m mulv  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    M MuLV Reverse Transcriptase
    Description:
    M MuLV Reverse Transcriptase 50 000 units
    Catalog Number:
    m0253l
    Price:
    288
    Size:
    50 000 units
    Category:
    Reverse Transcriptases
    Buy from Supplier


    Structured Review

    New England Biolabs m mulv
    M MuLV Reverse Transcriptase
    M MuLV Reverse Transcriptase 50 000 units
    https://www.bioz.com/result/m mulv/product/New England Biolabs
    Average 95 stars, based on 70 article reviews
    Price from $9.99 to $1999.99
    m mulv - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes"

    Article Title: Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw028

    Reverse transcription using AHP dUTP. ( A ) RNA template T5 with primer P3. ( B and C ) Twenty percent denaturing PAGE analysis of reactions using AMV and M-MuLV (RNase H-) reverse transcriptases at 42°C for 15 h.
    Figure Legend Snippet: Reverse transcription using AHP dUTP. ( A ) RNA template T5 with primer P3. ( B and C ) Twenty percent denaturing PAGE analysis of reactions using AMV and M-MuLV (RNase H-) reverse transcriptases at 42°C for 15 h.

    Techniques Used: Polyacrylamide Gel Electrophoresis

    Related Articles

    Clone Assay:

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems). .. A Gapdh -specific TaqMan probe (catalog no. 4352339) was used to normalize mRNA expression.

    Amplification:

    Article Title: Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum 1
    Article Snippet: The cells were frozen immediately, disrupted in liquid N2 , and total RNA was extracted as described by . cDNA was synthesized with M-MuLV Reverse Transcriptase (New England Bio Labs Inc., Beverly, MA) and oligo (dT)15 primer. .. A partial nucleotide sequence of CA cDNA was amplified by PCR, on the assumption that P. tricornutum CA is homologous to β-CAs.

    Article Title: The Imbalance between Foxp3+Tregs and Th1/Th17/Th22 Cells in Patients with Newly Diagnosed Autoimmune Hepatitis
    Article Snippet: Total RNA of 2 μ g was reverse transcribed with hexamer and M-MuLV reverse transcriptase (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. cDNA corresponding to 25 ng of total RNA was subjected to quantitative PCR (qPCR) using primer sets and TaqMan probes corresponding to murine Foxp3, T-bet, AHR, ROR γ t, and GAPDH with qPCR Master Mix. .. Promoter-specific primers were used for amplification: FOXP3 (forward: 5 ′ -AGGAGAAAGCGGATACCA- ′ 3 and reverse: 5 ′ -TGTGAGGACTACCGAGCC- ′ 3 ), T-bet (forward: 5 ′ -TCTTACTGGCTGGGAACACC- ′ 3 and reverse: 5 ′ -GCAGAGGGTAGGAATGTGGG- ′ 3 ), AHR (forward: 5 ′ -AGAATCCCACATCCGCATGATT- ′ 3 and reverse: 5 ′ -CATTGGACTGGACCCACCTC- ′ 3 ), ROR γ t (forward: 5 ′ -CCAGCTACCAGAGGAAGTCAA- ′ 3 and reverse: 5 ′ -TCCATGAAGCCTGAAAGCCG- ′ 3 ), and GAPDH forward: 5 ′ -TGTGTCCGTCGTGGATCTGA- ′ 3 and reverse: 5 ′ -TTGCTGTTGAAGTCGCAGGAG- ′ 3 ).

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: After prehybridization with QuikHyb (Stratagene), the membrane was hybridized with a Cyld -specific radioactive probe amplified using the primers GATTCCTTTTAGCAGAGCAG (forward) and AATTGTACTTTCAACACTTGC (reverse) and exposed to film overnight. .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems).

    Synthesized:

    Article Title: Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum 1
    Article Snippet: .. The cells were frozen immediately, disrupted in liquid N2 , and total RNA was extracted as described by . cDNA was synthesized with M-MuLV Reverse Transcriptase (New England Bio Labs Inc., Beverly, MA) and oligo (dT)15 primer. .. Degenerate primers were designed according to the amino acid sequence of the N-terminal end of the purified CA (PtCAF1: 5′-CGC GGA TCC GAY ATI ACI GAR ATH TTY GAY GG-3′) and according to two published nucleotide sequences of β-CAs from Coccomyxa sp. ( ) and P. purpreum ( ; PtCAR1: 5′-CCG GAA TTC CCA TNG CNK CYT GIA CHA T-3′), which corresponded to the sequences of DITEIFDG and IVQ(A/D) AW(A/D), respectively.

    Article Title: Monitoring Interactions and Dynamics of Endogenous Beta-catenin With Intracellular Nanobodies in Living Cells *
    Article Snippet: .. Using M-MuLV reverse transcriptase (New England Biolabs, Frankfurt, Germany) and hexanucleotide primers (dN6 -primers, Sigma Aldrich) cDNA was synthesized. .. Real-time PCR analysis was conducted with a StepOne Plus system (Applied Biosystems, Invitrogen) using standard predesigned TaqMan probes for GAPDH and β-catenin and a custom-made probe for TagGFP (Invitrogen).

    Article Title: An influential meal: host plant dependent transcriptional variation in the beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae)
    Article Snippet: .. Synthesis of first strand cDNA was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H− ), subsequently second strand cDNA was synthesized using DNA polymerase I and RNase H. After terminal repair of the sequences, the 3′ ends were adenylated and NEBnext adapters (NEB, MA, USA) were ligated. .. The library fragments were purified, for a 150–200 bp size range, with AMpure XP purification kit (Beckman Coulter, MA, USA).

    Quantitative RT-PCR:

    Article Title: The Imbalance between Foxp3+Tregs and Th1/Th17/Th22 Cells in Patients with Newly Diagnosed Autoimmune Hepatitis
    Article Snippet: The expressions of transcriptional repressors Foxp3, T-bet, ROR γ t, and AHR were then measured through real-time quantitative RT-PCR. .. Total RNA of 2 μ g was reverse transcribed with hexamer and M-MuLV reverse transcriptase (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. cDNA corresponding to 25 ng of total RNA was subjected to quantitative PCR (qPCR) using primer sets and TaqMan probes corresponding to murine Foxp3, T-bet, AHR, ROR γ t, and GAPDH with qPCR Master Mix.

