neb cutsmart buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    CutSmart Buffer
    Description:
    CutSmart Buffer 5 0 ml
    Catalog Number:
    b7204s
    Price:
    24
    Size:
    5 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs neb cutsmart buffer
    CutSmart Buffer
    CutSmart Buffer 5 0 ml
    https://www.bioz.com/result/neb cutsmart buffer/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    neb cutsmart buffer - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: Paragraph title: Barcoded guide-donor library cloning ... 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Article Title: A simple and efficient cloning system for CRISPR/Cas9-mediated genome editing in rice
    Article Snippet: Paragraph title: Construction of expression clones ... The reagents were recommended as following: one ul of PCR product, 50 ng of PJG112, 1 ul of Cutsmart Buffer (NEB), 0.4 ul of T4 ligase buffer (NEB), 5 U of Bsa I (NEB), 20 U of T4 DNA ligase (NEB) and add ddH2 O to 10 ul.

    Amplification:

    Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
    Article Snippet: .. Digestion of amplification products was performed using 10 μl PCR product, 2 μl CutSmart Buffer (New England BioLabs), and 1 U of restriction enzyme and filled up with aqua dest to a final volume of 20 μl. .. The reaction conditions were 16 h (for PTH1R and TRAFD1 ) or 2 h (for STC1 ) at 37 °C for incubation and 20 min at 65 °C for enzyme inactivation.

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We made this switch because this oligo is compatible with HiSeq2500, MiSeq, and NextSeq sequencers (lllumina), while the original one requires a custom sequencing primer with an annealing temperature that is only suitable for the HiSeq2000. ( 3 ) We used a PCR primer with sequence compatible to dT oligo and 5’ TSO, 5′-CTACACGACGCTCTTCCGATCT-3′, for cDNA amplification. .. We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: The guide-donor oligos were amplified using KAPA HiFi polymerase as directed by the manufacturer in 50 uL total reaction volume with an initial denaturation of 98°C for 1 min, and then 15 cycles of 98°C 10s, 60°C 20s, and 72°C 30s. .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Article Title: A simple and efficient cloning system for CRISPR/Cas9-mediated genome editing in rice
    Article Snippet: Primers containing adaptors for Golden Gate cloning (OJH307 and OJH308, ) were used in the amplification with PJG090 as the template. .. The reagents were recommended as following: one ul of PCR product, 50 ng of PJG112, 1 ul of Cutsmart Buffer (NEB), 0.4 ul of T4 ligase buffer (NEB), 5 U of Bsa I (NEB), 20 U of T4 DNA ligase (NEB) and add ddH2 O to 10 ul.

    Synthesized:

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We synthesized cDNA from 10 ng K-562 total RNA plus 0.64 μl 1/500× dilution of pooled original, uncapped ERCC spike-in RNA following a published protocol , combined with reverse transcription-PCR conditions based on SMART-Seq2 and the following modifications. ( 1 ) We used a 5’ biotin blocked dT oligo that contains a SalI restriction site (shown as underlined), 5′-/5Biosg/CTACACGACGCTCTTCCGATCT GTCGACT (30)VN–3’. ( 2 ) We used a 5’ template switching oligo (TSO) containing an Illumina adaptor sequence, 5′-CUACACGACGCUCUUCCGAUCUNNNNNGGG – noting all bases are RNA. .. We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes.

    Real-time Polymerase Chain Reaction:

    Article Title: Identification of an Intermediate in Hepatitis B Virus Covalently Closed Circular (CCC) DNA Formation and Sensitive and Selective CCC DNA Detection
    Article Snippet: .. For exonuclease T5 (Exo T5) digestion, 20 μl PF DNA sample was treated with 0.5 μl (5 units) Exo T5 in 1× Cutsmart buffer (NEB) in a total volume of 23 μl ( ) at 37°C for 2 to 3 h. Phenol extraction was then used to remove the nucleases before qPCR. .. To confirm the circular nature of CCC DNA, samples were heated at 95°C for 10 min with or without subsequent MfeI-HF (10 units) digestion to linearize the circular DNA.

    Incubation:

    Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
    Article Snippet: Digestion of amplification products was performed using 10 μl PCR product, 2 μl CutSmart Buffer (New England BioLabs), and 1 U of restriction enzyme and filled up with aqua dest to a final volume of 20 μl. .. The reaction conditions were 16 h (for PTH1R and TRAFD1 ) or 2 h (for STC1 ) at 37 °C for incubation and 20 min at 65 °C for enzyme inactivation.

