puc19  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    DNA Polymerase I Klenow Fragment
    Description:
    DNA Polymerase I Klenow Fragment 1 000 units
    Catalog Number:
    m0210l
    Price:
    248
    Size:
    1 000 units
    Category:
    DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs puc19
    DNA Polymerase I Klenow Fragment
    DNA Polymerase I Klenow Fragment 1 000 units
    https://www.bioz.com/result/puc19/product/New England Biolabs
    Average 99 stars, based on 996 article reviews
    Price from $9.99 to $1999.99
    puc19 - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer"

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00787-16

    In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.
    Figure Legend Snippet: In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.

    Techniques Used: In Vitro, Activity Assay, Incubation, Labeling

    2) Product Images from "Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer"

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00787-16

    In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.
    Figure Legend Snippet: In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.

    Techniques Used: In Vitro, Activity Assay, Incubation, Labeling

    3) Product Images from "RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells"

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells

    Journal: Nature genetics

    doi: 10.1038/s41588-018-0060-9

    PSPC1 and TET2 silence MERVL transcriptionally and post-transcriptionally a , MERVL expression in Tet1/2/3 triple knock-out ( Tet TKO) ESCs rescued with an empty vector (+EV), a wild-type (+TET2WT), or a catalytic mutant (+TET2Mut) TET2. Center line, median; box and whisker plots: ± 10th–90th percentile range. Data are from 5 independent experiments (n=14 total technical replicates for each rescue). Two-tailed Student’s t -test was applied. ns, not significant. b–c , MERVL and IAP enrichment, compared to U6 negative control, among anti-5hmC immunoprecipitated RNAs in Tet TKO (b) and Pspc1 KO (c) ESCs rescued with an empty vector (+EV), a wild-type, or a mutant TET2/PSPC1. Data are presented as mean ± s.e.m. (n=3 independent experiments). Two-tailed Student’s t -test was applied. ns, not significant. d , (Top) Schematic of the protocol used for inhibition of transcription with α-Amanitin for RNA stability assay. (Bottom) Relative abundance of MERVL RNA in Pspc1 WT an d KO ESCs after transcriptional inhibition for 1, 2, or 4 hours with α-Amanitin. Data are normalized to untreated cells at time 0 h (Vehicle without treatment). Error bars indicate s.e.m. (n=3). Two-tailed Student’s t -test was applied. ns, not significant. e , A model of MERVL regulation by PSPC1/TET2 and HDAC1/2 in ESCs. PSPC1 binding to actively transcribed MERVL RNAs recruits TET2 and HDAC1/2 to chromatin. TET2 catalyzes 5hmC modification of MERVL RNAs resulting in their destabilization, and HDAC1/2 deacetylate histones at the chromatin level leading to transcriptional repression of the MERVL loci. Transcriptional and posttranscriptional repression of MERVL leads to the release of the PSPC1-TET2-HDAC1/2 complex from chromatin. Sporadic reactivation of MERVL expression, well-recognized in conventionally cultured ESCs 10 , via a yet-to-be defined mechanism, leads to the recruitment PSPC1-TET2-HDAC1/2 for transcriptional and posttranscriptional control of MERVL and coordinated gene expression. Illustration by Jill Gregory. Printed with permission of ©Mount Sinai Health System.
    Figure Legend Snippet: PSPC1 and TET2 silence MERVL transcriptionally and post-transcriptionally a , MERVL expression in Tet1/2/3 triple knock-out ( Tet TKO) ESCs rescued with an empty vector (+EV), a wild-type (+TET2WT), or a catalytic mutant (+TET2Mut) TET2. Center line, median; box and whisker plots: ± 10th–90th percentile range. Data are from 5 independent experiments (n=14 total technical replicates for each rescue). Two-tailed Student’s t -test was applied. ns, not significant. b–c , MERVL and IAP enrichment, compared to U6 negative control, among anti-5hmC immunoprecipitated RNAs in Tet TKO (b) and Pspc1 KO (c) ESCs rescued with an empty vector (+EV), a wild-type, or a mutant TET2/PSPC1. Data are presented as mean ± s.e.m. (n=3 independent experiments). Two-tailed Student’s t -test was applied. ns, not significant. d , (Top) Schematic of the protocol used for inhibition of transcription with α-Amanitin for RNA stability assay. (Bottom) Relative abundance of MERVL RNA in Pspc1 WT an d KO ESCs after transcriptional inhibition for 1, 2, or 4 hours with α-Amanitin. Data are normalized to untreated cells at time 0 h (Vehicle without treatment). Error bars indicate s.e.m. (n=3). Two-tailed Student’s t -test was applied. ns, not significant. e , A model of MERVL regulation by PSPC1/TET2 and HDAC1/2 in ESCs. PSPC1 binding to actively transcribed MERVL RNAs recruits TET2 and HDAC1/2 to chromatin. TET2 catalyzes 5hmC modification of MERVL RNAs resulting in their destabilization, and HDAC1/2 deacetylate histones at the chromatin level leading to transcriptional repression of the MERVL loci. Transcriptional and posttranscriptional repression of MERVL leads to the release of the PSPC1-TET2-HDAC1/2 complex from chromatin. Sporadic reactivation of MERVL expression, well-recognized in conventionally cultured ESCs 10 , via a yet-to-be defined mechanism, leads to the recruitment PSPC1-TET2-HDAC1/2 for transcriptional and posttranscriptional control of MERVL and coordinated gene expression. Illustration by Jill Gregory. Printed with permission of ©Mount Sinai Health System.

    Techniques Used: Expressing, Knock-Out, Plasmid Preparation, Mutagenesis, Whisker Assay, Two Tailed Test, Negative Control, Immunoprecipitation, Inhibition, Stability Assay, Binding Assay, Modification, Cell Culture

    4) Product Images from "Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer"

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00787-16

    In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.
    Figure Legend Snippet: In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.