    Article Title: RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells [OPEN]
    Article Snippet: Following the RNA-IP, RT-qPCR was performed using an iTaq Universal SYBR Green Supermix Kit (Bio-Rad Laboratories) and a Bio-Rad CFX real-time PCR detection system. .. For qPCR, 1 μg RNA obtained from anti-RBP-P generated IP was subjected to cDNA synthesis using M-MuLV Reverse Transcriptase (NEB).

    SYBR Green Assay:

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems). .. A Gapdh -specific TaqMan probe (catalog no. 4352339) was used to normalize mRNA expression.

    Article Title: Establishment and functional characterization of the reversibly immortalized mouse glomerular podocytes (imPODs)
    Article Snippet: Total RNA was isolated using TRIzol Reagents (Invitrogen, Carlsbad, CA, USA) as described., , The cDNA synthesis was carried out using hexamer and M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA). .. The TqPCR program was carried out as follows : 95 °C × 3 s for one cycle; 95 °C × 20 s, 66 °C × 10 s, for 4 cycles by decreasing 3 °C per cycle; 95 °C × 20 s, 55 °C × 10 s, 70 °C × 1 s, followed by plate read, for 40 cycles using the 2× SYBR Green qPCR master mix (Bimake, Houston, TX).

    Article Title: RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells [OPEN]
    Article Snippet: Following the RNA-IP, RT-qPCR was performed using an iTaq Universal SYBR Green Supermix Kit (Bio-Rad Laboratories) and a Bio-Rad CFX real-time PCR detection system. .. For qPCR, 1 μg RNA obtained from anti-RBP-P generated IP was subjected to cDNA synthesis using M-MuLV Reverse Transcriptase (NEB).

    Article Title: Spatiotemporal regulation of the GPCR activity of BAI3 by C1qL4 and Stabilin-2 controls myoblast fusion
    Article Snippet: Total RNAs were treated with DNAse1 (Invitrogen) and cDNAs were generated using the M-MuLV Reverse Transcriptase and random primers (NEB), as recommended by the manufacturer. .. Specific knockdown of the genes of interest was confirmed by real-time Q-PCR in an Mx3005P (Stratagene) system using SYBR Green PCR Master Mix (Applied Biosystems).

    Incubation:

    Article Title: IL17/IL17RA as a Novel Signaling Axis Driving Mesenchymal Stem Cell Therapeutic Function in Experimental Autoimmune Encephalomyelitis
    Article Snippet: .. Briefly, a total of 2 µg RNA from each sample was incubated in a 20 µL reaction volume containing 10× buffer for M-MulV reverse transcriptase (New England BioLab, USA), 20 U RNAse inhibitor (New England BioLab, USA), 1 mM dNTPs, 0.5 µg/µL random primers (Promega), and 200 U M-MuLV reverse transcriptase (New England BioLab, USA) for 5 min at 37°C followed by 60 min at 42°C and 10 min at 70°C. ..

    Expressing:

    Article Title: Monitoring Interactions and Dynamics of Endogenous Beta-catenin With Intracellular Nanobodies in Living Cells *
    Article Snippet: Using M-MuLV reverse transcriptase (New England Biolabs, Frankfurt, Germany) and hexanucleotide primers (dN6 -primers, Sigma Aldrich) cDNA was synthesized. .. Relative mRNA expression levels were determined by the 2(−ΔΔC(T)) method ( ).

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems). .. A Gapdh -specific TaqMan probe (catalog no. 4352339) was used to normalize mRNA expression.

    Article Title: Essential Role of IL-12 in Angiogenesis in Type 2 Diabetes
    Article Snippet: The RNA was then reverse transcribed using NEB M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA) and subjected to real-time quantitative PCR using the TaqMan and Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories Inc.). .. Final normalized gene expression was calculated using α-actin mRNA as an endogenous control.

    Article Title: Stevia Prevents Acute and Chronic Liver Injury Induced by Carbon Tetrachloride by Blocking Oxidative Stress through Nrf2 Upregulation
    Article Snippet: RNA was reverse transcribed in 19.3 μ L of reaction mixture, which consisted of 10 μ L of sample added to 2.5 μ L RT buffer, 1 U/ μ L oligo (dT), 1.0 μ L RNAse inhibitor (40 U/ μ L), 0.5 mM dNTP mix, and 0.3 μ L M-MuLV reverse transcriptase (200 U/ μ L) (New England BioLabs, MA, USA). .. Taq polymerase (TaqMan, Universal Master Mix REF 4304437, Applied Biosystems, CA, USA) was used for the analysis of the relative expression of glutathione peroxidase (GPx).

    Transformation Assay:

    Article Title: Expression of WIPI2B counteracts age-related decline in autophagosome biogenesis in neurons
    Article Snippet: .. Isolated mRNA was immediately transformed into cDNA using M-MuLV Reverse Transcriptase (New England Biolabs (NEB), M0253L; other NEB reagents: S1330S, M0314S). ..

    Recombinase Polymerase Amplification:

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: Primers used to generate the probe for RPA were as follows: CYLD, GTCTAGCGAGAACAGATTCCAC (forward) and ATCTCTAAACCTTCCTTTTCCA (reverse). .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems).

    Hybridization:

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: For Northern blot hybridization, total RNA was electrophoresed on a 1.2% agarose gel, transferred to a Hybond-N membrane (Amersham Biosciences-GE) by the capillary method. .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems).

    Transfection:

    Article Title: Monitoring Interactions and Dynamics of Endogenous Beta-catenin With Intracellular Nanobodies in Living Cells *
    Article Snippet: From inhibitor-treated or transfected HeLa_BC1-CB cells RNA was prepared using the RNeasy Mini Kit (Qiagen, Hilden, Germany). .. Using M-MuLV reverse transcriptase (New England Biolabs, Frankfurt, Germany) and hexanucleotide primers (dN6 -primers, Sigma Aldrich) cDNA was synthesized.