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: .. The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min. .. The fragmented DNA was then incubated with anti-5-mC and anti-5-hmC antibodies in IP buffer for 6 h at 4 °C.

    Article Title: Decreased Enhancer-Promoter Proximity Accompanying Enhancer Activation
    Article Snippet: Cells were then disrupted on ice with a Dounce homogenizer (pestle B; 2 × 20 strokes) and cell suspensions centrifuged at 2000 g for 5 min. Supernatants were removed, the cell pellets were washed twice with 100 μL of 1 × CutSmart buffer (New England Biolabs), and resuspended in 100 μL of 1 × CutSmart buffer and divided into two Eppendorf tubes. .. 1 × CutSmart buffer (337 μL) was added to each tube, and the mixture was incubated for 10 min at 65°C with 0.1% SDS.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C. .. Reactions were column-cleaned and 400 ng of each insert was ligated with T4 DNA ligase into 1 ug of recipient vector ( > 7:1 insert:vector) treated with NotI, AscI, as well as CIP (NEB) – either pKR216 ( SEC14 library) or pKR348 (natural variants library) – in a total volume of 20 uL.

    TRF Assay:

    Article Title: Divergent patterns of telomere shortening in tropical compared to temperate stonechats, et al. Divergent patterns of telomere shortening in tropical compared to temperate stonechats
    Article Snippet: DNA integrity was assessed through the use of integrity gels (Nussey et al., ), and telomeres of high integrity DNA samples were then measured using the TRF assay. .. A 10 µg quantity of DNA was digested using 1.0 ml of RsaI (New England Biolabs, R0167L) and 0.2 ml of HinfI (New England Biolabs, R0155M) in CutSmart Buffer (New England Biolabs, B7204S) overnight at 37°C.

    Expressing:

    Article Title: A simple and efficient cloning system for CRISPR/Cas9-mediated genome editing in rice
    Article Snippet: Paragraph title: Construction of expression clones ... The reagents were recommended as following: one ul of PCR product, 50 ng of PJG112, 1 ul of Cutsmart Buffer (NEB), 0.4 ul of T4 ligase buffer (NEB), 5 U of Bsa I (NEB), 20 U of T4 DNA ligase (NEB) and add ddH2 O to 10 ul.

    Modification:

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: Paragraph title: Crosslink-assistant DNA modification immunoprecipitation assay ... The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min.

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes. .. We made the sequencing library with a modified NexteraXT (Illumina) protocol with the following modifications in addition. ( 1 ) We used 0.125 ng cDNA in ½ volume of a standard NexteraXT reaction. ( 2 ) We used the modified Nextera Index 1 primer, 5′-CAAGCAGAAGACGGCATACGAGATxrefXXGTCTCGTGGGCTCGGAGA*T*G-3′ with phosphorothioate bonds (denoted by *) and inverted end bases for protection; the 8 “X” bases indicate in-line index sequences that enable pooling samples.

    Countercurrent Chromatography:

    Article Title: Identification of an Intermediate in Hepatitis B Virus Covalently Closed Circular (CCC) DNA Formation and Sensitive and Selective CCC DNA Detection
    Article Snippet: For Exo I and Exo III (Exo I & III) digestion, 20 μl PF DNA prepared as described above was treated with 0.25 μl each of Exo I (NEB; 5 units) and Exo III (NEB; 25 units) in 1× NEB Cutsmart buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/ml bovine serum albumin [BSA], pH 7.9 [prepared at 25°C]) or 1× NEB buffer 3 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2 , 100 μg/ml BSA, pH 7.9 [prepared at 25°C]), as indicated, at 37°C for 2 to 3 h in a total volume of 23 μl. .. The amount of Exo I was able to be increased 4-fold from the standard conditions without affecting CCC DNA detection, but a 2-fold increase in the amount of Exo III sometimes led to some decrease in CCC DNA levels.

    Electroporation:

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C. .. 1 uL of each reaction was then electroporated into 20 uL NEB 10-beta in 0.1 cm-gap electroporation cuvettes (Bio-Rad) with the Bio-Rad GenePulser electroporator using the settings 1.7 kV, 200 Omega, and 25 μF.