    Techniques Used: In Vitro, Activity Assay, Incubation, Labeling

    5) Product Images from "RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells"

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells

    Journal: Nature genetics

    doi: 10.1038/s41588-018-0060-9

    PSPC1 and TET2 silence MERVL transcriptionally and post-transcriptionally a , MERVL expression in Tet1/2/3 triple knock-out ( Tet TKO) ESCs rescued with an empty vector (+EV), a wild-type (+TET2WT), or a catalytic mutant (+TET2Mut) TET2. Center line, median; box and whisker plots: ± 10th–90th percentile range. Data are from 5 independent experiments (n=14 total technical replicates for each rescue). Two-tailed Student’s t -test was applied. ns, not significant. b–c , MERVL and IAP enrichment, compared to U6 negative control, among anti-5hmC immunoprecipitated RNAs in Tet TKO (b) and Pspc1 KO (c) ESCs rescued with an empty vector (+EV), a wild-type, or a mutant TET2/PSPC1. Data are presented as mean ± s.e.m. (n=3 independent experiments). Two-tailed Student’s t -test was applied. ns, not significant. d , (Top) Schematic of the protocol used for inhibition of transcription with α-Amanitin for RNA stability assay. (Bottom) Relative abundance of MERVL RNA in Pspc1 WT an d KO ESCs after transcriptional inhibition for 1, 2, or 4 hours with α-Amanitin. Data are normalized to untreated cells at time 0 h (Vehicle without treatment). Error bars indicate s.e.m. (n=3). Two-tailed Student’s t -test was applied. ns, not significant. e , A model of MERVL regulation by PSPC1/TET2 and HDAC1/2 in ESCs. PSPC1 binding to actively transcribed MERVL RNAs recruits TET2 and HDAC1/2 to chromatin. TET2 catalyzes 5hmC modification of MERVL RNAs resulting in their destabilization, and HDAC1/2 deacetylate histones at the chromatin level leading to transcriptional repression of the MERVL loci. Transcriptional and posttranscriptional repression of MERVL leads to the release of the PSPC1-TET2-HDAC1/2 complex from chromatin. Sporadic reactivation of MERVL , via a yet-to-be defined mechanism, leads to the recruitment PSPC1-TET2-HDAC1/2 for transcriptional and posttranscriptional control of MERVL and coordinated gene expression. Illustration by Jill Gregory. Printed with permission of ©Mount Sinai Health System.
    Figure Legend Snippet: PSPC1 and TET2 silence MERVL transcriptionally and post-transcriptionally a , MERVL expression in Tet1/2/3 triple knock-out ( Tet TKO) ESCs rescued with an empty vector (+EV), a wild-type (+TET2WT), or a catalytic mutant (+TET2Mut) TET2. Center line, median; box and whisker plots: ± 10th–90th percentile range. Data are from 5 independent experiments (n=14 total technical replicates for each rescue). Two-tailed Student’s t -test was applied. ns, not significant. b–c , MERVL and IAP enrichment, compared to U6 negative control, among anti-5hmC immunoprecipitated RNAs in Tet TKO (b) and Pspc1 KO (c) ESCs rescued with an empty vector (+EV), a wild-type, or a mutant TET2/PSPC1. Data are presented as mean ± s.e.m. (n=3 independent experiments). Two-tailed Student’s t -test was applied. ns, not significant. d , (Top) Schematic of the protocol used for inhibition of transcription with α-Amanitin for RNA stability assay. (Bottom) Relative abundance of MERVL RNA in Pspc1 WT an d KO ESCs after transcriptional inhibition for 1, 2, or 4 hours with α-Amanitin. Data are normalized to untreated cells at time 0 h (Vehicle without treatment). Error bars indicate s.e.m. (n=3). Two-tailed Student’s t -test was applied. ns, not significant. e , A model of MERVL regulation by PSPC1/TET2 and HDAC1/2 in ESCs. PSPC1 binding to actively transcribed MERVL RNAs recruits TET2 and HDAC1/2 to chromatin. TET2 catalyzes 5hmC modification of MERVL RNAs resulting in their destabilization, and HDAC1/2 deacetylate histones at the chromatin level leading to transcriptional repression of the MERVL loci. Transcriptional and posttranscriptional repression of MERVL leads to the release of the PSPC1-TET2-HDAC1/2 complex from chromatin. Sporadic reactivation of MERVL , via a yet-to-be defined mechanism, leads to the recruitment PSPC1-TET2-HDAC1/2 for transcriptional and posttranscriptional control of MERVL and coordinated gene expression. Illustration by Jill Gregory. Printed with permission of ©Mount Sinai Health System.

    Techniques Used: Expressing, Knock-Out, Plasmid Preparation, Mutagenesis, Whisker Assay, Two Tailed Test, Negative Control, Immunoprecipitation, Inhibition, Stability Assay, Binding Assay, Modification

    6) Product Images from "Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer"

