high fidelity thermophilic dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    Deep Vent DNA Polymerase
    Description:
    Deep Vent DNA Polymerase 1 000 units
    Catalog Number:
    M0258L
    Price:
    414
    Category:
    Thermostable DNA Polymerases
    Size:
    1 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs high fidelity thermophilic dna polymerase
    Deep Vent DNA Polymerase
    Deep Vent DNA Polymerase 1 000 units
    https://www.bioz.com/result/high fidelity thermophilic dna polymerase/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    high fidelity thermophilic dna polymerase - by Bioz Stars, 2021-05
    96/100 stars

    Images

    1) Product Images from "Development of a Quantitative Methylation-Specific Polymerase Chain Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes"

    Article Title: Development of a Quantitative Methylation-Specific Polymerase Chain Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0047942

    Effect of non-specific gDNA on the specificity and sensitivity of MSP. The unmethylated Ins2 gene plasmid was diluted in the presence or absence of 500 ng non-specific gDNA, bisulfite-treated, and used as template for PCR. A) 160, 80, 40, 20, 10, 5, and 2 copies of plasmid without non-specific DNA analyzed by qMSP using primer set P4/P6. B) Serial dilutions ranged from 10 8 to 10 copies of plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P4/P6. C) Serial dilution from 10 8 to 3 copies of plasmid in the absence of non-specific gDNA analyzed by qMSP using primer set P12/P13. D) Range of serial dilutions from 10 7 to 10 copies plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P12/P13. Mouse liver gDNA was used as non-specific DNA and NTC is the non-template control.
    Figure Legend Snippet: Effect of non-specific gDNA on the specificity and sensitivity of MSP. The unmethylated Ins2 gene plasmid was diluted in the presence or absence of 500 ng non-specific gDNA, bisulfite-treated, and used as template for PCR. A) 160, 80, 40, 20, 10, 5, and 2 copies of plasmid without non-specific DNA analyzed by qMSP using primer set P4/P6. B) Serial dilutions ranged from 10 8 to 10 copies of plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P4/P6. C) Serial dilution from 10 8 to 3 copies of plasmid in the absence of non-specific gDNA analyzed by qMSP using primer set P12/P13. D) Range of serial dilutions from 10 7 to 10 copies plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P12/P13. Mouse liver gDNA was used as non-specific DNA and NTC is the non-template control.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Serial Dilution

    Quantification of circulating beta cell DNA in STZ-treated diabetic mice. NOD/scid mice were injected with STZ at days 0, 1, and 2, and blood was collected pre-treatment and post-treatment days 1, 2, 3, 5, 6, 7, 14, and 35. A) Blood glucose levels for untreated (n = 3) and STZ-injected (n = 34) NOD/scid mice were measured at days 1 (n = 6), 2 (n = 4), 5 (n = 4), 6 (n = 8), 7 (n = 4), 14 (n = 4) and 35 (n = 4) after injection. In parallel, qMSP was done using bisulfite converted gDNA obtained from the blood of untreated (n = 3) and STZ-treated mice at designated time points. Fold changes in demethylation are measured by calculation of ΔΔC q (B), Relative Expression Ration (C) or Demethylation Index (D) for each sample using methylation-specific primers P12/P13 and bisulfite-specific primers P16/P17. The cloned Ins2 gene was used for normalization and standardization of the results as described under Material and Methods. The data display the mean ± standard error (SEM) of three independent measurements. The statistical significance was calculated with the Student t test for unpaired values and significance level indicated by asterisks (*, P
    Figure Legend Snippet: Quantification of circulating beta cell DNA in STZ-treated diabetic mice. NOD/scid mice were injected with STZ at days 0, 1, and 2, and blood was collected pre-treatment and post-treatment days 1, 2, 3, 5, 6, 7, 14, and 35. A) Blood glucose levels for untreated (n = 3) and STZ-injected (n = 34) NOD/scid mice were measured at days 1 (n = 6), 2 (n = 4), 5 (n = 4), 6 (n = 8), 7 (n = 4), 14 (n = 4) and 35 (n = 4) after injection. In parallel, qMSP was done using bisulfite converted gDNA obtained from the blood of untreated (n = 3) and STZ-treated mice at designated time points. Fold changes in demethylation are measured by calculation of ΔΔC q (B), Relative Expression Ration (C) or Demethylation Index (D) for each sample using methylation-specific primers P12/P13 and bisulfite-specific primers P16/P17. The cloned Ins2 gene was used for normalization and standardization of the results as described under Material and Methods. The data display the mean ± standard error (SEM) of three independent measurements. The statistical significance was calculated with the Student t test for unpaired values and significance level indicated by asterisks (*, P

    Techniques Used: Mouse Assay, Injection, Expressing, Methylation, Clone Assay

    Rationale for selection of the primers that differentiate between methylated and unmethylated CpG. A) Schematic illustration of the mouse Ins2 gene with promoter region (blue), exon 1 (yellow), intron 1 (white), and exon 2 (green) showing the positions of CpG sites and the primers used in this study. Black arrows represent the bisulfite-specific primers (BSP) that amplify both methylated and unmethylated DNA. Red arrows represent methylation-specific primers (MSP) that amplify unmethylated but not methylated DNA. B) Gel electrophoresis (3% agarose) of PCR products amplified by reactions using different primer sets and the cloned Ins2 gene as template. The clone was methylated (M) or sham methylated (N) and bisulfite-treated prior to use in the reactions. NTC means non-template control. TSS indicates the transcription starting site.
    Figure Legend Snippet: Rationale for selection of the primers that differentiate between methylated and unmethylated CpG. A) Schematic illustration of the mouse Ins2 gene with promoter region (blue), exon 1 (yellow), intron 1 (white), and exon 2 (green) showing the positions of CpG sites and the primers used in this study. Black arrows represent the bisulfite-specific primers (BSP) that amplify both methylated and unmethylated DNA. Red arrows represent methylation-specific primers (MSP) that amplify unmethylated but not methylated DNA. B) Gel electrophoresis (3% agarose) of PCR products amplified by reactions using different primer sets and the cloned Ins2 gene as template. The clone was methylated (M) or sham methylated (N) and bisulfite-treated prior to use in the reactions. NTC means non-template control. TSS indicates the transcription starting site.

    Techniques Used: Selection, Methylation, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Amplification, Clone Assay

    2) Product Images from "Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis"

    Article Title: Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis

    Journal: Human Molecular Genetics

    doi: 10.1093/hmg/ddz062

    The Q331K mutation affects the nuclear translocation of XRCC4-DNA ligase 4. ( A ) IF of DNA ligase 4 in WT or Q331K cells shows increased cytoplasmic presence in mutant cells (Scale bar, 10 μm). The 2.5-dimensional view of the localization is shown in the image below. ( B ) IF of XRCC4 in WT or Q331K cells shows their reduced nuclear presence in mutant cells (Scale bar, 10 μm). The 2.5-dimensional view of the localization is shown in the image below. ( C ) PLA of FLAG versus DNA ligase 4 and FLAG versus XRCC4 in cells expressing WT and mutant TDP-43 (Scale bar, 10 μm). The higher number of foci in the cytoplasm of Q331K-expressing cells compared to WT-expressing cells indicates the increased interaction of XRCC4-DNA ligase 4 after DNA-damage induction by IR (3 Gy). ** P
    Figure Legend Snippet: The Q331K mutation affects the nuclear translocation of XRCC4-DNA ligase 4. ( A ) IF of DNA ligase 4 in WT or Q331K cells shows increased cytoplasmic presence in mutant cells (Scale bar, 10 μm). The 2.5-dimensional view of the localization is shown in the image below. ( B ) IF of XRCC4 in WT or Q331K cells shows their reduced nuclear presence in mutant cells (Scale bar, 10 μm). The 2.5-dimensional view of the localization is shown in the image below. ( C ) PLA of FLAG versus DNA ligase 4 and FLAG versus XRCC4 in cells expressing WT and mutant TDP-43 (Scale bar, 10 μm). The higher number of foci in the cytoplasm of Q331K-expressing cells compared to WT-expressing cells indicates the increased interaction of XRCC4-DNA ligase 4 after DNA-damage induction by IR (3 Gy). ** P

    Techniques Used: Mutagenesis, Translocation Assay, Proximity Ligation Assay, Expressing

    Q331K expression induces ROS stress and accumulation DNA strand breaks in neurons. ( A ) Cellular Reactive Oxygen Species Detection Assay by IF microscopy. Upper panels represent WT-expressing cells; lower panels represent Q331K-expressing cells. The two panels on the left represent uninduced cells. Panels to the right represent cells after Dox induction. Deep RED dye staining indicates the presence of ROS (Scale bar, 10 μm). ( B ) Quantitation of cellular ROS using a microplate fluorescence reader. ( C ) LA-PCR analysis of genomic DNA isolated from TDP-43-Q331K neurons shows reduced DNA integrity. Representative agarose gel images of amplified DNA products. ( D ) Quantification of PCR products by Pico Green-based DNA quantitation from triplicate experiments. ( E ) Alkaline comet analysis of differentiated SH-SY5Y cells expressing WT or Q331K (lower panel). Quantitation of mean tail moment before and after Dox induction in 25–50 cells reveals an ~5-fold increase in DNA damage in Q331K cells (Scale bar, 10 μm). * P
    Figure Legend Snippet: Q331K expression induces ROS stress and accumulation DNA strand breaks in neurons. ( A ) Cellular Reactive Oxygen Species Detection Assay by IF microscopy. Upper panels represent WT-expressing cells; lower panels represent Q331K-expressing cells. The two panels on the left represent uninduced cells. Panels to the right represent cells after Dox induction. Deep RED dye staining indicates the presence of ROS (Scale bar, 10 μm). ( B ) Quantitation of cellular ROS using a microplate fluorescence reader. ( C ) LA-PCR analysis of genomic DNA isolated from TDP-43-Q331K neurons shows reduced DNA integrity. Representative agarose gel images of amplified DNA products. ( D ) Quantification of PCR products by Pico Green-based DNA quantitation from triplicate experiments. ( E ) Alkaline comet analysis of differentiated SH-SY5Y cells expressing WT or Q331K (lower panel). Quantitation of mean tail moment before and after Dox induction in 25–50 cells reveals an ~5-fold increase in DNA damage in Q331K cells (Scale bar, 10 μm). * P

    Techniques Used: Expressing, Detection Assay, Microscopy, Staining, Quantitation Assay, Fluorescence, Polymerase Chain Reaction, Isolation, Agarose Gel Electrophoresis, Amplification

    3) Product Images from "The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701"

    Article Title: The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.186.17.5576-5584.2004