    Southern Blot:

    Article Title: Identification of an Intermediate in Hepatitis B Virus Covalently Closed Circular (CCC) DNA Formation and Sensitive and Selective CCC DNA Detection
    Article Snippet: For Exo I and Exo III (Exo I & III) digestion, 20 μl PF DNA prepared as described above was treated with 0.25 μl each of Exo I (NEB; 5 units) and Exo III (NEB; 25 units) in 1× NEB Cutsmart buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/ml bovine serum albumin [BSA], pH 7.9 [prepared at 25°C]) or 1× NEB buffer 3 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2 , 100 μg/ml BSA, pH 7.9 [prepared at 25°C]), as indicated, at 37°C for 2 to 3 h in a total volume of 23 μl. .. Treatment with either Exo I or Exo III alone did not appear capable of degrading all RC DNA completely such that viral DNA smears remained detectable by Southern blotting following digestion.

    Ligation:

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C. .. Ligation reactions were ethanol precipitated by adding 80 uL 100% EtOH and 2 uL of 5M NaOAc pH 5.2 with 1 uL of glycoblue (Ambion), incubated on ice for 10 minutes and spun at 13.2 krpm for 5 min, washed with 70% ethanol, and then re-suspended in 3 uL of nuclease-free water (IDT).

    Cell Culture:

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: DNA was isolated from cultured cells or mononuclear bone marrow cells using a Qiagen DNAeasy kit (catalogue # 69506, Valencia, CA). .. The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min.

    DNA Sequencing:

    Article Title: A simple and efficient cloning system for CRISPR/Cas9-mediated genome editing in rice
    Article Snippet: The reagents were recommended as following: one ul of PCR product, 50 ng of PJG112, 1 ul of Cutsmart Buffer (NEB), 0.4 ul of T4 ligase buffer (NEB), 5 U of Bsa I (NEB), 20 U of T4 DNA ligase (NEB) and add ddH2 O to 10 ul. .. Then the expression vector for CRISPR/Cas9 mediated genome editing was verified by DNA sequencing and renamed as PJF943.

    Sequencing:

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We made this switch because this oligo is compatible with HiSeq2500, MiSeq, and NextSeq sequencers (lllumina), while the original one requires a custom sequencing primer with an annealing temperature that is only suitable for the HiSeq2000. ( 3 ) We used a PCR primer with sequence compatible to dT oligo and 5’ TSO, 5′-CTACACGACGCTCTTCCGATCT-3′, for cDNA amplification. .. We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: We amplified subpools with a forward primer harboring an AscI restriction site at its 3′-end and a reverse primer with a NotI site at its 5′-end followed by a degenerate barcode encoding a pseudo-random sequence (either NNNVHTGNNNVHTGNNNVHTGNNNVHTGNNN or NNNTGVHNNNTGVHNNNTGVHNNNTGVHNNN) that excludes illegal restriction sites (NotI, AscI, and BspQI), followed by subpool-specific priming sequence. .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Antiviral Assay:

    Article Title: Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Coconversion
    Article Snippet: .. The following restriction digestions were used: armi sgRNA-1 DSB: an Ava II site 6 bp away; 5 µl of PCR digested with Ava II [0.2 U/µl final concentration (f.c.)] in 0.5× CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA) in 10 µl final volume (f.v.) at 37° for 2 hr; armi sgRNA-2/3 DSBs: a BstNI site 1 bp (sgRNA-2) or 1 bp (sgRNA-3) away; 5 µl of PCR with Bst NI (0.5 U/µl f.c.) in 1× NEBuffer 3.1 (NEB) in 10.5 µl f.v. at 60° for 1 hr; armi sgRNA-4 DSB: no restriction enzyme site nearby; digested with T7E1 as described below; armi sgRNA-5/6 DSBs: a PmlI site 17 bp (sgRNA-5) or 11 bp (sgRNA-6) away; 10 µl PCR with Eco 72I (0.5 U/µl f.c., Thermo Fisher) in 12.5 µl f.v. at room temperature for 1 hr; zuc sgRNA-1 DSB: a BccI site 9 bp away; 5 µl of PCR with Bcc I (0.5 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 1 hr; zuc sgRNA-2 DSB: a Hpy CH4III site 7 bp away; 5 µl of PCR with Hpy CH4III (0.25 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 2 hr. .. T7 endonuclease I (T7E1) digestion: To complement the restriction enzyme digestion, the same PCR products were denatured, reannealed to form heteroduplex, and digested with the mismatch-specific, sequence-independent T7E1.