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00787-16

    In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.
    Figure Legend Snippet: In vitro analysis of RpnA endonuclease activity. (A) WT RpnA cleaves pUC19, RpnA-D63A does not cleave pUC19, and RpnA-D165A is more active on pUC19. The pUC19 DNA (29 nM, 50 μg/ml) is initially supercoiled but can be relaxed by nicks, linearized by double-strand cleavage, or cleaved further. The supercoiled (control), relaxed (Nb.BtsI), and linear (HindIII) forms are indicated. pUC19 was treated with RpnA-inactive RpnA-D63A or hyperactive RpnA-D165A (15 μM, 45 min). (B) Time course of an RpnA (7.5 μM)-pUC19 (29 nM) digest. Band intensity was compared to determine the relative amounts of supercoiled, nicked, and linear pUC19 at each time point. Over 90% of the supercoiled pUC19 was digested within 180 min. (C) RpnA endonuclease activity depends on divalent cation and is stimulated by Ca 2+ . The reaction buffer was 50 mM NaCl and 10 mM Tris, pH 8.0; the indicated additives were at 10 mM each. RpnA at 3.8 μM was added for 18 h. (D) RpnA cleavage products provide a DNA polymerase primer. pUC19 was digested with RpnA, DNase I, or micrococcal nuclease (MNase) to produce similar smears and then incubated with fluorescein-labeled dNTPs and the Klenow fragment of DNA polymerase. DNA was visualized by ethidium bromide (EtBr; left) or fluorescein (middle), with the two signals being merged at the right. RpnA- and DNase I-digested DNAs were effectively labeled, but micrococcal nuclease-digested DNA was not.

    Techniques Used: In Vitro, Activity Assay, Incubation, Labeling

    Distribution of genomic exchanges in recombinants. (A) Diagram of markers that distinguish the donor and recipient genomes and distances from the selected tetRA cassette. The chromosome segregation site dif is also shown. ICR, restriction enzyme gene cluster known as the immigration control region. (B) Recombinants were screened for the cat , npt , mrr , fhuA , and lacZ markers. Recombinants containing both tetRA and mrr were classified as having genome additions, and the results for these recombinants are not shown. Horizontal bars indicate the extent of donor DNA (orange) that we inferred replaced the recipient genome (blue) during the recombination event. NA, not available. (C) Proportion of recombinants in each class from a basal mating (WT; ER3435 × ER3473) with or without AZT treatment or from a mating in which rpnA was overexpressed (RpnA; ER3435 × ER3514). For the WT, most recombinants were created by large replacements of over 400 kb of genomic DNA. In the RpnA and AZT matings, large replacements were less frequent, and over half of the genomic replacements were within the 236-kb segment between the npt and fhuA markers flanking the selected marker, tetRA .
    Figure Legend Snippet: Distribution of genomic exchanges in recombinants. (A) Diagram of markers that distinguish the donor and recipient genomes and distances from the selected tetRA cassette. The chromosome segregation site dif is also shown. ICR, restriction enzyme gene cluster known as the immigration control region. (B) Recombinants were screened for the cat , npt , mrr , fhuA , and lacZ markers. Recombinants containing both tetRA and mrr were classified as having genome additions, and the results for these recombinants are not shown. Horizontal bars indicate the extent of donor DNA (orange) that we inferred replaced the recipient genome (blue) during the recombination event. NA, not available. (C) Proportion of recombinants in each class from a basal mating (WT; ER3435 × ER3473) with or without AZT treatment or from a mating in which rpnA was overexpressed (RpnA; ER3435 × ER3514). For the WT, most recombinants were created by large replacements of over 400 kb of genomic DNA. In the RpnA and AZT matings, large replacements were less frequent, and over half of the genomic replacements were within the 236-kb segment between the npt and fhuA markers flanking the selected marker, tetRA .

    Techniques Used: Marker

    Related Articles

    Amplification:

    Article Title: Antisense RNA Strategies for Metabolic Engineering of Clostridium acetobutylicum
    Article Snippet: Restriction endonucleases, T4 DNA ligase, Vent DNA polymerase, and the DNA polymerase I-large (Klenow) fragment were obtained from New England Biolabs (Beverly, Mass.) and used according to the manufacturer’s specifications. .. Restriction sites were engineered into amplified DNA fragments by using a previously described PCR protocol ( ).

    Article Title: Mechanism of Action of the Arylomycin Antibiotics and Effects of Signal Peptidase I Inhibition
    Article Snippet: Briefly, the wild-type E. coli lepB coding sequence and upstream Shine-Dalgarno sequence were amplified using primers lepB+RBS_NF_NdeI and lepB_CR_KpnI, and the product was phosphorylated using T4 polynucleotide kinase (New England BioLabs). .. The DNA was ligated into the vector pTetBHR2 that had been digested with XhoI and XmaI (New England BioLabs) and treated with Klenow fragment DNA polymerase (New England BioLabs).

    Article Title: Evolutionary evidence for multi-host transmission of cetacean morbillivirus
    Article Snippet: Second-strand cDNA synthesis was performed with Klenow fragment DNA polymerase (New England Biolab [NEB], Ipswich, MA, USA). .. Random amplification of samples was performed using Phusion polymerase (NEB) and the same primer sequence as above.

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210). .. Library preparation protocol included end-repair, adapters ligation, size selection (Pipping Prep SAGE System), and amplification of the library using manufacturer's recommended protocol Ion plus fragment library kit (Pub.

    Synthesized:

    Article Title: Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction
    Article Snippet: Materials The hairpin fluorescence probe and oligonucleotide were commercially synthesized by TaKaRa Bio Inc. (Dalian, China). .. The polymerase Klenow fragment exo− was purchased from New England Biolabs, Inc.

    Article Title: Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
    Article Snippet: All labeled single strands were synthesized in vitro by the method of Zimmer and coworkers using a DNA hairpin template with a 5′ overhang corresponding to the complement of the target labeled strand and a 3′ ribose (IDT, Inc.). .. In this study we used the same hairpin sequence as Zimmer and coworkers , Klenow fragment DNA polymerase (NEB, Inc.) NEB2 buffer (NEB, Inc.), and uniformly 13 C/15 N-labeled dNTPs (Isotec, Sigma-Aldrich and Silantes).

    Construct:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min. .. The HiC library was constructed by amplifying the innate one directly off of the T1 beads through PCR using Illumina primers and protocol, which was separated from the beads, purified with AMpure XP beads and eluted from the beads into 1× Tris buffer, yielding an in situ HiC library.