    Transcriptional organization of virR gene cluster. (A) Genetic organization of DNA region harboring ORF3 to ORF9. The arrow above the map denotes the direction of transcription of the polycistronic message. Arrows below the illustration indicate oligonucleotide primers used for RT-PCR. (B) Results of RT-PCR analyses. Each oligonucleotide pair was used in three amplification reactions, with 2 μl of the reverse transcriptase-containing reaction (cDNA), without reverse transcriptase (−RT), and with R. equi ATCC 33701 genomic DNA (DNA). The oligonucleotide pairs used were 003R and 004R (i), 004F and 005R (ii), 005F and 006R (iii), 006F and 007NR (iv), 007NF and 008R (v), and 008F and 009R (vi). The size of each band is indicated.
    Figure Legend Snippet: Transcriptional organization of virR gene cluster. (A) Genetic organization of DNA region harboring ORF3 to ORF9. The arrow above the map denotes the direction of transcription of the polycistronic message. Arrows below the illustration indicate oligonucleotide primers used for RT-PCR. (B) Results of RT-PCR analyses. Each oligonucleotide pair was used in three amplification reactions, with 2 μl of the reverse transcriptase-containing reaction (cDNA), without reverse transcriptase (−RT), and with R. equi ATCC 33701 genomic DNA (DNA). The oligonucleotide pairs used were 003R and 004R (i), 004F and 005R (ii), 005F and 006R (iii), 006F and 007NR (iv), 007NF and 008R (v), and 008F and 009R (vi). The size of each band is indicated.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification

    4) Product Images from "Ubiquitin-editing enzyme A20 promotes tolerance to LPS in enterocytes 1"

    Article Title: Ubiquitin-editing enzyme A20 promotes tolerance to LPS in enterocytes 1

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi: 10.4049/jimmunol.0803987

    A20 is necessary and sufficient for the development of tolerance to LPS in IEC-6 cells. A , Levels of phospho-p38, IkB, and phospho-c-Jun in cells stably transfected with pcDNA3.1-V5His or pcDNA3-A20 and treated with LPS, UV, IL-17, or CpG DNA for indicated
    Figure Legend Snippet: A20 is necessary and sufficient for the development of tolerance to LPS in IEC-6 cells. A , Levels of phospho-p38, IkB, and phospho-c-Jun in cells stably transfected with pcDNA3.1-V5His or pcDNA3-A20 and treated with LPS, UV, IL-17, or CpG DNA for indicated

    Techniques Used: Stable Transfection, Transfection

    5) Product Images from "PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications"

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    Journal: Scientific Reports

    doi: 10.1038/srep05052

    Testing a DNA polymerase with high strand displacement activity in the amplification of the 12 TALE DNA-binding repeats in pTAL2 vector. Various parameters influencing the activity and the outcome of the PCR amplification of the Deep-VentR DNA polymerase are shown. The arrows indicate the expected size of the amplification products. PCR conditions are given in the supplementary material .
    Figure Legend Snippet: Testing a DNA polymerase with high strand displacement activity in the amplification of the 12 TALE DNA-binding repeats in pTAL2 vector. Various parameters influencing the activity and the outcome of the PCR amplification of the Deep-VentR DNA polymerase are shown. The arrows indicate the expected size of the amplification products. PCR conditions are given in the supplementary material .

    Techniques Used: Activity Assay, Amplification, Binding Assay, Plasmid Preparation, Polymerase Chain Reaction

    ET SSB slightly improves the performance of Deep-VentR DNA polymerase in amplifying TALE DNA-binding repeats. The arrow indicates the expected size of amplification products. ET SSB, a heat resistant single strand DNA-binding protein isolated from thermophilic bacteria (NE Biolabs). PCR conditions are given in the supplementary material .
    Figure Legend Snippet: ET SSB slightly improves the performance of Deep-VentR DNA polymerase in amplifying TALE DNA-binding repeats. The arrow indicates the expected size of amplification products. ET SSB, a heat resistant single strand DNA-binding protein isolated from thermophilic bacteria (NE Biolabs). PCR conditions are given in the supplementary material .

    Techniques Used: Binding Assay, Amplification, Isolation, Polymerase Chain Reaction

    6) Product Images from "Identification and removal of colanic acid from plasmid DNA preparations: implications for gene therapy"

    Article Title: Identification and removal of colanic acid from plasmid DNA preparations: implications for gene therapy

    Journal: Gene therapy

    doi: 10.1038/gt.2010.97

    DNA sequence of the open reading frame (ORF) for the CA-degrading enzyme (CAE). The complete ORF for the CAE was sequenced on both strands obtained from the NST1 genomic DNA. The initial sequencing was performed using degenerate oligos designed from amino-acid
    Figure Legend Snippet: DNA sequence of the open reading frame (ORF) for the CA-degrading enzyme (CAE). The complete ORF for the CAE was sequenced on both strands obtained from the NST1 genomic DNA. The initial sequencing was performed using degenerate oligos designed from amino-acid

    Techniques Used: Sequencing

    7) Product Images from "Acyclic and dideoxy terminator preferences denote divergent sugar recognition by archaeon and Taq DNA polymerases"

    Article Title: Acyclic and dideoxy terminator preferences denote divergent sugar recognition by archaeon and Taq DNA polymerases

    Journal: Nucleic Acids Research

    doi:

    Hyperthermophilic Family B archaeon DNA polymerases share terminator incorporation properties. Incorporation efficiencies of ROX-acyCTP by Family B DNA polymerases Vent, Deep Vent, Pfu and 9°N DNA polymerases were compared using the titration assay. Numbers refer to the ratio ROX–acyCTP:dNTP in the reaction mixture.
    Figure Legend Snippet: Hyperthermophilic Family B archaeon DNA polymerases share terminator incorporation properties. Incorporation efficiencies of ROX-acyCTP by Family B DNA polymerases Vent, Deep Vent, Pfu and 9°N DNA polymerases were compared using the titration assay. Numbers refer to the ratio ROX–acyCTP:dNTP in the reaction mixture.

    Techniques Used: Titration

    8) Product Images from "Examining Sources of Error in PCR by Single-Molecule Sequencing"

    Article Title: Examining Sources of Error in PCR by Single-Molecule Sequencing

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0169774

    Fidelity measurements and mutational spectrum of DNA polymerases. (A) Base substitution error rates of various DNA polymerases relative to Taq polymerase. (B) Proportion of each type of base substitution error as a percentage of the total errors for each polymerase.
    Figure Legend Snippet: Fidelity measurements and mutational spectrum of DNA polymerases. (A) Base substitution error rates of various DNA polymerases relative to Taq polymerase. (B) Proportion of each type of base substitution error as a percentage of the total errors for each polymerase.

    Techniques Used:

    9) Product Images from "PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications"

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    Journal: Scientific Reports

    doi: 10.1038/srep05052

    Testing a DNA polymerase with high strand displacement activity in the amplification of the 12 TALE DNA-binding repeats in pTAL2 vector. Various parameters influencing the activity and the outcome of the PCR amplification of the Deep-VentR DNA polymerase are shown. The arrows indicate the expected size of the amplification products. PCR conditions are given in the supplementary material .
    Figure Legend Snippet: Testing a DNA polymerase with high strand displacement activity in the amplification of the 12 TALE DNA-binding repeats in pTAL2 vector. Various parameters influencing the activity and the outcome of the PCR amplification of the Deep-VentR DNA polymerase are shown. The arrows indicate the expected size of the amplification products. PCR conditions are given in the supplementary material .

    Techniques Used: Activity Assay, Amplification, Binding Assay, Plasmid Preparation, Polymerase Chain Reaction

    ET SSB slightly improves the performance of Deep-VentR DNA polymerase in amplifying TALE DNA-binding repeats. The arrow indicates the expected size of amplification products. ET SSB, a heat resistant single strand DNA-binding protein isolated from thermophilic bacteria (NE Biolabs). PCR conditions are given in the supplementary material .
    Figure Legend Snippet: ET SSB slightly improves the performance of Deep-VentR DNA polymerase in amplifying TALE DNA-binding repeats. The arrow indicates the expected size of amplification products. ET SSB, a heat resistant single strand DNA-binding protein isolated from thermophilic bacteria (NE Biolabs). PCR conditions are given in the supplementary material .

    Techniques Used: Binding Assay, Amplification, Isolation, Polymerase Chain Reaction

    10) Product Images from "The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701"

    Article Title: The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.186.17.5576-5584.2004

    EMSA analysis of VirR binding to the vapA promoter region. Various concentrations of VirR were incubated with 2 ng of radiolabeled DNA (262 bp) containing the vapA promoter region. The amount of protein added to each lane was as follows: lane 1, radiolabeled DNA fragment only; lane 2, 50 ng; lane 3, 100 ng; lane 4, 200 ng; lane 5, 300 ng; and lane 6, 400 ng. Protein-DNA complexes are indicated with black arrows. Nonbound DNA is indicated with a gray arrow.
    Figure Legend Snippet: EMSA analysis of VirR binding to the vapA promoter region. Various concentrations of VirR were incubated with 2 ng of radiolabeled DNA (262 bp) containing the vapA promoter region. The amount of protein added to each lane was as follows: lane 1, radiolabeled DNA fragment only; lane 2, 50 ng; lane 3, 100 ng; lane 4, 200 ng; lane 5, 300 ng; and lane 6, 400 ng. Protein-DNA complexes are indicated with black arrows. Nonbound DNA is indicated with a gray arrow.

    Techniques Used: Binding Assay, Incubation

    Determination of vapA transcriptional start site in R. equi ATCC 33701. Fluorescent primer extension was performed with the Cy5-labeled primer CY5VAPA200R and 5 μg of total cellular RNA extracted from R. equi grown under vapA -inducing conditions (37°C, pH 6.5). CY5VAPA200R is complementary to a sequence 131 bp downstream from the vapA initiation codon. (A) Cy5-labeled primer extension product combined with DNA size standards and analyzed with the CEQ 8000 fragment analysis system. (B) Nucleotide sequence obtained by using VAPA200R. A dideoxy sequencing reaction mix was spiked with the Cy5-labeled primer extension product. The arrow indicates the transcriptional start site where the Cy5-labeled cDNA and the sequencing product overlapped. (C) Sequence of vapA promoter region. The transcriptional start site (+1) and putative −10 and −35 regions are boxed, and putative LysR motifs (T-N 11 -A) are indicated with brackets.
    Figure Legend Snippet: Determination of vapA transcriptional start site in R. equi ATCC 33701. Fluorescent primer extension was performed with the Cy5-labeled primer CY5VAPA200R and 5 μg of total cellular RNA extracted from R. equi grown under vapA -inducing conditions (37°C, pH 6.5). CY5VAPA200R is complementary to a sequence 131 bp downstream from the vapA initiation codon. (A) Cy5-labeled primer extension product combined with DNA size standards and analyzed with the CEQ 8000 fragment analysis system. (B) Nucleotide sequence obtained by using VAPA200R. A dideoxy sequencing reaction mix was spiked with the Cy5-labeled primer extension product. The arrow indicates the transcriptional start site where the Cy5-labeled cDNA and the sequencing product overlapped. (C) Sequence of vapA promoter region. The transcriptional start site (+1) and putative −10 and −35 regions are boxed, and putative LysR motifs (T-N 11 -A) are indicated with brackets.