    Sequencing:

    Article Title: Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum 1
    Article Snippet: The cells were frozen immediately, disrupted in liquid N2 , and total RNA was extracted as described by . cDNA was synthesized with M-MuLV Reverse Transcriptase (New England Bio Labs Inc., Beverly, MA) and oligo (dT)15 primer. .. Degenerate primers were designed according to the amino acid sequence of the N-terminal end of the purified CA (PtCAF1: 5′-CGC GGA TCC GAY ATI ACI GAR ATH TTY GAY GG-3′) and according to two published nucleotide sequences of β-CAs from Coccomyxa sp. ( ) and P. purpreum ( ; PtCAR1: 5′-CCG GAA TTC CCA TNG CNK CYT GIA CHA T-3′), which corresponded to the sequences of DITEIFDG and IVQ(A/D) AW(A/D), respectively.

    Article Title: An influential meal: host plant dependent transcriptional variation in the beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae)
    Article Snippet: The NEBNext Ultra RNA Library Prep Kit for Illumina sequencing (NEB, MA, USA) following the protocol as provided by the manufacturer was used for library preparation, index sequences were added to trace back the sequences to each sample. .. Synthesis of first strand cDNA was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H− ), subsequently second strand cDNA was synthesized using DNA polymerase I and RNase H. After terminal repair of the sequences, the 3′ ends were adenylated and NEBnext adapters (NEB, MA, USA) were ligated.

    Northern Blot:

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: For Northern blot hybridization, total RNA was electrophoresed on a 1.2% agarose gel, transferred to a Hybond-N membrane (Amersham Biosciences-GE) by the capillary method. .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems).

    Infection:

    Article Title: ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity
    Article Snippet: ES4326 infection, leaves of 25-day-old plants grown under short day conditions (12 h light per 12 h dark cycle) were infiltrated with P.s.m. .. Moloney Murine leukaemia virus reverse transcriptase was used for reverse transcription according to the manufacturer's instructions (New England Biolabs).

    Generated:

    Article Title: RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells [OPEN]
    Article Snippet: .. For qPCR, 1 μg RNA obtained from anti-RBP-P generated IP was subjected to cDNA synthesis using M-MuLV Reverse Transcriptase (NEB). ..

    Article Title: Spatiotemporal regulation of the GPCR activity of BAI3 by C1qL4 and Stabilin-2 controls myoblast fusion
    Article Snippet: .. Total RNAs were treated with DNAse1 (Invitrogen) and cDNAs were generated using the M-MuLV Reverse Transcriptase and random primers (NEB), as recommended by the manufacturer. .. Specific knockdown of the genes of interest was confirmed by real-time Q-PCR in an Mx3005P (Stratagene) system using SYBR Green PCR Master Mix (Applied Biosystems).

    other:

    Article Title: Alleviating Pain Hypersensitivity through Activation of Type 4 Metabotropic Glutamate Receptor
    Article Snippet: Reverse transcriptions were performed using 1 μg of total RNA with random primers and M-MuLV reverse transcriptase (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum 1
    Article Snippet: The cells were frozen immediately, disrupted in liquid N2 , and total RNA was extracted as described by . cDNA was synthesized with M-MuLV Reverse Transcriptase (New England Bio Labs Inc., Beverly, MA) and oligo (dT)15 primer. .. A partial nucleotide sequence of CA cDNA was amplified by PCR, on the assumption that P. tricornutum CA is homologous to β-CAs.

    Article Title: The Imbalance between Foxp3+Tregs and Th1/Th17/Th22 Cells in Patients with Newly Diagnosed Autoimmune Hepatitis
    Article Snippet: Total RNA of 2 μ g was reverse transcribed with hexamer and M-MuLV reverse transcriptase (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. cDNA corresponding to 25 ng of total RNA was subjected to quantitative PCR (qPCR) using primer sets and TaqMan probes corresponding to murine Foxp3, T-bet, AHR, ROR γ t, and GAPDH with qPCR Master Mix. .. The sizes of the PCR amplicons were as follows: Foxp3, 172 bp; T-bet, 86 bp; ROR γ t, 112 bp; and AHR, 98 bp.

    Article Title: Establishment and functional characterization of the reversibly immortalized mouse glomerular podocytes (imPODs)
    Article Snippet: Total RNA was isolated using TRIzol Reagents (Invitrogen, Carlsbad, CA, USA) as described., , The cDNA synthesis was carried out using hexamer and M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA). .. The cDNA products were diluted 10- to 50-fold and used as PCR templates.

    Article Title: RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells [OPEN]
    Article Snippet: For qPCR, 1 μg RNA obtained from anti-RBP-P generated IP was subjected to cDNA synthesis using M-MuLV Reverse Transcriptase (NEB). .. PCR conditions were 95°C for 2 min, 40 cycles of 95°C for 10 s, and 60°C for 1 min. Melting curves were performed to analyze primer dimer formation and specificity of primers.

    Article Title: Stevia Prevents Acute and Chronic Liver Injury Induced by Carbon Tetrachloride by Blocking Oxidative Stress through Nrf2 Upregulation
    Article Snippet: RNA was reverse transcribed in 19.3 μ L of reaction mixture, which consisted of 10 μ L of sample added to 2.5 μ L RT buffer, 1 U/ μ L oligo (dT), 1.0 μ L RNAse inhibitor (40 U/ μ L), 0.5 mM dNTP mix, and 0.3 μ L M-MuLV reverse transcriptase (200 U/ μ L) (New England BioLabs, MA, USA). .. The following reverse transcription cycle was used: 65°C for 5 min, 37°C for 60 min, 70°C for 15 min, and 4°C for 5 min. PCR was performed by using the Applied Biosystems® Step-One Plus Real-Time PCR system with software version 2.3.