    Real-time Polymerase Chain Reaction:

    Article Title: Characterization of a novel DNA polymerase activity assay enabling sensitive, quantitative and universal detection of viable microbes
    Article Snippet: DPE reaction conditions DNA Pol I (NEB cat# M0209L), Klenow (NEB cat# M0210S) and Klenow exo(−) (NEB cat# M0212S) were diluted to the indicated units per microliter stock in sterile Tris–EDTA, pH 8.0. .. Reactions containing DNA polymerase (or NICs) were vortexed briefly and placed at 37°C for 20 min. After 20 min, 3 µl of each reaction were immediately placed into a qPCR (see below for qPCR conditions).

    Incubation:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min. ..

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: .. DNA smears (1 μg) were incubated with dTTP, dATP, fluorescein–12-dCTP (catalog number NEL434001EA; PerkinElmer), fluorescein–12-dGTP (catalog number NEL496001EA; PerkinElmer), and the E. coli polymerase I Klenow fragment (catalog number M0210S; NEB) at 37°C for 30 min. Purified DNA was run on a 6% TBE-polyacrylamide gel; labeling was visualized using a Typhoon 9400 laser scanner (excitation wavelength, 488 nm; emission wavelength, 520 nm; GE Healthcare Life Sciences). .. Total DNA was visualized by UV after EtBr staining.

    Stripping Membranes:

    Article Title: Visual Detection of Gene Mutations Based on Isothermal Strand-Displacement Polymerase Reaction and Lateral Flow Strip
    Article Snippet: A portable strip reader (DT1030) was purchased from Shanghai Goldbio Tech. .. The polymerase Klenow fragment exo− was purchased from New England Biolabs, Inc.

    Expressing:

    Article Title: Mechanism of Action of the Arylomycin Antibiotics and Effects of Signal Peptidase I Inhibition
    Article Snippet: To examine the effect of increased expression of arylomycin-susceptible SPases, E. coli strains PAS0275 and PAS0234 were created to allow for the aTc-inducible, ectopic expression of LepB(P84L) and LepB(P84S) from the plasmid pTetBHR2. .. The DNA was ligated into the vector pTetBHR2 that had been digested with XhoI and XmaI (New England BioLabs) and treated with Klenow fragment DNA polymerase (New England BioLabs).

    Modification:

    Article Title: Antisense RNA Strategies for Metabolic Engineering of Clostridium acetobutylicum
    Article Snippet: Transformation of C. acetobutylicum by pRD1 was carried out by using a modified protocol (90% of the glucose in the outgrowth medium was replaced with an equal amount of soluble starch). .. Restriction endonucleases, T4 DNA ligase, Vent DNA polymerase, and the DNA polymerase I-large (Klenow) fragment were obtained from New England Biolabs (Beverly, Mass.) and used according to the manufacturer’s specifications.

    Transformation Assay:

    Article Title: Antisense RNA Strategies for Metabolic Engineering of Clostridium acetobutylicum
    Article Snippet: Paragraph title: DNA isolation, manipulation, and transformation. ... Restriction endonucleases, T4 DNA ligase, Vent DNA polymerase, and the DNA polymerase I-large (Klenow) fragment were obtained from New England Biolabs (Beverly, Mass.) and used according to the manufacturer’s specifications.

    Article Title: Mechanism of Action of the Arylomycin Antibiotics and Effects of Signal Peptidase I Inhibition
    Article Snippet: The DNA was ligated into the vector pTetBHR2 that had been digested with XhoI and XmaI (New England BioLabs) and treated with Klenow fragment DNA polymerase (New England BioLabs). .. Plasmid pTetBHR2-LepB(P84S) was transformed into PAS0232, which contains the chromosomal LepB(P84S) mutation.

    Over Expression:

    Article Title: Mechanism of Action of the Arylomycin Antibiotics and Effects of Signal Peptidase I Inhibition
    Article Snippet: The DNA was ligated into the vector pTetBHR2 that had been digested with XhoI and XmaI (New England BioLabs) and treated with Klenow fragment DNA polymerase (New England BioLabs). .. The plasmid pTetBHR2-LepB(P84L) was subsequently electroporated into PAS0260 to generate PAS0275 to allow overexpression of LepB(P84L).

    Sensitive Assay:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Ligation:

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Illumina adapter ligation was performed in a 20-μL reaction by incubation at 20°C for 15 min, followed by 65°C for 10 min (10 μL of DNA from previous step, 1× T4 DNA ligase buffer, 1 μL of T4 DNA ligase (NEB # M0202S), 1 μL of 40-μM pre-annealed adapter mix).

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210). .. Library preparation protocol included end-repair, adapters ligation, size selection (Pipping Prep SAGE System), and amplification of the library using manufacturer's recommended protocol Ion plus fragment library kit (Pub.

    Footprinting:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Paragraph title: In vivo footprinting ... Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    Introduce:

    Article Title: Mechanism of Action of the Arylomycin Antibiotics and Effects of Signal Peptidase I Inhibition
    Article Snippet: The DNA was ligated into the vector pTetBHR2 that had been digested with XhoI and XmaI (New England BioLabs) and treated with Klenow fragment DNA polymerase (New England BioLabs). .. The resulting vector was subjected to QuikChange mutagenesis (Stratagene) with primers described previously ( ) to introduce the LepB(P84L) or LepB(P84S) mutations, resulting in plasmids pTetBHR2-LepB(P84L) and pTetBHR2-LepB(P84S), respectively.

    other:

    Article Title: Strand-specific libraries for high throughput RNA sequencing (RNA-Seq) prepared without poly(A) selection
    Article Snippet: DNA Polymerase I, Large (Klenow) Fragment (5 U/μl, NEB, Catalog Number M0210L).