    Techniques Used: Labeling, Sequencing

    11) Product Images from "Demonstration that orf2 Encodes the Feline Immunodeficiency Virus Transactivating (Tat) Protein and Characterization of a Unique Gene Product with Partial Rev Activity"

    Article Title: Demonstration that orf2 Encodes the Feline Immunodeficiency Virus Transactivating (Tat) Protein and Characterization of a Unique Gene Product with Partial Rev Activity

    Journal: Journal of Virology

    doi:

    Long PCR amplification of the different size classes of FIV transcripts. PCR products were resolved by electrophoresis on 1.3% agarose gel and stained with ethidium bromide. The sizes of the Hin dIII-cut λ DNA markers (outside lanes) are indicated in kilobases. (A) Optimization using different enzyme ratios. Taq and Deep-Vent polymerases were used alone (lanes 1 and 2) or in combination (lanes 3 to 12), where 5 U of Taq was mixed with serial twofold dilutions of Deep-Vent, starting with 0.5 U of Deep-Vent. (B) PCR amplification with the primer pairs LA4-LA7 (left panel) and LA4-LA11 (right panel). Numbers on the left indicate the exon composition of each PCR product, deduced from the sequence of the cDNA clones.
    Figure Legend Snippet: Long PCR amplification of the different size classes of FIV transcripts. PCR products were resolved by electrophoresis on 1.3% agarose gel and stained with ethidium bromide. The sizes of the Hin dIII-cut λ DNA markers (outside lanes) are indicated in kilobases. (A) Optimization using different enzyme ratios. Taq and Deep-Vent polymerases were used alone (lanes 1 and 2) or in combination (lanes 3 to 12), where 5 U of Taq was mixed with serial twofold dilutions of Deep-Vent, starting with 0.5 U of Deep-Vent. (B) PCR amplification with the primer pairs LA4-LA7 (left panel) and LA4-LA11 (right panel). Numbers on the left indicate the exon composition of each PCR product, deduced from the sequence of the cDNA clones.

    Techniques Used: Polymerase Chain Reaction, Amplification, Electrophoresis, Agarose Gel Electrophoresis, Staining, Sequencing, Clone Assay

    12) Product Images from "BB0347, from the Lyme Disease Spirochete Borrelia burgdorferi, Is Surface Exposed and Interacts with the CS1 Heparin-Binding Domain of Human Fibronectin"

    Article Title: BB0347, from the Lyme Disease Spirochete Borrelia burgdorferi, Is Surface Exposed and Interacts with the CS1 Heparin-Binding Domain of Human Fibronectin

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075643

    BB0347 is expressed and produced in culture. A) Expression of BB0347 was verified by RT- PCR with flaB mRNA as a control. Lane 1: flaB from genomic DNA, lane 2: flaB from cDNA, lane 3: no RT control, lane 4: bb0347 from genomic DNA, lane 5: bb0347 from cDNA, lane 6: no RT control, L: ladder. B) Western blotting shows that BB0347 protein is produced in the spirochete at all sampled time points. C) QRT- PCR of bb0347 at two different temperatures of incubation with flaB as a standard. D) Western blot using αBB0347 and αFlaB against whole-cell lysates from spirochetes grown at either 34 or 23°C to similar cellular densities. All figures are representative of at least two independent experiments with similar results, and error bars indicate ±SEM.
    Figure Legend Snippet: BB0347 is expressed and produced in culture. A) Expression of BB0347 was verified by RT- PCR with flaB mRNA as a control. Lane 1: flaB from genomic DNA, lane 2: flaB from cDNA, lane 3: no RT control, lane 4: bb0347 from genomic DNA, lane 5: bb0347 from cDNA, lane 6: no RT control, L: ladder. B) Western blotting shows that BB0347 protein is produced in the spirochete at all sampled time points. C) QRT- PCR of bb0347 at two different temperatures of incubation with flaB as a standard. D) Western blot using αBB0347 and αFlaB against whole-cell lysates from spirochetes grown at either 34 or 23°C to similar cellular densities. All figures are representative of at least two independent experiments with similar results, and error bars indicate ±SEM.

    Techniques Used: Produced, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Quantitative RT-PCR, Incubation

    13) Product Images from "The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701"

    Article Title: The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.186.17.5576-5584.2004

    EMSA analysis of VirR binding to the vapA promoter region. Various concentrations of VirR were incubated with 2 ng of radiolabeled DNA (262 bp) containing the vapA promoter region. The amount of protein added to each lane was as follows: lane 1, radiolabeled DNA fragment only; lane 2, 50 ng; lane 3, 100 ng; lane 4, 200 ng; lane 5, 300 ng; and lane 6, 400 ng. Protein-DNA complexes are indicated with black arrows. Nonbound DNA is indicated with a gray arrow.
    Figure Legend Snippet: EMSA analysis of VirR binding to the vapA promoter region. Various concentrations of VirR were incubated with 2 ng of radiolabeled DNA (262 bp) containing the vapA promoter region. The amount of protein added to each lane was as follows: lane 1, radiolabeled DNA fragment only; lane 2, 50 ng; lane 3, 100 ng; lane 4, 200 ng; lane 5, 300 ng; and lane 6, 400 ng. Protein-DNA complexes are indicated with black arrows. Nonbound DNA is indicated with a gray arrow.

    Techniques Used: Binding Assay, Incubation

    Determination of vapA transcriptional start site in R. equi ATCC 33701. Fluorescent primer extension was performed with the Cy5-labeled primer CY5VAPA200R and 5 μg of total cellular RNA extracted from R. equi grown under vapA -inducing conditions (37°C, pH 6.5). CY5VAPA200R is complementary to a sequence 131 bp downstream from the vapA initiation codon. (A) Cy5-labeled primer extension product combined with DNA size standards and analyzed with the CEQ 8000 fragment analysis system. (B) Nucleotide sequence obtained by using VAPA200R. A dideoxy sequencing reaction mix was spiked with the Cy5-labeled primer extension product. The arrow indicates the transcriptional start site where the Cy5-labeled cDNA and the sequencing product overlapped. (C) Sequence of vapA promoter region. The transcriptional start site (+1) and putative −10 and −35 regions are boxed, and putative LysR motifs (T-N 11 -A) are indicated with brackets.
    Figure Legend Snippet: Determination of vapA transcriptional start site in R. equi ATCC 33701. Fluorescent primer extension was performed with the Cy5-labeled primer CY5VAPA200R and 5 μg of total cellular RNA extracted from R. equi grown under vapA -inducing conditions (37°C, pH 6.5). CY5VAPA200R is complementary to a sequence 131 bp downstream from the vapA initiation codon. (A) Cy5-labeled primer extension product combined with DNA size standards and analyzed with the CEQ 8000 fragment analysis system. (B) Nucleotide sequence obtained by using VAPA200R. A dideoxy sequencing reaction mix was spiked with the Cy5-labeled primer extension product. The arrow indicates the transcriptional start site where the Cy5-labeled cDNA and the sequencing product overlapped. (C) Sequence of vapA promoter region. The transcriptional start site (+1) and putative −10 and −35 regions are boxed, and putative LysR motifs (T-N 11 -A) are indicated with brackets.

    Techniques Used: Labeling, Sequencing

    14) Product Images from "DNA recognition by the SwaI restriction endonuclease involves unusual distortion of an 8 base pair A:T-rich target"

    Article Title: DNA recognition by the SwaI restriction endonuclease involves unusual distortion of an 8 base pair A:T-rich target

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1200

    ( A ) Alignment of SwaI against four of its closest sequence homologues identified within the NCBI protein database ( 39 ), and against its two nearest structural homologues (HincII and EcoRV) identified within the RCSB protein structure database ( 40 ). One additional significant sequence homologue (WP_066163638; REBASE Bsp13219ORF4205P) is not shown for clarity. Conserved residues are shown as colored bold residues. The overall identity between SwaI and its nearest sequence relatives is 46–57% identity, while the identity between SwaI and HincII or EcoRV is 14% and 11%, respectively (corresponding to 32 and 25 conserved residues, respectively). The position and boundaries of secondary structural elements in SwaI are shown above the aligned sequences, and the position of the conserved active site residues are indicated with red arrows. The ‘X48’ notation in the HincII sequence correspond to a large unique insertion of additional residues, that are not shown, relative to all the other aligned sequences. ( B ) Sequence and numbering of the DNA target sites recognized and cleaved by SwaI, HincII and EcoRV. ‘Y’ and ‘R’ refer to any pyrimidine and purine base, respectively, which corresponds to promiscuous recognition at positions ±1 by HincII.
    Figure Legend Snippet: ( A ) Alignment of SwaI against four of its closest sequence homologues identified within the NCBI protein database ( 39 ), and against its two nearest structural homologues (HincII and EcoRV) identified within the RCSB protein structure database ( 40 ). One additional significant sequence homologue (WP_066163638; REBASE Bsp13219ORF4205P) is not shown for clarity. Conserved residues are shown as colored bold residues. The overall identity between SwaI and its nearest sequence relatives is 46–57% identity, while the identity between SwaI and HincII or EcoRV is 14% and 11%, respectively (corresponding to 32 and 25 conserved residues, respectively). The position and boundaries of secondary structural elements in SwaI are shown above the aligned sequences, and the position of the conserved active site residues are indicated with red arrows. The ‘X48’ notation in the HincII sequence correspond to a large unique insertion of additional residues, that are not shown, relative to all the other aligned sequences. ( B ) Sequence and numbering of the DNA target sites recognized and cleaved by SwaI, HincII and EcoRV. ‘Y’ and ‘R’ refer to any pyrimidine and purine base, respectively, which corresponds to promiscuous recognition at positions ±1 by HincII.