    Article Title: Spatiotemporal regulation of the GPCR activity of BAI3 by C1qL4 and Stabilin-2 controls myoblast fusion
    Article Snippet: Total RNAs were treated with DNAse1 (Invitrogen) and cDNAs were generated using the M-MuLV Reverse Transcriptase and random primers (NEB), as recommended by the manufacturer. .. Specific knockdown of the genes of interest was confirmed by real-time Q-PCR in an Mx3005P (Stratagene) system using SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: The development of a sensitive fluorescent protein-based transcript reporter for high throughput screening of negative modulators of lncRNAs
    Article Snippet: Reverse transcription reactions were done using hexamer and M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA). .. The cDNA products were diluted 20- to 100-fold and used as PCR templates.

    Article Title: An influential meal: host plant dependent transcriptional variation in the beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae)
    Article Snippet: Synthesis of first strand cDNA was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H− ), subsequently second strand cDNA was synthesized using DNA polymerase I and RNase H. After terminal repair of the sequences, the 3′ ends were adenylated and NEBnext adapters (NEB, MA, USA) were ligated. .. The cDNA was enriched by PCR reactions using Phusion High-Fidelity DNA polymerase, universal PCR primers and index primers.

    Binding Assay:

    Article Title: RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells [OPEN]
    Article Snippet: Paragraph title: RNA-Protein Binding Analysis ... For qPCR, 1 μg RNA obtained from anti-RBP-P generated IP was subjected to cDNA synthesis using M-MuLV Reverse Transcriptase (NEB).

    Molecular Cloning:

    Article Title: Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum 1
    Article Snippet: Paragraph title: Extraction of Total RNA and Molecular Cloning of CA cDNA ... The cells were frozen immediately, disrupted in liquid N2 , and total RNA was extracted as described by . cDNA was synthesized with M-MuLV Reverse Transcriptase (New England Bio Labs Inc., Beverly, MA) and oligo (dT)15 primer.

    RNA Sequencing Assay:

    Article Title: An influential meal: host plant dependent transcriptional variation in the beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae)
    Article Snippet: Paragraph title: RNA sequencing ... Synthesis of first strand cDNA was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H− ), subsequently second strand cDNA was synthesized using DNA polymerase I and RNase H. After terminal repair of the sequences, the 3′ ends were adenylated and NEBnext adapters (NEB, MA, USA) were ligated.

    Magnetic Beads:

    Article Title: An influential meal: host plant dependent transcriptional variation in the beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae)
    Article Snippet: The mRNA was purified using poly-T oligo-attached magnetic beads followed by fragmentation using NEBNext First Strand Synthesis Reaction Buffer (5x). .. Synthesis of first strand cDNA was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H− ), subsequently second strand cDNA was synthesized using DNA polymerase I and RNase H. After terminal repair of the sequences, the 3′ ends were adenylated and NEBnext adapters (NEB, MA, USA) were ligated.

    Mutagenesis:

    Article Title: ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity
    Article Snippet: Paragraph title: Mutant analysis ... Moloney Murine leukaemia virus reverse transcriptase was used for reverse transcription according to the manufacturer's instructions (New England Biolabs).

    Isolation:

    Article Title: Establishment and functional characterization of the reversibly immortalized mouse glomerular podocytes (imPODs)
    Article Snippet: .. Total RNA was isolated using TRIzol Reagents (Invitrogen, Carlsbad, CA, USA) as described., , The cDNA synthesis was carried out using hexamer and M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA). .. The cDNA products were diluted 10- to 50-fold and used as PCR templates.

    Article Title: Expression of WIPI2B counteracts age-related decline in autophagosome biogenesis in neurons
    Article Snippet: .. Isolated mRNA was immediately transformed into cDNA using M-MuLV Reverse Transcriptase (New England Biolabs (NEB), M0253L; other NEB reagents: S1330S, M0314S). ..

    Article Title: Essential Role of IL-12 in Angiogenesis in Type 2 Diabetes
    Article Snippet: Total RNA was isolated using RNAzol-RT reagent (Molecular Research Center, Cincinnati, OH) from ischemic hind-limb muscles from all groups. .. The RNA was then reverse transcribed using NEB M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA) and subjected to real-time quantitative PCR using the TaqMan and Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories Inc.).

    Article Title: ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity
    Article Snippet: RNA was isolated from three independent samples using EZ-10 Spin Column Plant RNA Mini-Preps Kit (Bio Basic, Canada) and subjected to subsequent RT–PCR analysis. .. Moloney Murine leukaemia virus reverse transcriptase was used for reverse transcription according to the manufacturer's instructions (New England Biolabs).

    Article Title: The development of a sensitive fluorescent protein-based transcript reporter for high throughput screening of negative modulators of lncRNAs
    Article Snippet: Paragraph title: RNA isolation and touchdown quantitative Real-Time PCR (TqPCR) ... Reverse transcription reactions were done using hexamer and M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA).

    Article Title: IL17/IL17RA as a Novel Signaling Axis Driving Mesenchymal Stem Cell Therapeutic Function in Experimental Autoimmune Encephalomyelitis
    Article Snippet: Total RNA from cell cultures was isolated using Trizol (Invitrogen) and then treated with DNase I before reverse transcription processing to remove genomic DNA contamination. .. Briefly, a total of 2 µg RNA from each sample was incubated in a 20 µL reaction volume containing 10× buffer for M-MulV reverse transcriptase (New England BioLab, USA), 20 U RNAse inhibitor (New England BioLab, USA), 1 mM dNTPs, 0.5 µg/µL random primers (Promega), and 200 U M-MuLV reverse transcriptase (New England BioLab, USA) for 5 min at 37°C followed by 60 min at 42°C and 10 min at 70°C.

    Labeling:

    Article Title: Stevia Prevents Acute and Chronic Liver Injury Induced by Carbon Tetrachloride by Blocking Oxidative Stress through Nrf2 Upregulation
    Article Snippet: RNA was reverse transcribed in 19.3 μ L of reaction mixture, which consisted of 10 μ L of sample added to 2.5 μ L RT buffer, 1 U/ μ L oligo (dT), 1.0 μ L RNAse inhibitor (40 U/ μ L), 0.5 mM dNTP mix, and 0.3 μ L M-MuLV reverse transcriptase (200 U/ μ L) (New England BioLabs, MA, USA). .. The tests were performed in duplicate and labeled with FAM reporter dye and a nonfluorescent quencher.