    Sequencing:

    Article Title: Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
    Article Snippet: .. In this study we used the same hairpin sequence as Zimmer and coworkers , Klenow fragment DNA polymerase (NEB, Inc.) NEB2 buffer (NEB, Inc.), and uniformly 13 C/15 N-labeled dNTPs (Isotec, Sigma-Aldrich and Silantes). .. Base- and heat-catalyzed cleavage separated the hairpin template from the 13 C/15 N-labeled synthesized product.

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: In order to extract HiC information through high-throughput sequencing using Illumina sequencers, the biotinylated DNA was sheared to sizes varying between 300 and 500 bp in length with Covaris LE220 (Covaris, Woburn, MA) (volume 130 μL in a Covaris microTUBE; fill level 10; duty cycle 15; PIP 500; cycles/burst 200; time 58 s). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Article Title: Mechanism of Action of the Arylomycin Antibiotics and Effects of Signal Peptidase I Inhibition
    Article Snippet: Briefly, the wild-type E. coli lepB coding sequence and upstream Shine-Dalgarno sequence were amplified using primers lepB+RBS_NF_NdeI and lepB_CR_KpnI, and the product was phosphorylated using T4 polynucleotide kinase (New England BioLabs). .. The DNA was ligated into the vector pTetBHR2 that had been digested with XhoI and XmaI (New England BioLabs) and treated with Klenow fragment DNA polymerase (New England BioLabs).

    Hi-C:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: Paragraph title: Construction of Hi-C library ... The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    DNA Extraction:

    Article Title: Antisense RNA Strategies for Metabolic Engineering of Clostridium acetobutylicum
    Article Snippet: Paragraph title: DNA isolation, manipulation, and transformation. ... Restriction endonucleases, T4 DNA ligase, Vent DNA polymerase, and the DNA polymerase I-large (Klenow) fragment were obtained from New England Biolabs (Beverly, Mass.) and used according to the manufacturer’s specifications.

    In Vivo:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: Paragraph title: In vivo footprinting ... Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min.

    RNA Sequencing Assay:

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: Paragraph title: 5′ End Enriched RNA-seq Library Construction ... Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210).

    Fluorescence:

    Article Title: Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction
    Article Snippet: Materials The hairpin fluorescence probe and oligonucleotide were commercially synthesized by TaKaRa Bio Inc. (Dalian, China). .. The polymerase Klenow fragment exo− was purchased from New England Biolabs, Inc.

    Mutagenesis:

    Article Title: Mechanism of Action of the Arylomycin Antibiotics and Effects of Signal Peptidase I Inhibition
    Article Snippet: The DNA was ligated into the vector pTetBHR2 that had been digested with XhoI and XmaI (New England BioLabs) and treated with Klenow fragment DNA polymerase (New England BioLabs). .. The resulting vector was subjected to QuikChange mutagenesis (Stratagene) with primers described previously ( ) to introduce the LepB(P84L) or LepB(P84S) mutations, resulting in plasmids pTetBHR2-LepB(P84L) and pTetBHR2-LepB(P84S), respectively.

    Isolation:

    Article Title: Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
    Article Snippet: In this study we used the same hairpin sequence as Zimmer and coworkers , Klenow fragment DNA polymerase (NEB, Inc.) NEB2 buffer (NEB, Inc.), and uniformly 13 C/15 N-labeled dNTPs (Isotec, Sigma-Aldrich and Silantes). .. The single-stranded DNA product was purified by 20 % denaturing polyacrylamide gel electrophoresis, isolated by passive elution from crushed gel pieces and desalted on a C18 reverse-phase column (Sep-Pak, Waters).

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Genomic DNA was isolated from 10–20 mL of YPD-grown cells using Qiagen Genomic-tip 100/G columns as described by the manufacturer. .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Labeling:

    Article Title: Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
    Article Snippet: All labeled single strands were synthesized in vitro by the method of Zimmer and coworkers using a DNA hairpin template with a 5′ overhang corresponding to the complement of the target labeled strand and a 3′ ribose (IDT, Inc.). .. In this study we used the same hairpin sequence as Zimmer and coworkers , Klenow fragment DNA polymerase (NEB, Inc.) NEB2 buffer (NEB, Inc.), and uniformly 13 C/15 N-labeled dNTPs (Isotec, Sigma-Aldrich and Silantes).

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat#1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min. ..

    Article Title: Divalent ions attenuate DNA synthesis by human DNA polymerase α by changing the structure of the template/primer or by perturbing the polymerase reaction
    Article Snippet: We have used the following primers and templates for the DNA polymerase reactions: 5’-TYE665 (Cy5-equivalent) labeled primers poly-dA15 , poly-rA15 , and hetero-DNA (5’-CTTGAAAACATAGCGA); templates poly-dT70 , 73a (5’-(T)35 -AGCGTCTTAATCTAAGCACTCGCTATGTTTTCAAGTTT), and 73b (5 - GTCTGGAATGATGAAGATTACTAGTGAAGATTCTGAGCGTCTTAATCTAAGCACTCGCTATGTT TTCAAGTTT). .. A large (Klenow) fragment of E. coli DNA Polymerase I (#M0210S; 5,000 units/ml) was purchased from New England Biolabs Inc., Ipswich, Massachusetts.

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: .. DNA smears (1 μg) were incubated with dTTP, dATP, fluorescein–12-dCTP (catalog number NEL434001EA; PerkinElmer), fluorescein–12-dGTP (catalog number NEL496001EA; PerkinElmer), and the E. coli polymerase I Klenow fragment (catalog number M0210S; NEB) at 37°C for 30 min. Purified DNA was run on a 6% TBE-polyacrylamide gel; labeling was visualized using a Typhoon 9400 laser scanner (excitation wavelength, 488 nm; emission wavelength, 520 nm; GE Healthcare Life Sciences). .. Total DNA was visualized by UV after EtBr staining.