    Techniques Used: Sequencing

    Atomic contacts made between SwaI and individual bases in its DNA target site. The individual panels show contacts to bases starting at the outermost base pairs ( A–C ) and progressively working towards the middle of the target site ( D and E ). For clarity, only contacts to bases in one half-site are shown (except for the adenine bases at the exact center of the target site); the contacts are identical in the two DNA half-sites. The eight bases in each DNA half-site are directly contacted by six amino acid side chains (five from one protein subunit, and one from the opposing subunit). Of those six protein residues, four appear to form bridging contacts to bases at immediately neighboring positions. Two contacts between protein backbone nitrogen atoms (from residues 105 and 107) and atoms on DNA bases (adenine N7 in panels 2 and 3, respectively) are not shown for clarity. Panel e illustrates the position and reversed base-stacking interactions formed between the adenine bases extracted from positions ±1 in the protein-DNA complex. That pair of bases is flanked by the side chains of arginine 35 and 35΄, which respectively form cation–π interactions with each base (while at the same time, also forming contacts to two additional bases). Additional non-specific contacts made between protein side chains and the DNA backbone are also not shown in the figure for clarity.
    Figure Legend Snippet: Atomic contacts made between SwaI and individual bases in its DNA target site. The individual panels show contacts to bases starting at the outermost base pairs ( A–C ) and progressively working towards the middle of the target site ( D and E ). For clarity, only contacts to bases in one half-site are shown (except for the adenine bases at the exact center of the target site); the contacts are identical in the two DNA half-sites. The eight bases in each DNA half-site are directly contacted by six amino acid side chains (five from one protein subunit, and one from the opposing subunit). Of those six protein residues, four appear to form bridging contacts to bases at immediately neighboring positions. Two contacts between protein backbone nitrogen atoms (from residues 105 and 107) and atoms on DNA bases (adenine N7 in panels 2 and 3, respectively) are not shown for clarity. Panel e illustrates the position and reversed base-stacking interactions formed between the adenine bases extracted from positions ±1 in the protein-DNA complex. That pair of bases is flanked by the side chains of arginine 35 and 35΄, which respectively form cation–π interactions with each base (while at the same time, also forming contacts to two additional bases). Additional non-specific contacts made between protein side chains and the DNA backbone are also not shown in the figure for clarity.

    Techniques Used:

    Structure of the DNA-bound form of SwaI in the presence of calcium ions. the structure of the same complex in the presence of magnesium ions (not shown) is virtually indistinguishable, with the exception of fully cleaved DNA ends in the two enzyme active sites (Figure 7 ). ( A and B ) Ribbon diagrams of the enzyme homodimer (colored as in Figure 2 ) with and without the bound DNA are shown for clarity. The enzyme undergoes a significant conformational closure around the DNA target site, that is augmented by smaller movements and ordering of surface loops along the nuclease domain (that present side chains to the DNA backbone and its nucleotide bases). ( C ) Bending of the DNA target (the 8 bases of the actual target are colored, and the location of the scissile phosphates are indicated with arrows) and corresponding position of the enzyme ring around the target site.
    Figure Legend Snippet: Structure of the DNA-bound form of SwaI in the presence of calcium ions. the structure of the same complex in the presence of magnesium ions (not shown) is virtually indistinguishable, with the exception of fully cleaved DNA ends in the two enzyme active sites (Figure 7 ). ( A and B ) Ribbon diagrams of the enzyme homodimer (colored as in Figure 2 ) with and without the bound DNA are shown for clarity. The enzyme undergoes a significant conformational closure around the DNA target site, that is augmented by smaller movements and ordering of surface loops along the nuclease domain (that present side chains to the DNA backbone and its nucleotide bases). ( C ) Bending of the DNA target (the 8 bases of the actual target are colored, and the location of the scissile phosphates are indicated with arrows) and corresponding position of the enzyme ring around the target site.

    Techniques Used:

    ( A ) The active site of SwaI in the presence of calcium ions (left panel) and in the presence of magnesium ions (right panel). In both structures, a pair of bound metal ions flank each scissile phosphate, near the location of an incoming nucleophilic water (and corresponding non-bridging oxygens) and near the 3΄ oxygen leaving group, respectively. The former metal ion is coordinated by six oxygen moieties: two acidic side-chain oxygens from conserved aspartate residues D76 and D93; the backbone carbonyl of F94; a non-bridging phosphate oxygen; and two water molecules. The conserved active site lysine (K95) is positioned appropriately to participate in activation of one of the metal-bound water molecules that can then serve an incoming nucleophile for in-line hydrolytic displacement. In the structure solved in the presence of magnesium, the DNA appears to be fully cleaved, and the free 5΄ phosphates in each DNA strand are observed in two distinct positions, as indicated in the figure and corresponding refined model. ( B ) DNA-cleavage assays of wild-type SwaI and catalytic-site mutants. Cell-extracts of wild type SwaI, and of alanine-substitutions of the three key residues of the presumptive catalytic site (D76, D93, and K95) were prepared and assayed by 2-fold serial dilution on linear phage T7 DNA (upper panel) and circular plasmid pXba DNA (lower panel). Wild type SwaI cleaved both substrates, converting T7 into 34-kb and 6-kb fragments, and pXba into the 23-kb linear form. The mutated enzymes, in contrast, displayed a trace of DNA-nicking activity at the highest enzyme concentration, but no DNA-cleavage activity, supporting the idea that these residues are essential for catalysis.
    Figure Legend Snippet: ( A ) The active site of SwaI in the presence of calcium ions (left panel) and in the presence of magnesium ions (right panel). In both structures, a pair of bound metal ions flank each scissile phosphate, near the location of an incoming nucleophilic water (and corresponding non-bridging oxygens) and near the 3΄ oxygen leaving group, respectively. The former metal ion is coordinated by six oxygen moieties: two acidic side-chain oxygens from conserved aspartate residues D76 and D93; the backbone carbonyl of F94; a non-bridging phosphate oxygen; and two water molecules. The conserved active site lysine (K95) is positioned appropriately to participate in activation of one of the metal-bound water molecules that can then serve an incoming nucleophile for in-line hydrolytic displacement. In the structure solved in the presence of magnesium, the DNA appears to be fully cleaved, and the free 5΄ phosphates in each DNA strand are observed in two distinct positions, as indicated in the figure and corresponding refined model. ( B ) DNA-cleavage assays of wild-type SwaI and catalytic-site mutants. Cell-extracts of wild type SwaI, and of alanine-substitutions of the three key residues of the presumptive catalytic site (D76, D93, and K95) were prepared and assayed by 2-fold serial dilution on linear phage T7 DNA (upper panel) and circular plasmid pXba DNA (lower panel). Wild type SwaI cleaved both substrates, converting T7 into 34-kb and 6-kb fragments, and pXba into the 23-kb linear form. The mutated enzymes, in contrast, displayed a trace of DNA-nicking activity at the highest enzyme concentration, but no DNA-cleavage activity, supporting the idea that these residues are essential for catalysis.

    Techniques Used: Activation Assay, Serial Dilution, Plasmid Preparation, Activity Assay, Concentration Assay

    Superposition and comparison of the DNA-bound structures of SwaI and HincII. The left panels in each row show the superposition of both structures; the middle and right panels show the same elements in their individual molecular complexes. Each superposition is calculated based on the core nuclease residues of the helix and 3 β-strands that comprise the core elements of the PD-(D/E)xK nuclease motif (see Figure 7 ). Note that while the nuclease domains superimpose relatively closely, that the corresponding orientations of additional protein structural elements (such as the domain-swapped helices) and the bound DNA differ by at least 10° from one another. The bottom row shows the superposition of the two bound DNA targets for SwaI and HincII. While the overall bend angle and positions of the flanking bases (at positions 2–4 in each half-site) are similar, the effect of DNA binding and bending on the central two base pairs are radically different. In SwaI the central A:T base pairs are completely disrupted, whereas in HincII (and in EcoRV, not shown) they remain in a bent (but still base-paired) conformation.
    Figure Legend Snippet: Superposition and comparison of the DNA-bound structures of SwaI and HincII. The left panels in each row show the superposition of both structures; the middle and right panels show the same elements in their individual molecular complexes. Each superposition is calculated based on the core nuclease residues of the helix and 3 β-strands that comprise the core elements of the PD-(D/E)xK nuclease motif (see Figure 7 ). Note that while the nuclease domains superimpose relatively closely, that the corresponding orientations of additional protein structural elements (such as the domain-swapped helices) and the bound DNA differ by at least 10° from one another. The bottom row shows the superposition of the two bound DNA targets for SwaI and HincII. While the overall bend angle and positions of the flanking bases (at positions 2–4 in each half-site) are similar, the effect of DNA binding and bending on the central two base pairs are radically different. In SwaI the central A:T base pairs are completely disrupted, whereas in HincII (and in EcoRV, not shown) they remain in a bent (but still base-paired) conformation.

    Techniques Used: Binding Assay

    15) Product Images from "The Deaf Jerker Mouse Has a Mutation in the Gene Encoding the Espin Actin-Bundling Proteins of Hair Cell Stereocilia and Fails to Accumulate Espins"

    Article Title: The Deaf Jerker Mouse Has a Mutation in the Gene Encoding the Espin Actin-Bundling Proteins of Hair Cell Stereocilia and Fails to Accumulate Espins

    Journal: Cell

    doi:

    Organization of the Mouse Espin Gene and the Mutation Found in Jerker Mice (A) Revised map of part of the mouse espin gene highlighting the relative sizes and positions of the exons used to construct small espin (t-z) and the portion of espin downstream of the ankyrin-like repeats (n-s, u, and w-z) (PR, exons that encode the proline-rich peptides of espin; ABM, the exons that encode the 116-amino acid shared C-terminal actin-bundling module). Exons t and v, which are specific to small espin, have been shaded. (B and C) Automated DNA sequence analysis of mouse espin and small espin cDNAs and exon x of the mouse espin gene showing that, compared to the wild-type sequences (B), jerker homozygotes (C) are missing a G at the position corresponding to nucleotide 2426 in the coding sequence of mouse espin cDNA. This deletion causes a frameshift mutation that changes the sequence of the shared C-terminal actin-bundling module and is expected to produce a protein that is 24 amino acids shorter because a stop codon is reached at a position corresponding to nucleotide 2543 instead of 2614 in the coding sequence of mouse espin cDNA. The espin and small espin cDNAs and exon x of the espin gene in jerker heterozygotes contain a mixture of the wild-type and mutated sequences. (D and E) Comparisons of the amino acid sequences at the C-termini of mouse wild-type (D) and mutated jerker (E) espins.
    Figure Legend Snippet: Organization of the Mouse Espin Gene and the Mutation Found in Jerker Mice (A) Revised map of part of the mouse espin gene highlighting the relative sizes and positions of the exons used to construct small espin (t-z) and the portion of espin downstream of the ankyrin-like repeats (n-s, u, and w-z) (PR, exons that encode the proline-rich peptides of espin; ABM, the exons that encode the 116-amino acid shared C-terminal actin-bundling module). Exons t and v, which are specific to small espin, have been shaded. (B and C) Automated DNA sequence analysis of mouse espin and small espin cDNAs and exon x of the mouse espin gene showing that, compared to the wild-type sequences (B), jerker homozygotes (C) are missing a G at the position corresponding to nucleotide 2426 in the coding sequence of mouse espin cDNA. This deletion causes a frameshift mutation that changes the sequence of the shared C-terminal actin-bundling module and is expected to produce a protein that is 24 amino acids shorter because a stop codon is reached at a position corresponding to nucleotide 2543 instead of 2614 in the coding sequence of mouse espin cDNA. The espin and small espin cDNAs and exon x of the espin gene in jerker heterozygotes contain a mixture of the wild-type and mutated sequences. (D and E) Comparisons of the amino acid sequences at the C-termini of mouse wild-type (D) and mutated jerker (E) espins.