    Purification:

    Article Title: Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum 1
    Article Snippet: The cells were frozen immediately, disrupted in liquid N2 , and total RNA was extracted as described by . cDNA was synthesized with M-MuLV Reverse Transcriptase (New England Bio Labs Inc., Beverly, MA) and oligo (dT)15 primer. .. Degenerate primers were designed according to the amino acid sequence of the N-terminal end of the purified CA (PtCAF1: 5′-CGC GGA TCC GAY ATI ACI GAR ATH TTY GAY GG-3′) and according to two published nucleotide sequences of β-CAs from Coccomyxa sp. ( ) and P. purpreum ( ; PtCAR1: 5′-CCG GAA TTC CCA TNG CNK CYT GIA CHA T-3′), which corresponded to the sequences of DITEIFDG and IVQ(A/D) AW(A/D), respectively.

    Article Title: An influential meal: host plant dependent transcriptional variation in the beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae)
    Article Snippet: The mRNA was purified using poly-T oligo-attached magnetic beads followed by fragmentation using NEBNext First Strand Synthesis Reaction Buffer (5x). .. Synthesis of first strand cDNA was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H− ), subsequently second strand cDNA was synthesized using DNA polymerase I and RNase H. After terminal repair of the sequences, the 3′ ends were adenylated and NEBnext adapters (NEB, MA, USA) were ligated.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The Imbalance between Foxp3+Tregs and Th1/Th17/Th22 Cells in Patients with Newly Diagnosed Autoimmune Hepatitis
    Article Snippet: Paragraph title: 2.8. RT-PCR ... Total RNA of 2 μ g was reverse transcribed with hexamer and M-MuLV reverse transcriptase (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. cDNA corresponding to 25 ng of total RNA was subjected to quantitative PCR (qPCR) using primer sets and TaqMan probes corresponding to murine Foxp3, T-bet, AHR, ROR γ t, and GAPDH with qPCR Master Mix.

    Article Title: Stevia Prevents Acute and Chronic Liver Injury Induced by Carbon Tetrachloride by Blocking Oxidative Stress through Nrf2 Upregulation
    Article Snippet: Paragraph title: 2.8. Ribonucleic Acid (RNA) Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR) ... RNA was reverse transcribed in 19.3 μ L of reaction mixture, which consisted of 10 μ L of sample added to 2.5 μ L RT buffer, 1 U/ μ L oligo (dT), 1.0 μ L RNAse inhibitor (40 U/ μ L), 0.5 mM dNTP mix, and 0.3 μ L M-MuLV reverse transcriptase (200 U/ μ L) (New England BioLabs, MA, USA).

    Article Title: ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity
    Article Snippet: RNA was isolated from three independent samples using EZ-10 Spin Column Plant RNA Mini-Preps Kit (Bio Basic, Canada) and subjected to subsequent RT–PCR analysis. .. Moloney Murine leukaemia virus reverse transcriptase was used for reverse transcription according to the manufacturer's instructions (New England Biolabs).

    Article Title: IL17/IL17RA as a Novel Signaling Axis Driving Mesenchymal Stem Cell Therapeutic Function in Experimental Autoimmune Encephalomyelitis
    Article Snippet: Paragraph title: Reverse Transcription-Polymerase Chain Reaction ... Briefly, a total of 2 µg RNA from each sample was incubated in a 20 µL reaction volume containing 10× buffer for M-MulV reverse transcriptase (New England BioLab, USA), 20 U RNAse inhibitor (New England BioLab, USA), 1 mM dNTPs, 0.5 µg/µL random primers (Promega), and 200 U M-MuLV reverse transcriptase (New England BioLab, USA) for 5 min at 37°C followed by 60 min at 42°C and 10 min at 70°C.

    Mouse Assay:

    Article Title: The Imbalance between Foxp3+Tregs and Th1/Th17/Th22 Cells in Patients with Newly Diagnosed Autoimmune Hepatitis
    Article Snippet: Total RNA was acquired from the hepatic tissue at each time point from EAH mice. .. Total RNA of 2 μ g was reverse transcribed with hexamer and M-MuLV reverse transcriptase (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. cDNA corresponding to 25 ng of total RNA was subjected to quantitative PCR (qPCR) using primer sets and TaqMan probes corresponding to murine Foxp3, T-bet, AHR, ROR γ t, and GAPDH with qPCR Master Mix.

    Software:

    Article Title: Stevia Prevents Acute and Chronic Liver Injury Induced by Carbon Tetrachloride by Blocking Oxidative Stress through Nrf2 Upregulation
    Article Snippet: RNA was reverse transcribed in 19.3 μ L of reaction mixture, which consisted of 10 μ L of sample added to 2.5 μ L RT buffer, 1 U/ μ L oligo (dT), 1.0 μ L RNAse inhibitor (40 U/ μ L), 0.5 mM dNTP mix, and 0.3 μ L M-MuLV reverse transcriptase (200 U/ μ L) (New England BioLabs, MA, USA). .. The following reverse transcription cycle was used: 65°C for 5 min, 37°C for 60 min, 70°C for 15 min, and 4°C for 5 min. PCR was performed by using the Applied Biosystems® Step-One Plus Real-Time PCR system with software version 2.3.

    Real-time Polymerase Chain Reaction:

    Article Title: The Imbalance between Foxp3+Tregs and Th1/Th17/Th22 Cells in Patients with Newly Diagnosed Autoimmune Hepatitis
    Article Snippet: .. Total RNA of 2 μ g was reverse transcribed with hexamer and M-MuLV reverse transcriptase (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. cDNA corresponding to 25 ng of total RNA was subjected to quantitative PCR (qPCR) using primer sets and TaqMan probes corresponding to murine Foxp3, T-bet, AHR, ROR γ t, and GAPDH with qPCR Master Mix. ..