    Purification:

    Article Title: Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
    Article Snippet: In this study we used the same hairpin sequence as Zimmer and coworkers , Klenow fragment DNA polymerase (NEB, Inc.) NEB2 buffer (NEB, Inc.), and uniformly 13 C/15 N-labeled dNTPs (Isotec, Sigma-Aldrich and Silantes). .. The single-stranded DNA product was purified by 20 % denaturing polyacrylamide gel electrophoresis, isolated by passive elution from crushed gel pieces and desalted on a C18 reverse-phase column (Sep-Pak, Waters).

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Article Title: Divalent ions attenuate DNA synthesis by human DNA polymerase α by changing the structure of the template/primer or by perturbing the polymerase reaction
    Article Snippet: The purification of human proteins, including the polα catalytic core (further referred to as polα-core), p70-p180ΔN (polα), and p49-p58-p70-p180ΔN (polα-prim), are described in [ , , ]. .. A large (Klenow) fragment of E. coli DNA Polymerase I (#M0210S; 5,000 units/ml) was purchased from New England Biolabs Inc., Ipswich, Massachusetts.

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The sheared DNA was purified with AMPure XP beads (Beckman Coulter, A63881). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: 5′ End Enriched RNA-seq Library Construction First strand of cDNA was prepared with 3 μg of purified RNA, random hexamers and Invitrogen SuperScript® III First-Strand Synthesis System (Pub. .. Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210).

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: .. DNA smears (1 μg) were incubated with dTTP, dATP, fluorescein–12-dCTP (catalog number NEL434001EA; PerkinElmer), fluorescein–12-dGTP (catalog number NEL496001EA; PerkinElmer), and the E. coli polymerase I Klenow fragment (catalog number M0210S; NEB) at 37°C for 30 min. Purified DNA was run on a 6% TBE-polyacrylamide gel; labeling was visualized using a Typhoon 9400 laser scanner (excitation wavelength, 488 nm; emission wavelength, 520 nm; GE Healthcare Life Sciences). .. Total DNA was visualized by UV after EtBr staining.

    Polymerase Chain Reaction:

    Article Title: Unusual isothermal multimerization and amplification by the strand-displacing DNA polymerases with reverse transcription activities
    Article Snippet: General information Bst DNA polymerase Large fragment (Bst LF), Bst 2.0 DNA polymerase (Bst 2.0), Bst 2.0 WarmStart DNA polymerase (Bst 2.0 WS), Bst 3.0 DNA polymerase (Bst 3.0), Klenow fragment polymerase (Klenow), Klenow fragment exo- polymerase (Klenow (exo-)), Vent exo- DNA polymerase (Vent (exo-)), and dNTP Mix were purchased from New England Biolabs. .. BcaBEST RNA PCR kit Ver.1.1, z-Taq, RTase M-MLV (RNase H-), Reverse Transcriptase XL (AMV) were purchased from Takara.

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB. .. Addition of a dATP to end-repaired DNA was performed by incubation at 37°C for 30 min; 32 μL of end-repaired DNA, 5 μL of Buffer 2 [NEB #B7002S], 1 μL 10mM dATP [Invitrogen #18252-015], 3 μL Klenow Exo- Fragment [NEB #M0212L]).

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min. .. The HiC library was constructed by amplifying the innate one directly off of the T1 beads through PCR using Illumina primers and protocol, which was separated from the beads, purified with AMpure XP beads and eluted from the beads into 1× Tris buffer, yielding an in situ HiC library.

    Article Title: Antisense RNA Strategies for Metabolic Engineering of Clostridium acetobutylicum
    Article Snippet: Restriction endonucleases, T4 DNA ligase, Vent DNA polymerase, and the DNA polymerase I-large (Klenow) fragment were obtained from New England Biolabs (Beverly, Mass.) and used according to the manufacturer’s specifications. .. Restriction sites were engineered into amplified DNA fragments by using a previously described PCR protocol ( ).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
    Article Snippet: In this study we used the same hairpin sequence as Zimmer and coworkers , Klenow fragment DNA polymerase (NEB, Inc.) NEB2 buffer (NEB, Inc.), and uniformly 13 C/15 N-labeled dNTPs (Isotec, Sigma-Aldrich and Silantes). .. The single-stranded DNA product was purified by 20 % denaturing polyacrylamide gel electrophoresis, isolated by passive elution from crushed gel pieces and desalted on a C18 reverse-phase column (Sep-Pak, Waters).

    IA:

    Article Title: Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction
    Article Snippet: The polymerase Klenow fragment exo− was purchased from New England Biolabs, Inc. .. Deionized water was obtained through the Nanopure Infinity™ ultrapure water system (Barnstead/Thermolyne Corp., Dubuque, IA, USA).

    Agarose Gel Electrophoresis:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain
    Article Snippet: .. Then, 5 µl of 5X labeling buffer from the DECAprimerTM II (Ambion, Cat1455) kit (without dCTP), 10 µl α-32 P-dCTP (10 µCi/µl, 3000Ci/mmol), and 1 µl DNA pol I Klenow fragment (5 units total; NEB, Cat# M0210S) were added to the denatured template/primer solution and incubated at 37°C for 30 min. ..

    Plasmid Preparation:

    Article Title: Antisense RNA Strategies for Metabolic Engineering of Clostridium acetobutylicum
    Article Snippet: Plasmid DNA was prepared from C. acetobutylicum by using an alkaline lysis protocol developed for C. acetobutylicum ( ). .. Restriction endonucleases, T4 DNA ligase, Vent DNA polymerase, and the DNA polymerase I-large (Klenow) fragment were obtained from New England Biolabs (Beverly, Mass.) and used according to the manufacturer’s specifications.