    Techniques Used: Mutagenesis, Mouse Assay, Construct, Sequencing

    16) Product Images from "A cell-free antibody engineering platform rapidly generates SARS-CoV-2 neutralizing antibodies"

    Article Title: A cell-free antibody engineering platform rapidly generates SARS-CoV-2 neutralizing antibodies

    Journal: bioRxiv

    doi: 10.1101/2020.10.29.361287

    A cell-free antibody engineering platform for rapid isolation of antibodies from large synthetic libraries. ( a ) The workflow takes linear DNA library as input. ( b ) Ribosome display links genotype (RNAs transcribed from DNA input library that are stop codon free, and stall ribosome at the end of the transcript) and phenotype (folded VHH protein tethered to ribosomes due to the lack of stop codon in the RNA). ( c ) Selection cycle that enriches DNA encoding for VHHs that binds immobilized targets. ( d ) High throughput sequencing of full-length VHHs. ( e ) Sequences are grouped into clusters based on similarity of their CDRs, each cluster is distinct and represent a unique binding family. ( f ) The system outputs one representative sequence from each cluster to be synthesized and characterized for specific downstream applications. ( g ) Workflow for generating VHH library. VHH CDR randomization was introduced by PCR using a hairpin oligo (blocks DNA end from ligation) and an oligo with random 5’ sequence, followed by orientation-controlled ligation. Three successive PCR plus ligation cycles randomizes all three CDRs. ( h ) The final DNA library sequence structure. ( i ) One round of ribosome display and anti-Myc selection was performed after randomization of CDR1 and CDR2. The pie chart shows percentage of indicated sequence categories before and after anti-Myc selection. ( j ) Length distribution of DNA region encoding CDR1 of the VHH library before and after anti-Myc selection. Arrows indicate all correct-frame lengths showing increased percentage after anti-Myc selection.
    Figure Legend Snippet: A cell-free antibody engineering platform for rapid isolation of antibodies from large synthetic libraries. ( a ) The workflow takes linear DNA library as input. ( b ) Ribosome display links genotype (RNAs transcribed from DNA input library that are stop codon free, and stall ribosome at the end of the transcript) and phenotype (folded VHH protein tethered to ribosomes due to the lack of stop codon in the RNA). ( c ) Selection cycle that enriches DNA encoding for VHHs that binds immobilized targets. ( d ) High throughput sequencing of full-length VHHs. ( e ) Sequences are grouped into clusters based on similarity of their CDRs, each cluster is distinct and represent a unique binding family. ( f ) The system outputs one representative sequence from each cluster to be synthesized and characterized for specific downstream applications. ( g ) Workflow for generating VHH library. VHH CDR randomization was introduced by PCR using a hairpin oligo (blocks DNA end from ligation) and an oligo with random 5’ sequence, followed by orientation-controlled ligation. Three successive PCR plus ligation cycles randomizes all three CDRs. ( h ) The final DNA library sequence structure. ( i ) One round of ribosome display and anti-Myc selection was performed after randomization of CDR1 and CDR2. The pie chart shows percentage of indicated sequence categories before and after anti-Myc selection. ( j ) Length distribution of DNA region encoding CDR1 of the VHH library before and after anti-Myc selection. Arrows indicate all correct-frame lengths showing increased percentage after anti-Myc selection.

    Techniques Used: Isolation, Selection, Next-Generation Sequencing, Binding Assay, Sequencing, Synthesized, Polymerase Chain Reaction, Ligation

    Working principles for orientation-controlled ligation by end blocking using hairpin oligos. ( a ) working principle for generating one end blocked DNA for orientation-controlled ligation by PCR using a hairpin DNA oligo. ( b ) Representative orientation-controlled ligation products visualized by agarose gel electrophoresis.
    Figure Legend Snippet: Working principles for orientation-controlled ligation by end blocking using hairpin oligos. ( a ) working principle for generating one end blocked DNA for orientation-controlled ligation by PCR using a hairpin DNA oligo. ( b ) Representative orientation-controlled ligation products visualized by agarose gel electrophoresis.

    Techniques Used: Ligation, Blocking Assay, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    17) Product Images from "The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701"

    Article Title: The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.186.17.5576-5584.2004

    Determination of vapA transcriptional start site in R. equi ATCC 33701. Fluorescent primer extension was performed with the Cy5-labeled primer CY5VAPA200R and 5 μg of total cellular RNA extracted from R. equi grown under vapA -inducing conditions (37°C, pH 6.5). CY5VAPA200R is complementary to a sequence 131 bp downstream from the vapA initiation codon. (A) Cy5-labeled primer extension product combined with DNA size standards and analyzed with the CEQ 8000 fragment analysis system. (B) Nucleotide sequence obtained by using VAPA200R. A dideoxy sequencing reaction mix was spiked with the Cy5-labeled primer extension product. The arrow indicates the transcriptional start site where the Cy5-labeled cDNA and the sequencing product overlapped. (C) Sequence of vapA promoter region. The transcriptional start site (+1) and putative −10 and −35 regions are boxed, and putative LysR motifs (T-N 11 -A) are indicated with brackets.
    Figure Legend Snippet: Determination of vapA transcriptional start site in R. equi ATCC 33701. Fluorescent primer extension was performed with the Cy5-labeled primer CY5VAPA200R and 5 μg of total cellular RNA extracted from R. equi grown under vapA -inducing conditions (37°C, pH 6.5). CY5VAPA200R is complementary to a sequence 131 bp downstream from the vapA initiation codon. (A) Cy5-labeled primer extension product combined with DNA size standards and analyzed with the CEQ 8000 fragment analysis system. (B) Nucleotide sequence obtained by using VAPA200R. A dideoxy sequencing reaction mix was spiked with the Cy5-labeled primer extension product. The arrow indicates the transcriptional start site where the Cy5-labeled cDNA and the sequencing product overlapped. (C) Sequence of vapA promoter region. The transcriptional start site (+1) and putative −10 and −35 regions are boxed, and putative LysR motifs (T-N 11 -A) are indicated with brackets.

    Techniques Used: Labeling, Sequencing

    18) Product Images from "Chromatin-Bound Oxidized α-Synuclein Causes Strand Breaks in Neuronal Genomes in in vitro Models of Parkinson’s Disease"

    Article Title: Chromatin-Bound Oxidized α-Synuclein Causes Strand Breaks in Neuronal Genomes in in vitro Models of Parkinson’s Disease

    Journal: Journal of Alzheimer's disease : JAD

    doi: 10.3233/JAD-170342

    α-Syn DNA nicking activity may be mediated by its oxidation. A) Exposure of recombinant α-Syn to 1 O 2 , generated by exposing flavonoid Bengal red to UVB radiation, enhanced its DNA nicking activity with plasmid scDNA in vitro . The products were analyzed by agarose gel electrophoresis. The histogram represents quantification of DNA fragmentation. B) SHSY-5Y cells were exposed to similarly oxidized α-Syn, and DNA damage was quantified by alkaline Comet assay.
    Figure Legend Snippet: α-Syn DNA nicking activity may be mediated by its oxidation. A) Exposure of recombinant α-Syn to 1 O 2 , generated by exposing flavonoid Bengal red to UVB radiation, enhanced its DNA nicking activity with plasmid scDNA in vitro . The products were analyzed by agarose gel electrophoresis. The histogram represents quantification of DNA fragmentation. B) SHSY-5Y cells were exposed to similarly oxidized α-Syn, and DNA damage was quantified by alkaline Comet assay.

    Techniques Used: Activity Assay, Recombinant, Generated, Plasmid Preparation, In Vitro, Agarose Gel Electrophoresis, Alkaline Single Cell Gel Electrophoresis

    Increased α-Syn expression causes DNA breaks in neurons synergistically with pro-oxidant metals. A, B) Alkaline Comet assay in iFLAG-α-Syn SHSY-5Y cells exposed to 200 μM FeSO 4 or CuSO 4 . α-Syn was induced with Dox for 48 h. Metal salts alone at the same concentration caused only moderate increases in strand breaks. C, D) Semi-quantitative LA-PCR assay for genomic DNA isolated from pCW-iFLAG-α-Syn SHSY-5Y cells in the presence of FeSO 4 or CuSO 4 . *** p ≤ 0.001; **** p ≤ 0.0001.
    Figure Legend Snippet: Increased α-Syn expression causes DNA breaks in neurons synergistically with pro-oxidant metals. A, B) Alkaline Comet assay in iFLAG-α-Syn SHSY-5Y cells exposed to 200 μM FeSO 4 or CuSO 4 . α-Syn was induced with Dox for 48 h. Metal salts alone at the same concentration caused only moderate increases in strand breaks. C, D) Semi-quantitative LA-PCR assay for genomic DNA isolated from pCW-iFLAG-α-Syn SHSY-5Y cells in the presence of FeSO 4 or CuSO 4 . *** p ≤ 0.001; **** p ≤ 0.0001.

    Techniques Used: Expressing, Alkaline Single Cell Gel Electrophoresis, Concentration Assay, Polymerase Chain Reaction, Isolation

    MD simulation: α-Syn N-terminal residues may be involved in DNA binding. Protein-DNA docking Model 1 demonstrating binding of α-Syn (PDB: 1XQ8) N-terminal amino acid residues Glu-35, Ser-42, Thr-54 to the crystal structure of d(CCGGTACCGG) as a B-DNA duplex (PDB: 3IXN). This structure model represents the best structure from the biggest cluster after the refinement process. Structures were analyzed using PyMOL Molecular Graphics System, Version 1.7.4.5 Schrödinger, LLC.
    Figure Legend Snippet: MD simulation: α-Syn N-terminal residues may be involved in DNA binding. Protein-DNA docking Model 1 demonstrating binding of α-Syn (PDB: 1XQ8) N-terminal amino acid residues Glu-35, Ser-42, Thr-54 to the crystal structure of d(CCGGTACCGG) as a B-DNA duplex (PDB: 3IXN). This structure model represents the best structure from the biggest cluster after the refinement process. Structures were analyzed using PyMOL Molecular Graphics System, Version 1.7.4.5 Schrödinger, LLC.

    Techniques Used: Binding Assay

    Model illustrating how α-Syn-induced DNA breaks contributes to neuronal apoptosis in PD. The role of pro-oxidant Fe or ROS in promoting α-Syn misfolding and oxidation, which could exacerbate its DNA nicking activity.
    Figure Legend Snippet: Model illustrating how α-Syn-induced DNA breaks contributes to neuronal apoptosis in PD. The role of pro-oxidant Fe or ROS in promoting α-Syn misfolding and oxidation, which could exacerbate its DNA nicking activity.