    Article Title: Monitoring Interactions and Dynamics of Endogenous Beta-catenin With Intracellular Nanobodies in Living Cells *
    Article Snippet: Paragraph title: Quantitative Real-Time PCR ... Using M-MuLV reverse transcriptase (New England Biolabs, Frankfurt, Germany) and hexanucleotide primers (dN6 -primers, Sigma Aldrich) cDNA was synthesized.

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems). .. A Gapdh -specific TaqMan probe (catalog no. 4352339) was used to normalize mRNA expression.

    Article Title: Establishment and functional characterization of the reversibly immortalized mouse glomerular podocytes (imPODs)
    Article Snippet: Paragraph title: RNA isolation and Touchdown qPCR (TqPCR) analysis ... Total RNA was isolated using TRIzol Reagents (Invitrogen, Carlsbad, CA, USA) as described., , The cDNA synthesis was carried out using hexamer and M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA).

    Article Title: Expression of WIPI2B counteracts age-related decline in autophagosome biogenesis in neurons
    Article Snippet: Paragraph title: Quantitative Real-Time PCR (qPCR) cDNA isolation from whole brain ... Isolated mRNA was immediately transformed into cDNA using M-MuLV Reverse Transcriptase (New England Biolabs (NEB), M0253L; other NEB reagents: S1330S, M0314S).

    Article Title: Essential Role of IL-12 in Angiogenesis in Type 2 Diabetes
    Article Snippet: .. The RNA was then reverse transcribed using NEB M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA) and subjected to real-time quantitative PCR using the TaqMan and Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories Inc.). .. Real-time quantitative PCR was performed in triplicate using the following TaqMan assays (Thermo Fisher Scientific): Nox2 (Mm01287743_m1), Nox4 (Mm00479246_m1), tumor necrosis factor (TNF)-α (Mm00443258_m1), p40 (Mm00434174_m1), p35 (Mm.PT.5813818295), IL-10 (Mm.PT.58 13531087), interferon (IFN)-γ (Mm.PT.5841769240), arginase-1 (Mm.PT.588651372), Mannose receptor C type 1 (Mm.PT.5831835913), C-type lectin domain containing 10A (Clec10a; Mm.PT.5831835913), and chemokine (C-C motif) ligand (Mm.PT.5842151692).

    Article Title: RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells [OPEN]
    Article Snippet: .. For qPCR, 1 μg RNA obtained from anti-RBP-P generated IP was subjected to cDNA synthesis using M-MuLV Reverse Transcriptase (NEB). ..

    Article Title: Stevia Prevents Acute and Chronic Liver Injury Induced by Carbon Tetrachloride by Blocking Oxidative Stress through Nrf2 Upregulation
    Article Snippet: RNA was reverse transcribed in 19.3 μ L of reaction mixture, which consisted of 10 μ L of sample added to 2.5 μ L RT buffer, 1 U/ μ L oligo (dT), 1.0 μ L RNAse inhibitor (40 U/ μ L), 0.5 mM dNTP mix, and 0.3 μ L M-MuLV reverse transcriptase (200 U/ μ L) (New England BioLabs, MA, USA). .. The following reverse transcription cycle was used: 65°C for 5 min, 37°C for 60 min, 70°C for 15 min, and 4°C for 5 min. PCR was performed by using the Applied Biosystems® Step-One Plus Real-Time PCR system with software version 2.3.

    Article Title: ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity
    Article Snippet: Moloney Murine leukaemia virus reverse transcriptase was used for reverse transcription according to the manufacturer's instructions (New England Biolabs). .. Real-time PCR was performed using the SYBR Premix Ex Taq II (TAKARA).

    Article Title: Spatiotemporal regulation of the GPCR activity of BAI3 by C1qL4 and Stabilin-2 controls myoblast fusion
    Article Snippet: Paragraph title: Semi-quantitative and real-time quantitative PCR (Q-RT-PCR) ... Total RNAs were treated with DNAse1 (Invitrogen) and cDNAs were generated using the M-MuLV Reverse Transcriptase and random primers (NEB), as recommended by the manufacturer.

    Article Title: The development of a sensitive fluorescent protein-based transcript reporter for high throughput screening of negative modulators of lncRNAs
    Article Snippet: Paragraph title: RNA isolation and touchdown quantitative Real-Time PCR (TqPCR) ... Reverse transcription reactions were done using hexamer and M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA).

    RNA Extraction:

    Article Title: Stevia Prevents Acute and Chronic Liver Injury Induced by Carbon Tetrachloride by Blocking Oxidative Stress through Nrf2 Upregulation
    Article Snippet: Paragraph title: 2.8. Ribonucleic Acid (RNA) Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR) ... RNA was reverse transcribed in 19.3 μ L of reaction mixture, which consisted of 10 μ L of sample added to 2.5 μ L RT buffer, 1 U/ μ L oligo (dT), 1.0 μ L RNAse inhibitor (40 U/ μ L), 0.5 mM dNTP mix, and 0.3 μ L M-MuLV reverse transcriptase (200 U/ μ L) (New England BioLabs, MA, USA).

    Agarose Gel Electrophoresis:

    Article Title: Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum 1
    Article Snippet: The cells were frozen immediately, disrupted in liquid N2 , and total RNA was extracted as described by . cDNA was synthesized with M-MuLV Reverse Transcriptase (New England Bio Labs Inc., Beverly, MA) and oligo (dT)15 primer. .. The PCR profile was as follows: five cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 90 s, followed by 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 90 s. The resulting PCR products were separated by agarose gel electrophoresis and the bands corresponding in size to approximately 400 to 600 bp were cut out of the gel and the extract was used as a template for a second PCR.

    Article Title: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis (CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice *
    Article Snippet: For Northern blot hybridization, total RNA was electrophoresed on a 1.2% agarose gel, transferred to a Hybond-N membrane (Amersham Biosciences-GE) by the capillary method. .. To generate cDNA, reverse transcription was performed using M-MuLV reverse transcriptase, RNase inhibitor, random primers 9 (for qPCR) or oligo(dT) (for cloning), and dNTPs (New England BioLabs). cDNA was analyzed for mRNA expression levels using SYBR Green and TaqMan probe-based gene expression analysis with the following custom, full-length, specific CYLD primer/probe: GCTCAGTGACGTGCTAGCT (forward) and GCGTGCCCCTGAAAGTTC (reverse), Probe(FAM)-CTGGAACTGGAAGATGAA (Applied Biosystems).