    Article Title: Mechanism of Action of the Arylomycin Antibiotics and Effects of Signal Peptidase I Inhibition
    Article Snippet: .. The DNA was ligated into the vector pTetBHR2 that had been digested with XhoI and XmaI (New England BioLabs) and treated with Klenow fragment DNA polymerase (New England BioLabs). .. The resulting vector was subjected to QuikChange mutagenesis (Stratagene) with primers described previously ( ) to introduce the LepB(P84L) or LepB(P84S) mutations, resulting in plasmids pTetBHR2-LepB(P84L) and pTetBHR2-LepB(P84S), respectively.

    In Vitro:

    Article Title: Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
    Article Snippet: All labeled single strands were synthesized in vitro by the method of Zimmer and coworkers using a DNA hairpin template with a 5′ overhang corresponding to the complement of the target labeled strand and a 3′ ribose (IDT, Inc.). .. In this study we used the same hairpin sequence as Zimmer and coworkers , Klenow fragment DNA polymerase (NEB, Inc.) NEB2 buffer (NEB, Inc.), and uniformly 13 C/15 N-labeled dNTPs (Isotec, Sigma-Aldrich and Silantes).

    Selection:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The DNA fragments in the range of 300–500 bp retained on the beads were eluted, quantified by Qubit dsDNA High Sensitivity Assay (Life Technologies, Q32854), and run on a 2% agarose gel to verify successful size selection. .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Article Title: UTRme: A Scoring-Based Tool to Annotate Untranslated Regions in Trypanosomatid Genomes
    Article Snippet: Second strand of cDNA was prepared using a specific SL primer (5′tacagtttctgtactatattg3′) and DNA Polymerase I Large (Klenow) Fragment (NEB M0210). .. Library preparation protocol included end-repair, adapters ligation, size selection (Pipping Prep SAGE System), and amplification of the library using manufacturer's recommended protocol Ion plus fragment library kit (Pub.

    Sample Prep:

    Article Title: Evolutionary evidence for multi-host transmission of cetacean morbillivirus
    Article Snippet: Paragraph title: Sample preparation ... Second-strand cDNA synthesis was performed with Klenow fragment DNA polymerase (New England Biolab [NEB], Ipswich, MA, USA).

    In Situ:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min. .. The HiC library was constructed by amplifying the innate one directly off of the T1 beads through PCR using Illumina primers and protocol, which was separated from the beads, purified with AMpure XP beads and eluted from the beads into 1× Tris buffer, yielding an in situ HiC library.

    Hydrophobic Interaction Chromatography:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: In order to extract HiC information through high-throughput sequencing using Illumina sequencers, the biotinylated DNA was sheared to sizes varying between 300 and 500 bp in length with Covaris LE220 (Covaris, Woburn, MA) (volume 130 μL in a Covaris microTUBE; fill level 10; duty cycle 15; PIP 500; cycles/burst 200; time 58 s). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Next-Generation Sequencing:

    Article Title: Evolutionary evidence for multi-host transmission of cetacean morbillivirus
    Article Snippet: Second-strand cDNA synthesis was performed with Klenow fragment DNA polymerase (New England Biolab [NEB], Ipswich, MA, USA). .. To determine the amount of CeMV present in the samples before performing NGS, DMV and PMV RT-PCRs were performed as previously described .

    Nuclear Magnetic Resonance:

    Article Title: Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
    Article Snippet: Paragraph title: NMR Samples and Resonance Assignments ... In this study we used the same hairpin sequence as Zimmer and coworkers , Klenow fragment DNA polymerase (NEB, Inc.) NEB2 buffer (NEB, Inc.), and uniformly 13 C/15 N-labeled dNTPs (Isotec, Sigma-Aldrich and Silantes).

    Concentration Assay:

    Article Title: Characterization of a novel DNA polymerase activity assay enabling sensitive, quantitative and universal detection of viable microbes
    Article Snippet: DPE reaction conditions DNA Pol I (NEB cat# M0209L), Klenow (NEB cat# M0210S) and Klenow exo(−) (NEB cat# M0212S) were diluted to the indicated units per microliter stock in sterile Tris–EDTA, pH 8.0. .. To begin, 2 µl of DNA polymerase stock at each concentration were placed into a 50 -µl DPE reaction mixture containing the following components: 50 µM dNTP, 20 mM Tris, pH 8.0, 10 mM ammonium sulfate, 10 mM potassium chloride, 2 mM magnesium sulfate, 1% BSA, 0.1% Triton X-100, 0.1% Tween-20 and 0.001 µM pre-annealed DNA substrate (described above).

    Alkaline Lysis:

    Article Title: Antisense RNA Strategies for Metabolic Engineering of Clostridium acetobutylicum
    Article Snippet: Plasmid DNA was prepared from C. acetobutylicum by using an alkaline lysis protocol developed for C. acetobutylicum ( ). .. Restriction endonucleases, T4 DNA ligase, Vent DNA polymerase, and the DNA polymerase I-large (Klenow) fragment were obtained from New England Biolabs (Beverly, Mass.) and used according to the manufacturer’s specifications.

    High Throughput Screening Assay:

    Article Title: Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation
    Article Snippet: In order to extract HiC information through high-throughput sequencing using Illumina sequencers, the biotinylated DNA was sheared to sizes varying between 300 and 500 bp in length with Covaris LE220 (Covaris, Woburn, MA) (volume 130 μL in a Covaris microTUBE; fill level 10; duty cycle 15; PIP 500; cycles/burst 200; time 58 s). .. The sheared DNA fragments were end-repaired with NEB T4 PNK (NEB, M0201), NEB T4 DNA polymerase I (NEB, M0203), and NEB DNA polymerase I Large (Klenow) Fragment (NEB, M0210) at room temperature for 30 min, and NEB Klenow exo minus (NEB, M0212) at 37 °C for 30 min.