    Techniques Used: Activity Assay

    Nuclear localization and chromatin/DNA binding of α-Syn. A, B) Characterization of time-dependent induction of FLAG-α-Syn in a SHSY-5Y cell line stably harboring tet-on (Dox-inducible) pCW-iFLAG-α-Syn vector. Immunoblotting (A) and immunofluorescence (B) revealed a time-dependent increase (2–4-fold) in both FLAG and total α-Syn levels after induction with Dox for 24–72 h in differentiated cells. The presence of nuclear α-Syn after 72 h of Dox induction is indicated in the enlarged image. C) PLA of FLAG versus α-Syn antibody in pCW-iFLAG-α-Syn SHSY-5Y cells. A PLA focus in the nucleus (DAPI) detected the same molecule of ectopic α-Syn. PLA of FLAG versus histone H3 antibody confirmed interaction with H3 in the nucleus. D) ChIP assay using FLAG antibody from pCW-iFLAG-α-Syn SHSY-5Y cells after Dox induction (72 h) and real-time PCR amplification using three randomly selected primer pairs. E) In vitro biotin affinity co-elution analysis. Immunoblotting of SHSY-5Y cell nuclear extract or recombinant α-Syn co-eluted with biotin-labeled duplex DNA oligo.
    Figure Legend Snippet: Nuclear localization and chromatin/DNA binding of α-Syn. A, B) Characterization of time-dependent induction of FLAG-α-Syn in a SHSY-5Y cell line stably harboring tet-on (Dox-inducible) pCW-iFLAG-α-Syn vector. Immunoblotting (A) and immunofluorescence (B) revealed a time-dependent increase (2–4-fold) in both FLAG and total α-Syn levels after induction with Dox for 24–72 h in differentiated cells. The presence of nuclear α-Syn after 72 h of Dox induction is indicated in the enlarged image. C) PLA of FLAG versus α-Syn antibody in pCW-iFLAG-α-Syn SHSY-5Y cells. A PLA focus in the nucleus (DAPI) detected the same molecule of ectopic α-Syn. PLA of FLAG versus histone H3 antibody confirmed interaction with H3 in the nucleus. D) ChIP assay using FLAG antibody from pCW-iFLAG-α-Syn SHSY-5Y cells after Dox induction (72 h) and real-time PCR amplification using three randomly selected primer pairs. E) In vitro biotin affinity co-elution analysis. Immunoblotting of SHSY-5Y cell nuclear extract or recombinant α-Syn co-eluted with biotin-labeled duplex DNA oligo.

    Techniques Used: Binding Assay, Stable Transfection, Plasmid Preparation, Immunofluorescence, Proximity Ligation Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Amplification, In Vitro, Co-Elution Assay, Recombinant, Labeling

    Recombinant α-Syn nicks naked DNA in vitro , which is enhanced by its misfolding/oligomerization. A) Agarose gel electrophoresis showing plasmid scDNA cleavage by recombinant α-Syn. B) Assessment of SSBs and DSBs in scDNA induced by α-Syn. Values are expressed as SSBs and DSBs induced per μg of scDNA. C) Recombinant α-Syn was incubated with constant stirring to cause its aggregation, which was monitored by Thio T fluorescence analysis with an aliquot of α-Syn taken at various time intervals. D) The α-Syn aliquots were also analyzed for their DNA nicking activity with plasmid DNA by agarose gel electrophoresis. E) DNA breaks were quantified. F) Misfolding/β-sheet formation in α-Syn upon stirring as confirmed by CD spectroscopy.
    Figure Legend Snippet: Recombinant α-Syn nicks naked DNA in vitro , which is enhanced by its misfolding/oligomerization. A) Agarose gel electrophoresis showing plasmid scDNA cleavage by recombinant α-Syn. B) Assessment of SSBs and DSBs in scDNA induced by α-Syn. Values are expressed as SSBs and DSBs induced per μg of scDNA. C) Recombinant α-Syn was incubated with constant stirring to cause its aggregation, which was monitored by Thio T fluorescence analysis with an aliquot of α-Syn taken at various time intervals. D) The α-Syn aliquots were also analyzed for their DNA nicking activity with plasmid DNA by agarose gel electrophoresis. E) DNA breaks were quantified. F) Misfolding/β-sheet formation in α-Syn upon stirring as confirmed by CD spectroscopy.

    Techniques Used: Recombinant, In Vitro, Agarose Gel Electrophoresis, Plasmid Preparation, Incubation, Fluorescence, Activity Assay, Spectroscopy

    DNA damage in neurons generated from normal and PD patient-derived SNCA -tri iPSC cells. A) Phase contrast image demonstrating generation of NPCs from iPSCs: (a) SNCA- tri iPSCs cultured in MEF feeder layer, (b) SNCA- tri iPSCs cultured in feeder free layer, (c) day 2, (d) day 4, (e) day 6 of neural induction for NPC derivation, (f) NPC at passage 3. The iPSC specific marker Oct4 and neural precursor markers nestin analyzed by immunoblotting (B). C) Immunofluorescence characterization with nestin and α-Syn protein expression. D) α-SYN mRNA quantitation in control versus SNCA-tri iPSC and NPC cells. E, F) LA-PCR analysis of genomic DNA isolated from control or SNCA -tri NPC cells exposed to 200 μM FeSO 4 or CuSO 4 . *** p ≤ 0.001.
    Figure Legend Snippet: DNA damage in neurons generated from normal and PD patient-derived SNCA -tri iPSC cells. A) Phase contrast image demonstrating generation of NPCs from iPSCs: (a) SNCA- tri iPSCs cultured in MEF feeder layer, (b) SNCA- tri iPSCs cultured in feeder free layer, (c) day 2, (d) day 4, (e) day 6 of neural induction for NPC derivation, (f) NPC at passage 3. The iPSC specific marker Oct4 and neural precursor markers nestin analyzed by immunoblotting (B). C) Immunofluorescence characterization with nestin and α-Syn protein expression. D) α-SYN mRNA quantitation in control versus SNCA-tri iPSC and NPC cells. E, F) LA-PCR analysis of genomic DNA isolated from control or SNCA -tri NPC cells exposed to 200 μM FeSO 4 or CuSO 4 . *** p ≤ 0.001.

    Techniques Used: Generated, Derivative Assay, Cell Culture, Marker, Immunofluorescence, Expressing, Quantitation Assay, Polymerase Chain Reaction, Isolation

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Development of a Quantitative Methylation-Specific Polymerase Chain Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes
    Article Snippet: Briefly, purified mouse islets were dispersed on-enzymatically and the resultant single cell suspension sorted by flow cytometry based on autofluorescence of the beta cells. .. PCR cloning of a fragment from mouse insulin gene The 842 bp fragment of the mouse insulin gene (Ins2 ) from −480 to +362, containing nine CpG sites at positions −414, −182, and −171 in the promoter, +14 in exon 1, +121 in intron 1, and at +190, +310, +337, and +340 in exon 2, was PCR amplified from mouse gDNA using primers Ins2-pro-For and Ins2-pro-Rev ( ) and high-fidelity thermophilic DNA polymerase (Deep Vent DNA polymerase, NEB). .. The PCR product was cloned into pCR2.1-TOPO plasmid vector using the TOPO-TA cloning kit (Invitrogen).

    Article Title: Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis
    Article Snippet: Expression plasmidsThe FLAG-TDP-43 WT pcDNA 3.1(+) expression plasmid was a kind gift from Prof. Paul Taylor (St. Jude Children’s Research Hospital; Memphis, TN). pCW-Cas9 was a gift from Eric Lander and David Sabatini (Addgene plasmid # 50661). .. The TDP-43 coding DNA sequence (CDS) along with the N-terminal 1X FLAG tag sequence was PCR-amplified from FLAG-TDP-43 pcDNA 3.1 vector using high-fidelity Deep Vent DNA polymerase (# M0258, NEB, Ipswich, MA). .. The following primers were used for PCR amplification: Fl-TDP43-F: 5′-CGGCGCTAGCATGGACTACAAAGACGATGACGACAAGTCTGAATATATTCGGGTAAC-3′ and Fl-TDP43-R: 5′-CAACGGATCCCTACATTCCCCAGCCAGAAGACTTAGAATCCA-3′.

    Article Title: Identification and removal of colanic acid from plasmid DNA preparations: implications for gene therapy
    Article Snippet: .. PCR amplification of the NST1 phage genomic DNA using Deep Vent DNA Polymerase (New England BioLabs, Ipswich, MA, USA) for the CAE ORF extending from amino acids 107–790 with inclusion of an Nterminal methionine followed by glycine and then 6 histidines in the forward primer was performed. ..

    Clone Assay:

    Article Title: Development of a Quantitative Methylation-Specific Polymerase Chain Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes
    Article Snippet: Briefly, purified mouse islets were dispersed on-enzymatically and the resultant single cell suspension sorted by flow cytometry based on autofluorescence of the beta cells. .. PCR cloning of a fragment from mouse insulin gene The 842 bp fragment of the mouse insulin gene (Ins2 ) from −480 to +362, containing nine CpG sites at positions −414, −182, and −171 in the promoter, +14 in exon 1, +121 in intron 1, and at +190, +310, +337, and +340 in exon 2, was PCR amplified from mouse gDNA using primers Ins2-pro-For and Ins2-pro-Rev ( ) and high-fidelity thermophilic DNA polymerase (Deep Vent DNA polymerase, NEB). .. The PCR product was cloned into pCR2.1-TOPO plasmid vector using the TOPO-TA cloning kit (Invitrogen).

    Amplification:

    Article Title: Development of a Quantitative Methylation-Specific Polymerase Chain Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes
    Article Snippet: Briefly, purified mouse islets were dispersed on-enzymatically and the resultant single cell suspension sorted by flow cytometry based on autofluorescence of the beta cells. .. PCR cloning of a fragment from mouse insulin gene The 842 bp fragment of the mouse insulin gene (Ins2 ) from −480 to +362, containing nine CpG sites at positions −414, −182, and −171 in the promoter, +14 in exon 1, +121 in intron 1, and at +190, +310, +337, and +340 in exon 2, was PCR amplified from mouse gDNA using primers Ins2-pro-For and Ins2-pro-Rev ( ) and high-fidelity thermophilic DNA polymerase (Deep Vent DNA polymerase, NEB). .. The PCR product was cloned into pCR2.1-TOPO plasmid vector using the TOPO-TA cloning kit (Invitrogen).

    Article Title: The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701
    Article Snippet: The product was ligated into the EcoRV site of pRE7 , yielding pR6VT. pForlan21 was constructed as follows. .. ORF8 was amplified with Deep Vent DNA polymerase and oligonucleotides 008F and 102R (Table ). .. The resulting PCR product was digested with EcoRI and the 736-bp fragment was ligated into SmaI-EcoRI-digested pBluescript II KS (Stratagene), yielding pPCR-RR.