    In Vitro:

    Article Title: RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells [OPEN]
    Article Snippet: In vitro RNA-protein UV-cross-linking assay and RNA-IP were performed as previously described ( ). .. For qPCR, 1 μg RNA obtained from anti-RBP-P generated IP was subjected to cDNA synthesis using M-MuLV Reverse Transcriptase (NEB).

    Homogenization:

    Article Title: Expression of WIPI2B counteracts age-related decline in autophagosome biogenesis in neurons
    Article Snippet: 2 mL TRIzol reagent and 800 μL chloroform were added after homogenization. .. Isolated mRNA was immediately transformed into cDNA using M-MuLV Reverse Transcriptase (New England Biolabs (NEB), M0253L; other NEB reagents: S1330S, M0314S).

    Random Hexamer Labeling:

    Article Title: An influential meal: host plant dependent transcriptional variation in the beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae)
    Article Snippet: .. Synthesis of first strand cDNA was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H− ), subsequently second strand cDNA was synthesized using DNA polymerase I and RNase H. After terminal repair of the sequences, the 3′ ends were adenylated and NEBnext adapters (NEB, MA, USA) were ligated. .. The library fragments were purified, for a 150–200 bp size range, with AMpure XP purification kit (Beckman Coulter, MA, USA).

    Concentration Assay:

    Article Title: An influential meal: host plant dependent transcriptional variation in the beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae)
    Article Snippet: The RNA concentration was measured using the Qubit RNA Assay Kit on a Qubit 2.0 Fluorometer (Invitrogen Co. Ltd., San Diego, USA). .. Synthesis of first strand cDNA was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H− ), subsequently second strand cDNA was synthesized using DNA polymerase I and RNase H. After terminal repair of the sequences, the 3′ ends were adenylated and NEBnext adapters (NEB, MA, USA) were ligated.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs mmlv rt
    Reverse transcriptase assays. A. Fluorogenic assay. RT activity was measured by detection of RNA:DNA heteroduplex by fluorescence of EvaGreen binding. Oligo dT primed poly A was incubated at 37°C and 65°C in the presence of indicated Pol enzymes in manufacturer recommended buffers and dTTP. Fluorescence measurements were obtained every 6 seconds for 10 minutes. The initial slopes from a plot of RFU vs. time in seconds were determined by linear least square regression from 30 to 150 seconds at 37°C and from 30 to 90 seconds at 65°C. Error bars are standard error of regression slope. B. RT primer extension assay. HEX-labeled dT 20 primed poly A was incubated 10 minutes at 37°C and then 10 minutes at 65°C in the presence of indicated Pol enzymes and dTTP in manufacturer recommended buffers. Primer extension products were resolved by 10% denaturing PAGE and imaged on a Molecular Imager FX (Bio-Rad). Left facing triangle indicates migration of unextended dT20 primer and asterisk indicates bromophenol blue dye front. C. RT MS2-specific primer extension. 5′-labeled primer was annealed to MS2 RNA and incubated 10 minutes at 37°C and then 30 minutes at 65°C in the presence of indicated Pol enzymes with dNTPS (N = A,C,G,T) in manufacturer recommended buffers. Primer extension products were resolved by 5% denaturing PAGE. Lane 1 No <t>RNA+MMLV</t> RT; Lane 2: MS2 RNA No RT; Lane 3 MS2 RNA+MMLV RT, Lane 3 MS2 <t>RNA+3173</t> Pol. Molecular weight in bases indicted. Red Arrow: ∼650 base MMLV extension product. Blue Arrow: ∼715 base PyroScript extension product. Green arrow: Non-templated MMLV reaction product.
    Mmlv Rt, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mmlv rt/product/New England Biolabs
    Average 95 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    mmlv rt - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Reverse transcriptase assays. A. Fluorogenic assay. RT activity was measured by detection of RNA:DNA heteroduplex by fluorescence of EvaGreen binding. Oligo dT primed poly A was incubated at 37°C and 65°C in the presence of indicated Pol enzymes in manufacturer recommended buffers and dTTP. Fluorescence measurements were obtained every 6 seconds for 10 minutes. The initial slopes from a plot of RFU vs. time in seconds were determined by linear least square regression from 30 to 150 seconds at 37°C and from 30 to 90 seconds at 65°C. Error bars are standard error of regression slope. B. RT primer extension assay. HEX-labeled dT 20 primed poly A was incubated 10 minutes at 37°C and then 10 minutes at 65°C in the presence of indicated Pol enzymes and dTTP in manufacturer recommended buffers. Primer extension products were resolved by 10% denaturing PAGE and imaged on a Molecular Imager FX (Bio-Rad). Left facing triangle indicates migration of unextended dT20 primer and asterisk indicates bromophenol blue dye front. C. RT MS2-specific primer extension. 5′-labeled primer was annealed to MS2 RNA and incubated 10 minutes at 37°C and then 30 minutes at 65°C in the presence of indicated Pol enzymes with dNTPS (N = A,C,G,T) in manufacturer recommended buffers. Primer extension products were resolved by 5% denaturing PAGE. Lane 1 No RNA+MMLV RT; Lane 2: MS2 RNA No RT; Lane 3 MS2 RNA+MMLV RT, Lane 3 MS2 RNA+3173 Pol. Molecular weight in bases indicted. Red Arrow: ∼650 base MMLV extension product. Blue Arrow: ∼715 base PyroScript extension product. Green arrow: Non-templated MMLV reaction product.