    Staining:

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: DNA smears (1 μg) were incubated with dTTP, dATP, fluorescein–12-dCTP (catalog number NEL434001EA; PerkinElmer), fluorescein–12-dGTP (catalog number NEL496001EA; PerkinElmer), and the E. coli polymerase I Klenow fragment (catalog number M0210S; NEB) at 37°C for 30 min. Purified DNA was run on a 6% TBE-polyacrylamide gel; labeling was visualized using a Typhoon 9400 laser scanner (excitation wavelength, 488 nm; emission wavelength, 520 nm; GE Healthcare Life Sciences). .. Total DNA was visualized by UV after EtBr staining.

    Variant Assay:

    Article Title: Divalent ions attenuate DNA synthesis by human DNA polymerase α by changing the structure of the template/primer or by perturbing the polymerase reaction
    Article Snippet: The three-subunit wild-type yeast polδ and its exonuclease-defective variant, Pol3-5DV, were generous gifts from Dr. Polina Shcherbakova’s laboratory (University of Nebraska Medical Center) and Dr. Peter Burgers’ laboratory (Washington University Medical School), respectively. .. A large (Klenow) fragment of E. coli DNA Polymerase I (#M0210S; 5,000 units/ml) was purchased from New England Biolabs Inc., Ipswich, Massachusetts.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs micrococcal nuclease mnase digestion digestion
    AGO2 knock-down affects nucleosome occupancy at TSSs bound by SWI/SNF. ( a ) HeLaS3 cells were transfected with a control siRNA (siCTRL) or a pool of AGO2 siRNA (siAGO2). Down-regulation of AGO2 protein was verified by western blot. GAPDH was used as loading control. ( b ) Chromatin from siCTRL- or siAGO2-treated HeLaS3 cells was digested by <t>MNase</t> and recovered <t>DNA</t> fragments were sequenced. Nucleosome occupancy profile for siCTRL and siAGO2 cells was plotted for TSSs with at least 30 swiRNAs (siCTRL, black line; siAGO2, green line). The occupancy at the nucleosome +1 (arrow) is reduced in AGO2 knock-down cells. ( c ) Bars height represents percent reduction of nucleosome occupancy (siAGO2 versus siCTRL) at TSS ±150 nt overlapped by at least the indicated number of swiRNAs (green), IgG-IP ‘other sRNAs’ (black) and AGO1-associated ‘other sRNAs’ (purple). ** P value
    Micrococcal Nuclease Mnase Digestion Digestion, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 106 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/micrococcal nuclease mnase digestion digestion/product/New England Biolabs
    Average 99 stars, based on 106 article reviews
    Price from $9.99 to $1999.99
    micrococcal nuclease mnase digestion digestion - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    AGO2 knock-down affects nucleosome occupancy at TSSs bound by SWI/SNF. ( a ) HeLaS3 cells were transfected with a control siRNA (siCTRL) or a pool of AGO2 siRNA (siAGO2). Down-regulation of AGO2 protein was verified by western blot. GAPDH was used as loading control. ( b ) Chromatin from siCTRL- or siAGO2-treated HeLaS3 cells was digested by MNase and recovered DNA fragments were sequenced. Nucleosome occupancy profile for siCTRL and siAGO2 cells was plotted for TSSs with at least 30 swiRNAs (siCTRL, black line; siAGO2, green line). The occupancy at the nucleosome +1 (arrow) is reduced in AGO2 knock-down cells. ( c ) Bars height represents percent reduction of nucleosome occupancy (siAGO2 versus siCTRL) at TSS ±150 nt overlapped by at least the indicated number of swiRNAs (green), IgG-IP ‘other sRNAs’ (black) and AGO1-associated ‘other sRNAs’ (purple). ** P value

    Journal: Nucleic Acids Research

    Article Title: ARGONAUTE2 cooperates with SWI/SNF complex to determine nucleosome occupancy at human Transcription Start Sites

    doi: 10.1093/nar/gku1387

    Figure Lengend Snippet: AGO2 knock-down affects nucleosome occupancy at TSSs bound by SWI/SNF. ( a ) HeLaS3 cells were transfected with a control siRNA (siCTRL) or a pool of AGO2 siRNA (siAGO2). Down-regulation of AGO2 protein was verified by western blot. GAPDH was used as loading control. ( b ) Chromatin from siCTRL- or siAGO2-treated HeLaS3 cells was digested by MNase and recovered DNA fragments were sequenced. Nucleosome occupancy profile for siCTRL and siAGO2 cells was plotted for TSSs with at least 30 swiRNAs (siCTRL, black line; siAGO2, green line). The occupancy at the nucleosome +1 (arrow) is reduced in AGO2 knock-down cells. ( c ) Bars height represents percent reduction of nucleosome occupancy (siAGO2 versus siCTRL) at TSS ±150 nt overlapped by at least the indicated number of swiRNAs (green), IgG-IP ‘other sRNAs’ (black) and AGO1-associated ‘other sRNAs’ (purple). ** P value

    Article Snippet: Isolation of nucleosomal DNA by micrococcal nuclease (MNase) digestion Digestion of chromatin from untreated, siCTRL- or siAGO2-treated HeLa S3 cells (2 × 106 ) was performed with 50 U of MNase (New England Biolabs) in 300 μl of permeabilization buffer (15 mM Tris–HCl pH 7.4, 300 mM sucrose, 60 mM KCl, 15 mM NaCl, 4 mM CaCl2 , 0.5 mM EGTA, 0.2% NP-40, 0.5 mM β-mercaptoethanol) for 20 min at 37°C.

    Techniques: Transfection, Western Blot