    Article Title: Ubiquitin-editing enzyme A20 promotes tolerance to LPS in enterocytes 1
    Article Snippet: RNA bands were quantified by densitometry of underexposed autoradiograms using GelDoc scanner and Quantity One software (Bio-Rad). .. Rat A20 open reading frame was amplified using primers CACCATGGCTGAACAACTTCTTCCT and GGCGTACATCTGCTTGAACTG, Deep Vent DNA polymerase (New England Biolabs), Moloney reverse transcriptase, and RNA from LPS-treated IEC-6 cells. .. Resulting RT-PCR product was inserted into pcDNA3.1-V5His (Invitrogen) to yield pcDNA3-A20.

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications
    Article Snippet: .. Perhaps this was the reason why Deep-VentR DNA polymerase, which has high strand displacement ability, instead of reducing the production of partial amplification products acting as mega-primers, made only some minor improvements. .. In conclusion, through the sequencing of PCR artifact products from two different repetitive DNA templates (12 × 100 bp as direct repeats and 2 × 717 bp as direct or inverted repeats) and the systematic analyses of selected DNA polymerases available in the market along with various other conditions, we were able to model the mechanisms leading to these artifacts.

    Article Title: Identification and removal of colanic acid from plasmid DNA preparations: implications for gene therapy
    Article Snippet: .. PCR amplification of the NST1 phage genomic DNA using Deep Vent DNA Polymerase (New England BioLabs, Ipswich, MA, USA) for the CAE ORF extending from amino acids 107–790 with inclusion of an Nterminal methionine followed by glycine and then 6 histidines in the forward primer was performed. ..

    Sequencing:

    Article Title: Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis
    Article Snippet: Expression plasmidsThe FLAG-TDP-43 WT pcDNA 3.1(+) expression plasmid was a kind gift from Prof. Paul Taylor (St. Jude Children’s Research Hospital; Memphis, TN). pCW-Cas9 was a gift from Eric Lander and David Sabatini (Addgene plasmid # 50661). .. The TDP-43 coding DNA sequence (CDS) along with the N-terminal 1X FLAG tag sequence was PCR-amplified from FLAG-TDP-43 pcDNA 3.1 vector using high-fidelity Deep Vent DNA polymerase (# M0258, NEB, Ipswich, MA). .. The following primers were used for PCR amplification: Fl-TDP43-F: 5′-CGGCGCTAGCATGGACTACAAAGACGATGACGACAAGTCTGAATATATTCGGGTAAC-3′ and Fl-TDP43-R: 5′-CAACGGATCCCTACATTCCCCAGCCAGAAGACTTAGAATCCA-3′.

    FLAG-tag:

    Article Title: Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis
    Article Snippet: Expression plasmidsThe FLAG-TDP-43 WT pcDNA 3.1(+) expression plasmid was a kind gift from Prof. Paul Taylor (St. Jude Children’s Research Hospital; Memphis, TN). pCW-Cas9 was a gift from Eric Lander and David Sabatini (Addgene plasmid # 50661). .. The TDP-43 coding DNA sequence (CDS) along with the N-terminal 1X FLAG tag sequence was PCR-amplified from FLAG-TDP-43 pcDNA 3.1 vector using high-fidelity Deep Vent DNA polymerase (# M0258, NEB, Ipswich, MA). .. The following primers were used for PCR amplification: Fl-TDP43-F: 5′-CGGCGCTAGCATGGACTACAAAGACGATGACGACAAGTCTGAATATATTCGGGTAAC-3′ and Fl-TDP43-R: 5′-CAACGGATCCCTACATTCCCCAGCCAGAAGACTTAGAATCCA-3′.

    Plasmid Preparation:

    Article Title: Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis
    Article Snippet: Expression plasmidsThe FLAG-TDP-43 WT pcDNA 3.1(+) expression plasmid was a kind gift from Prof. Paul Taylor (St. Jude Children’s Research Hospital; Memphis, TN). pCW-Cas9 was a gift from Eric Lander and David Sabatini (Addgene plasmid # 50661). .. The TDP-43 coding DNA sequence (CDS) along with the N-terminal 1X FLAG tag sequence was PCR-amplified from FLAG-TDP-43 pcDNA 3.1 vector using high-fidelity Deep Vent DNA polymerase (# M0258, NEB, Ipswich, MA). .. The following primers were used for PCR amplification: Fl-TDP43-F: 5′-CGGCGCTAGCATGGACTACAAAGACGATGACGACAAGTCTGAATATATTCGGGTAAC-3′ and Fl-TDP43-R: 5′-CAACGGATCCCTACATTCCCCAGCCAGAAGACTTAGAATCCA-3′.

    Activity Assay:

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications
    Article Snippet: .. Deep-VentR DNA polymerase (NE Biolabs) was advertised as the polymerase with one of the highest strand displacement activity and is suitable for thermal cycling. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    New England Biolabs high fidelity thermophilic dna polymerase
    Effect of non-specific <t>gDNA</t> on the specificity and sensitivity of MSP. The unmethylated Ins2 gene plasmid was diluted in the presence or absence of 500 ng non-specific gDNA, bisulfite-treated, and used as template for PCR. A) 160, 80, 40, 20, 10, 5, and 2 copies of plasmid without non-specific <t>DNA</t> analyzed by qMSP using primer set P4/P6. B) Serial dilutions ranged from 10 8 to 10 copies of plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P4/P6. C) Serial dilution from 10 8 to 3 copies of plasmid in the absence of non-specific gDNA analyzed by qMSP using primer set P12/P13. D) Range of serial dilutions from 10 7 to 10 copies plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P12/P13. Mouse liver gDNA was used as non-specific DNA and NTC is the non-template control.
    High Fidelity Thermophilic Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity thermophilic dna polymerase/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    high fidelity thermophilic dna polymerase - by Bioz Stars, 2021-05
    96/100 stars
      Buy from Supplier

    Image Search Results


    Effect of non-specific gDNA on the specificity and sensitivity of MSP. The unmethylated Ins2 gene plasmid was diluted in the presence or absence of 500 ng non-specific gDNA, bisulfite-treated, and used as template for PCR. A) 160, 80, 40, 20, 10, 5, and 2 copies of plasmid without non-specific DNA analyzed by qMSP using primer set P4/P6. B) Serial dilutions ranged from 10 8 to 10 copies of plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P4/P6. C) Serial dilution from 10 8 to 3 copies of plasmid in the absence of non-specific gDNA analyzed by qMSP using primer set P12/P13. D) Range of serial dilutions from 10 7 to 10 copies plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P12/P13. Mouse liver gDNA was used as non-specific DNA and NTC is the non-template control.

    Journal: PLoS ONE

    Article Title: Development of a Quantitative Methylation-Specific Polymerase Chain Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes

    doi: 10.1371/journal.pone.0047942

    Figure Lengend Snippet: Effect of non-specific gDNA on the specificity and sensitivity of MSP. The unmethylated Ins2 gene plasmid was diluted in the presence or absence of 500 ng non-specific gDNA, bisulfite-treated, and used as template for PCR. A) 160, 80, 40, 20, 10, 5, and 2 copies of plasmid without non-specific DNA analyzed by qMSP using primer set P4/P6. B) Serial dilutions ranged from 10 8 to 10 copies of plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P4/P6. C) Serial dilution from 10 8 to 3 copies of plasmid in the absence of non-specific gDNA analyzed by qMSP using primer set P12/P13. D) Range of serial dilutions from 10 7 to 10 copies plasmid in the presence of non-specific gDNA analyzed by qMSP using primer set P12/P13. Mouse liver gDNA was used as non-specific DNA and NTC is the non-template control.

    Article Snippet: PCR cloning of a fragment from mouse insulin gene The 842 bp fragment of the mouse insulin gene (Ins2 ) from −480 to +362, containing nine CpG sites at positions −414, −182, and −171 in the promoter, +14 in exon 1, +121 in intron 1, and at +190, +310, +337, and +340 in exon 2, was PCR amplified from mouse gDNA using primers Ins2-pro-For and Ins2-pro-Rev ( ) and high-fidelity thermophilic DNA polymerase (Deep Vent DNA polymerase, NEB).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Serial Dilution

    Quantification of circulating beta cell DNA in STZ-treated diabetic mice. NOD/scid mice were injected with STZ at days 0, 1, and 2, and blood was collected pre-treatment and post-treatment days 1, 2, 3, 5, 6, 7, 14, and 35. A) Blood glucose levels for untreated (n = 3) and STZ-injected (n = 34) NOD/scid mice were measured at days 1 (n = 6), 2 (n = 4), 5 (n = 4), 6 (n = 8), 7 (n = 4), 14 (n = 4) and 35 (n = 4) after injection. In parallel, qMSP was done using bisulfite converted gDNA obtained from the blood of untreated (n = 3) and STZ-treated mice at designated time points. Fold changes in demethylation are measured by calculation of ΔΔC q (B), Relative Expression Ration (C) or Demethylation Index (D) for each sample using methylation-specific primers P12/P13 and bisulfite-specific primers P16/P17. The cloned Ins2 gene was used for normalization and standardization of the results as described under Material and Methods. The data display the mean ± standard error (SEM) of three independent measurements. The statistical significance was calculated with the Student t test for unpaired values and significance level indicated by asterisks (*, P

    Journal: PLoS ONE

    Article Title: Development of a Quantitative Methylation-Specific Polymerase Chain Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes

    doi: 10.1371/journal.pone.0047942

    Figure Lengend Snippet: Quantification of circulating beta cell DNA in STZ-treated diabetic mice. NOD/scid mice were injected with STZ at days 0, 1, and 2, and blood was collected pre-treatment and post-treatment days 1, 2, 3, 5, 6, 7, 14, and 35. A) Blood glucose levels for untreated (n = 3) and STZ-injected (n = 34) NOD/scid mice were measured at days 1 (n = 6), 2 (n = 4), 5 (n = 4), 6 (n = 8), 7 (n = 4), 14 (n = 4) and 35 (n = 4) after injection. In parallel, qMSP was done using bisulfite converted gDNA obtained from the blood of untreated (n = 3) and STZ-treated mice at designated time points. Fold changes in demethylation are measured by calculation of ΔΔC q (B), Relative Expression Ration (C) or Demethylation Index (D) for each sample using methylation-specific primers P12/P13 and bisulfite-specific primers P16/P17. The cloned Ins2 gene was used for normalization and standardization of the results as described under Material and Methods. The data display the mean ± standard error (SEM) of three independent measurements. The statistical significance was calculated with the Student t test for unpaired values and significance level indicated by asterisks (*, P

    Article Snippet: PCR cloning of a fragment from mouse insulin gene The 842 bp fragment of the mouse insulin gene (Ins2 ) from −480 to +362, containing nine CpG sites at positions −414, −182, and −171 in the promoter, +14 in exon 1, +121 in intron 1, and at +190, +310, +337, and +340 in exon 2, was PCR amplified from mouse gDNA using primers Ins2-pro-For and Ins2-pro-Rev ( ) and high-fidelity thermophilic DNA polymerase (Deep Vent DNA polymerase, NEB).