    Journal: PLoS ONE

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme

    doi: 10.1371/journal.pone.0038371

    Figure Lengend Snippet: Reverse transcriptase assays. A. Fluorogenic assay. RT activity was measured by detection of RNA:DNA heteroduplex by fluorescence of EvaGreen binding. Oligo dT primed poly A was incubated at 37°C and 65°C in the presence of indicated Pol enzymes in manufacturer recommended buffers and dTTP. Fluorescence measurements were obtained every 6 seconds for 10 minutes. The initial slopes from a plot of RFU vs. time in seconds were determined by linear least square regression from 30 to 150 seconds at 37°C and from 30 to 90 seconds at 65°C. Error bars are standard error of regression slope. B. RT primer extension assay. HEX-labeled dT 20 primed poly A was incubated 10 minutes at 37°C and then 10 minutes at 65°C in the presence of indicated Pol enzymes and dTTP in manufacturer recommended buffers. Primer extension products were resolved by 10% denaturing PAGE and imaged on a Molecular Imager FX (Bio-Rad). Left facing triangle indicates migration of unextended dT20 primer and asterisk indicates bromophenol blue dye front. C. RT MS2-specific primer extension. 5′-labeled primer was annealed to MS2 RNA and incubated 10 minutes at 37°C and then 30 minutes at 65°C in the presence of indicated Pol enzymes with dNTPS (N = A,C,G,T) in manufacturer recommended buffers. Primer extension products were resolved by 5% denaturing PAGE. Lane 1 No RNA+MMLV RT; Lane 2: MS2 RNA No RT; Lane 3 MS2 RNA+MMLV RT, Lane 3 MS2 RNA+3173 Pol. Molecular weight in bases indicted. Red Arrow: ∼650 base MMLV extension product. Blue Arrow: ∼715 base PyroScript extension product. Green arrow: Non-templated MMLV reaction product.

    Article Snippet: Two-step RT-PCR reactions were performed using either 5 units 3173 Pol, exonuclease negative mutant or 200 Units MMLV RT (NEB).

    Techniques: Activity Assay, Fluorescence, Binding Assay, Incubation, Primer Extension Assay, Labeling, Polyacrylamide Gel Electrophoresis, Migration, Molecular Weight

    RT-PCR detection of human transcript RNAs. Beta-actin, beta2-microglobulin and cyclophilin target sequences of the indicated sizes were amplified from human liver total RNA using the primers described in Table 1 . Shown are products of two step reactions where either MMLV RT or 3173 Pol were used for first strand cDNA synthesis, as indicated. Taq Pol was used for PCR. Products were resolved on a 1% agarose gel.

    Journal: PLoS ONE

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme

    doi: 10.1371/journal.pone.0038371

    Figure Lengend Snippet: RT-PCR detection of human transcript RNAs. Beta-actin, beta2-microglobulin and cyclophilin target sequences of the indicated sizes were amplified from human liver total RNA using the primers described in Table 1 . Shown are products of two step reactions where either MMLV RT or 3173 Pol were used for first strand cDNA synthesis, as indicated. Taq Pol was used for PCR. Products were resolved on a 1% agarose gel.

    Article Snippet: Two-step RT-PCR reactions were performed using either 5 units 3173 Pol, exonuclease negative mutant or 200 Units MMLV RT (NEB).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Two step RT-PCR comparing 3173 Pol and MMLV RT. A. MS2 viral RNA and B., C. total human liver RNA were reverse transcribed using either 3173 Pol or MMLV RT and then PCR amplified using Taq Polymerase. Target amplicons : A. MS2 RNA phage 77 bp amplicon, 2% gel, B. Human beta-actin 144 bp amplicon, 2% gel, C. Human beta-actin 821 bp amplicon, 1% gel. Lanes : 1 , 11 : oligo dT primer; 2–4 , 12–14 : Gene specific primers; 5 , 15 : random hexamers; 6 , 16 : random nonamers; 7 , 17 : No primer plus RT; 8 : No RT enzyme; 9 : PCR No Target Control; 10 : Molecular Weight Marker (MW), 100 bp (50 bp lowest) for Panels A, B and 1000 bp (300, 500, 700 lowest) for Panel C. Correct PCR product size indicated by black triangle.

    Journal: PLoS ONE

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme

    doi: 10.1371/journal.pone.0038371

    Figure Lengend Snippet: Two step RT-PCR comparing 3173 Pol and MMLV RT. A. MS2 viral RNA and B., C. total human liver RNA were reverse transcribed using either 3173 Pol or MMLV RT and then PCR amplified using Taq Polymerase. Target amplicons : A. MS2 RNA phage 77 bp amplicon, 2% gel, B. Human beta-actin 144 bp amplicon, 2% gel, C. Human beta-actin 821 bp amplicon, 1% gel. Lanes : 1 , 11 : oligo dT primer; 2–4 , 12–14 : Gene specific primers; 5 , 15 : random hexamers; 6 , 16 : random nonamers; 7 , 17 : No primer plus RT; 8 : No RT enzyme; 9 : PCR No Target Control; 10 : Molecular Weight Marker (MW), 100 bp (50 bp lowest) for Panels A, B and 1000 bp (300, 500, 700 lowest) for Panel C. Correct PCR product size indicated by black triangle.

    Article Snippet: Two-step RT-PCR reactions were performed using either 5 units 3173 Pol, exonuclease negative mutant or 200 Units MMLV RT (NEB).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Molecular Weight, Marker

    Reverse transcription using AHP dUTP. ( A ) RNA template T5 with primer P3. ( B and C ) Twenty percent denaturing PAGE analysis of reactions using AMV and M-MuLV (RNase H-) reverse transcriptases at 42°C for 15 h.

    Journal: Nucleic Acids Research

    Article Title: Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

    doi: 10.1093/nar/gkw028

    Figure Lengend Snippet: Reverse transcription using AHP dUTP. ( A ) RNA template T5 with primer P3. ( B and C ) Twenty percent denaturing PAGE analysis of reactions using AMV and M-MuLV (RNase H-) reverse transcriptases at 42°C for 15 h.

    Article Snippet: Klenow large fragment, Therminator™ II, M-MuLV (RNase H− ) reverse transcriptase, AMV reverse transcriptase, RNase inhibitor and λ-exonuclease were purchased from New England Biolabs.

    Techniques: Polyacrylamide Gel Electrophoresis