were purchased from New England BioLabs (Beverly, MA).

    Techniques: Polyacrylamide Gel Electrophoresis, Incubation, Sequencing

    Screening various DNA polymerases with compound 1A and T1 . Lane 1, primer only; lane 2, ddTTP (control); lane 3, dTTP (control); lane 4, Tth; lane 5, Tfl; lane 6, Thermosequenase; lane 7, Vent(exo-); lane 8, Therminator; lane 9, KOD DASH; lane 10, Klenow; lane 11, Sequenase v.2.0.

    Journal: Molecules

    Article Title: Synthesis and Enzymatic Incorporation of Modified Deoxyuridine Triphosphates

    doi: 10.3390/molecules200813591

    Figure Lengend Snippet: Screening various DNA polymerases with compound 1A and T1 . Lane 1, primer only; lane 2, ddTTP (control); lane 3, dTTP (control); lane 4, Tth; lane 5, Tfl; lane 6, Thermosequenase; lane 7, Vent(exo-); lane 8, Therminator; lane 9, KOD DASH; lane 10, Klenow; lane 11, Sequenase v.2.0.

    Article Snippet: 6X loading buffer, T4 polynucleotide kinase, Vent (exo–), Therminator and Taq DNA polymerase were purchased from New England Biolabs (Ipswich, MA, USA).

    Techniques:

    TNA polymerase screen. Products of tNTP elongation on a 5‘[-P 32 ]-labeled 23-mer primer annealed to a DNA template. Reaction progress over time was analyzed by denaturing polyacrylamide gel electrophoresis for experiments using exonuclease deficient family B DNA polymerases: 9°N, Therminator, 9°N single mutant Y409V, 9°N double mutant Y409V and A485L, Deep Vent, and Vent. Time points were taken for each polymerase reaction at 0 (no enzyme), 15, 30, 90, 150, and 300 min, lanes 1−6, respectively.

    Journal: Journal of the American Chemical Society

    Article Title: Kinetic Analysis of an Efficient DNA-Dependent TNA Polymerase

    doi: 10.1021/ja0428255

    Figure Lengend Snippet: TNA polymerase screen. Products of tNTP elongation on a 5‘[-P 32 ]-labeled 23-mer primer annealed to a DNA template. Reaction progress over time was analyzed by denaturing polyacrylamide gel electrophoresis for experiments using exonuclease deficient family B DNA polymerases: 9°N, Therminator, 9°N single mutant Y409V, 9°N double mutant Y409V and A485L, Deep Vent, and Vent. Time points were taken for each polymerase reaction at 0 (no enzyme), 15, 30, 90, 150, and 300 min, lanes 1−6, respectively.

    Article Snippet: Polymerization reactions were initiated by adding 10 μL of 2 × dNTP or tNTP solution (0.01−10 μM) to an equal volume of the reaction mixture containing primer−template complex, 20 mM Tris-HCl, 10 mM KCl, 10 mM (NH4 )2 SO4 , 20 mM MgSO4 , 0.1% Triton X-100, 0.25 μg/μL BSA, 100 μM DTT, and either 0.05 units of Therminator DNA polymerase (final concentration 9.3 nM) (New England Biolabs, 2 u/μL) or 0.1 units of Deep Vent (exo-) DNA polymerase (final concentration 1.82 nM) (New England Biolabs, 2 u/μL).

    Techniques: Labeling, Polyacrylamide Gel Electrophoresis, Mutagenesis

    TNA primer extension reactions. Reaction progress over time was analyzed by denaturing polyacrylamide gel electrophoresis for (A) Deep Vent exo- (DV exo- ) and (B) Therminator-catalyzed DNA polymerase reactions. Primer-extension reactions were performed in the absence (lanes 1−7) and presence (lanes 8−14) of 1.25 mM MnCl 2 .

    Journal: Journal of the American Chemical Society

    Article Title: Kinetic Analysis of an Efficient DNA-Dependent TNA Polymerase

    doi: 10.1021/ja0428255

    Figure Lengend Snippet: TNA primer extension reactions. Reaction progress over time was analyzed by denaturing polyacrylamide gel electrophoresis for (A) Deep Vent exo- (DV exo- ) and (B) Therminator-catalyzed DNA polymerase reactions. Primer-extension reactions were performed in the absence (lanes 1−7) and presence (lanes 8−14) of 1.25 mM MnCl 2 .

    Article Snippet: Polymerization reactions were initiated by adding 10 μL of 2 × dNTP or tNTP solution (0.01−10 μM) to an equal volume of the reaction mixture containing primer−template complex, 20 mM Tris-HCl, 10 mM KCl, 10 mM (NH4 )2 SO4 , 20 mM MgSO4 , 0.1% Triton X-100, 0.25 μg/μL BSA, 100 μM DTT, and either 0.05 units of Therminator DNA polymerase (final concentration 9.3 nM) (New England Biolabs, 2 u/μL) or 0.1 units of Deep Vent (exo-) DNA polymerase (final concentration 1.82 nM) (New England Biolabs, 2 u/μL).

    Techniques: Polyacrylamide Gel Electrophoresis