    Techniques: Mouse Assay, Injection, Expressing, Methylation, Clone Assay

    Rationale for selection of the primers that differentiate between methylated and unmethylated CpG. A) Schematic illustration of the mouse Ins2 gene with promoter region (blue), exon 1 (yellow), intron 1 (white), and exon 2 (green) showing the positions of CpG sites and the primers used in this study. Black arrows represent the bisulfite-specific primers (BSP) that amplify both methylated and unmethylated DNA. Red arrows represent methylation-specific primers (MSP) that amplify unmethylated but not methylated DNA. B) Gel electrophoresis (3% agarose) of PCR products amplified by reactions using different primer sets and the cloned Ins2 gene as template. The clone was methylated (M) or sham methylated (N) and bisulfite-treated prior to use in the reactions. NTC means non-template control. TSS indicates the transcription starting site.

    Journal: PLoS ONE

    Article Title: Development of a Quantitative Methylation-Specific Polymerase Chain Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes

    doi: 10.1371/journal.pone.0047942

    Figure Lengend Snippet: Rationale for selection of the primers that differentiate between methylated and unmethylated CpG. A) Schematic illustration of the mouse Ins2 gene with promoter region (blue), exon 1 (yellow), intron 1 (white), and exon 2 (green) showing the positions of CpG sites and the primers used in this study. Black arrows represent the bisulfite-specific primers (BSP) that amplify both methylated and unmethylated DNA. Red arrows represent methylation-specific primers (MSP) that amplify unmethylated but not methylated DNA. B) Gel electrophoresis (3% agarose) of PCR products amplified by reactions using different primer sets and the cloned Ins2 gene as template. The clone was methylated (M) or sham methylated (N) and bisulfite-treated prior to use in the reactions. NTC means non-template control. TSS indicates the transcription starting site.

    Article Snippet: PCR cloning of a fragment from mouse insulin gene The 842 bp fragment of the mouse insulin gene (Ins2 ) from −480 to +362, containing nine CpG sites at positions −414, −182, and −171 in the promoter, +14 in exon 1, +121 in intron 1, and at +190, +310, +337, and +340 in exon 2, was PCR amplified from mouse gDNA using primers Ins2-pro-For and Ins2-pro-Rev ( ) and high-fidelity thermophilic DNA polymerase (Deep Vent DNA polymerase, NEB).

    Techniques: Selection, Methylation, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Amplification, Clone Assay

    The Q331K mutation affects the nuclear translocation of XRCC4-DNA ligase 4. ( A ) IF of DNA ligase 4 in WT or Q331K cells shows increased cytoplasmic presence in mutant cells (Scale bar, 10 μm). The 2.5-dimensional view of the localization is shown in the image below. ( B ) IF of XRCC4 in WT or Q331K cells shows their reduced nuclear presence in mutant cells (Scale bar, 10 μm). The 2.5-dimensional view of the localization is shown in the image below. ( C ) PLA of FLAG versus DNA ligase 4 and FLAG versus XRCC4 in cells expressing WT and mutant TDP-43 (Scale bar, 10 μm). The higher number of foci in the cytoplasm of Q331K-expressing cells compared to WT-expressing cells indicates the increased interaction of XRCC4-DNA ligase 4 after DNA-damage induction by IR (3 Gy). ** P

    Journal: Human Molecular Genetics

    Article Title: Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis

    doi: 10.1093/hmg/ddz062

    Figure Lengend Snippet: The Q331K mutation affects the nuclear translocation of XRCC4-DNA ligase 4. ( A ) IF of DNA ligase 4 in WT or Q331K cells shows increased cytoplasmic presence in mutant cells (Scale bar, 10 μm). The 2.5-dimensional view of the localization is shown in the image below. ( B ) IF of XRCC4 in WT or Q331K cells shows their reduced nuclear presence in mutant cells (Scale bar, 10 μm). The 2.5-dimensional view of the localization is shown in the image below. ( C ) PLA of FLAG versus DNA ligase 4 and FLAG versus XRCC4 in cells expressing WT and mutant TDP-43 (Scale bar, 10 μm). The higher number of foci in the cytoplasm of Q331K-expressing cells compared to WT-expressing cells indicates the increased interaction of XRCC4-DNA ligase 4 after DNA-damage induction by IR (3 Gy). ** P

    Article Snippet: The TDP-43 coding DNA sequence (CDS) along with the N-terminal 1X FLAG tag sequence was PCR-amplified from FLAG-TDP-43 pcDNA 3.1 vector using high-fidelity Deep Vent DNA polymerase (# M0258, NEB, Ipswich, MA).

    Techniques: Mutagenesis, Translocation Assay, Proximity Ligation Assay, Expressing

    Q331K expression induces ROS stress and accumulation DNA strand breaks in neurons. ( A ) Cellular Reactive Oxygen Species Detection Assay by IF microscopy. Upper panels represent WT-expressing cells; lower panels represent Q331K-expressing cells. The two panels on the left represent uninduced cells. Panels to the right represent cells after Dox induction. Deep RED dye staining indicates the presence of ROS (Scale bar, 10 μm). ( B ) Quantitation of cellular ROS using a microplate fluorescence reader. ( C ) LA-PCR analysis of genomic DNA isolated from TDP-43-Q331K neurons shows reduced DNA integrity. Representative agarose gel images of amplified DNA products. ( D ) Quantification of PCR products by Pico Green-based DNA quantitation from triplicate experiments. ( E ) Alkaline comet analysis of differentiated SH-SY5Y cells expressing WT or Q331K (lower panel). Quantitation of mean tail moment before and after Dox induction in 25–50 cells reveals an ~5-fold increase in DNA damage in Q331K cells (Scale bar, 10 μm). * P

    Journal: Human Molecular Genetics

    Article Title: Amyotrophic lateral sclerosis-associated TDP-43 mutation Q331K prevents nuclear translocation of XRCC4-DNA ligase 4 complex and is linked to genome damage-mediated neuronal apoptosis

    doi: 10.1093/hmg/ddz062

    Figure Lengend Snippet: Q331K expression induces ROS stress and accumulation DNA strand breaks in neurons. ( A ) Cellular Reactive Oxygen Species Detection Assay by IF microscopy. Upper panels represent WT-expressing cells; lower panels represent Q331K-expressing cells. The two panels on the left represent uninduced cells. Panels to the right represent cells after Dox induction. Deep RED dye staining indicates the presence of ROS (Scale bar, 10 μm). ( B ) Quantitation of cellular ROS using a microplate fluorescence reader. ( C ) LA-PCR analysis of genomic DNA isolated from TDP-43-Q331K neurons shows reduced DNA integrity. Representative agarose gel images of amplified DNA products. ( D ) Quantification of PCR products by Pico Green-based DNA quantitation from triplicate experiments. ( E ) Alkaline comet analysis of differentiated SH-SY5Y cells expressing WT or Q331K (lower panel). Quantitation of mean tail moment before and after Dox induction in 25–50 cells reveals an ~5-fold increase in DNA damage in Q331K cells (Scale bar, 10 μm). * P

    Article Snippet: The TDP-43 coding DNA sequence (CDS) along with the N-terminal 1X FLAG tag sequence was PCR-amplified from FLAG-TDP-43 pcDNA 3.1 vector using high-fidelity Deep Vent DNA polymerase (# M0258, NEB, Ipswich, MA).

    Techniques: Expressing, Detection Assay, Microscopy, Staining, Quantitation Assay, Fluorescence, Polymerase Chain Reaction, Isolation, Agarose Gel Electrophoresis, Amplification

    Transcriptional organization of virR gene cluster. (A) Genetic organization of DNA region harboring ORF3 to ORF9. The arrow above the map denotes the direction of transcription of the polycistronic message. Arrows below the illustration indicate oligonucleotide primers used for RT-PCR. (B) Results of RT-PCR analyses. Each oligonucleotide pair was used in three amplification reactions, with 2 μl of the reverse transcriptase-containing reaction (cDNA), without reverse transcriptase (−RT), and with R. equi ATCC 33701 genomic DNA (DNA). The oligonucleotide pairs used were 003R and 004R (i), 004F and 005R (ii), 005F and 006R (iii), 006F and 007NR (iv), 007NF and 008R (v), and 008F and 009R (vi). The size of each band is indicated.

    Journal: Journal of Bacteriology

    Article Title: The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701

    doi: 10.1128/JB.186.17.5576-5584.2004

    Figure Lengend Snippet: Transcriptional organization of virR gene cluster. (A) Genetic organization of DNA region harboring ORF3 to ORF9. The arrow above the map denotes the direction of transcription of the polycistronic message. Arrows below the illustration indicate oligonucleotide primers used for RT-PCR. (B) Results of RT-PCR analyses. Each oligonucleotide pair was used in three amplification reactions, with 2 μl of the reverse transcriptase-containing reaction (cDNA), without reverse transcriptase (−RT), and with R. equi ATCC 33701 genomic DNA (DNA). The oligonucleotide pairs used were 003R and 004R (i), 004F and 005R (ii), 005F and 006R (iii), 006F and 007NR (iv), 007NF and 008R (v), and 008F and 009R (vi). The size of each band is indicated.

    Article Snippet: ORF8 was amplified with Deep Vent DNA polymerase and oligonucleotides 008F and 102R (Table ).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification

    A20 is necessary and sufficient for the development of tolerance to LPS in IEC-6 cells. A , Levels of phospho-p38, IkB, and phospho-c-Jun in cells stably transfected with pcDNA3.1-V5His or pcDNA3-A20 and treated with LPS, UV, IL-17, or CpG DNA for indicated

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    Article Title: Ubiquitin-editing enzyme A20 promotes tolerance to LPS in enterocytes 1

    doi: 10.4049/jimmunol.0803987

    Figure Lengend Snippet: A20 is necessary and sufficient for the development of tolerance to LPS in IEC-6 cells. A , Levels of phospho-p38, IkB, and phospho-c-Jun in cells stably transfected with pcDNA3.1-V5His or pcDNA3-A20 and treated with LPS, UV, IL-17, or CpG DNA for indicated

    Article Snippet: Rat A20 open reading frame was amplified using primers CACCATGGCTGAACAACTTCTTCCT and GGCGTACATCTGCTTGAACTG, Deep Vent DNA polymerase (New England Biolabs), Moloney reverse transcriptase, and RNA from LPS-treated IEC-6 cells.

    Techniques: Stable Transfection, Transfection