    Pulsed-Field Gel:

    Article Title: Divergent patterns of telomere shortening in tropical compared to temperate stonechats, et al. Divergent patterns of telomere shortening in tropical compared to temperate stonechats
    Article Snippet: A 10 µg quantity of DNA was digested using 1.0 ml of RsaI (New England Biolabs, R0167L) and 0.2 ml of HinfI (New England Biolabs, R0155M) in CutSmart Buffer (New England Biolabs, B7204S) overnight at 37°C. .. The digested DNA was separated using pulsed‐field gel electrophoresis (3 V/cm, 0.5‐ to 7.0‐s switch times, 14°C) for 19 hr on a 0.8% nondenaturing agarose gel.

    Methylation:

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: Crosslink-assisted DNA modification IP assay was modified from the previously published methylated DNA IP protocol . .. The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min.

    Purification:

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes. .. We purified this product by using 0.7x volume AMPureXP SPRI beads (Beckman Coulter Genomics) following vendor protocol.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: Reactions were column-cleaned with the Qiagen QIAquick PCR purification kit. .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Polymerase Chain Reaction:

    Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
    Article Snippet: .. Digestion of amplification products was performed using 10 μl PCR product, 2 μl CutSmart Buffer (New England BioLabs), and 1 U of restriction enzyme and filled up with aqua dest to a final volume of 20 μl. .. The reaction conditions were 16 h (for PTH1R and TRAFD1 ) or 2 h (for STC1 ) at 37 °C for incubation and 20 min at 65 °C for enzyme inactivation.

    Article Title: Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Coconversion
    Article Snippet: .. The following restriction digestions were used: armi sgRNA-1 DSB: an Ava II site 6 bp away; 5 µl of PCR digested with Ava II [0.2 U/µl final concentration (f.c.)] in 0.5× CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA) in 10 µl final volume (f.v.) at 37° for 2 hr; armi sgRNA-2/3 DSBs: a BstNI site 1 bp (sgRNA-2) or 1 bp (sgRNA-3) away; 5 µl of PCR with Bst NI (0.5 U/µl f.c.) in 1× NEBuffer 3.1 (NEB) in 10.5 µl f.v. at 60° for 1 hr; armi sgRNA-4 DSB: no restriction enzyme site nearby; digested with T7E1 as described below; armi sgRNA-5/6 DSBs: a PmlI site 17 bp (sgRNA-5) or 11 bp (sgRNA-6) away; 10 µl PCR with Eco 72I (0.5 U/µl f.c., Thermo Fisher) in 12.5 µl f.v. at room temperature for 1 hr; zuc sgRNA-1 DSB: a BccI site 9 bp away; 5 µl of PCR with Bcc I (0.5 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 1 hr; zuc sgRNA-2 DSB: a Hpy CH4III site 7 bp away; 5 µl of PCR with Hpy CH4III (0.25 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 2 hr. .. T7 endonuclease I (T7E1) digestion: To complement the restriction enzyme digestion, the same PCR products were denatured, reannealed to form heteroduplex, and digested with the mismatch-specific, sequence-independent T7E1.

    Article Title: Mixing alters the lytic activity of viruses in the dark ocean
    Article Snippet: Each 15 μL restriction digest contained 1.5 μL 10× CutSmart buffer (500 mmol/L K‐acetate, 200 mmol/L Tris‐acetate, 100 mmol/L Mg‐acetate, 1 mg/mL BSA, pH 7.9) and 0.5 μL of restriction enzyme Hha I (20,000 units/mL; Cat. No. R0139S, both from New England BioLabs, Ipswich, Massachusetts, USA). .. The amount of PCR products added to the restriction digests (1–12 μL) was standardized using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific).

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We made this switch because this oligo is compatible with HiSeq2500, MiSeq, and NextSeq sequencers (lllumina), while the original one requires a custom sequencing primer with an annealing temperature that is only suitable for the HiSeq2000. ( 3 ) We used a PCR primer with sequence compatible to dT oligo and 5’ TSO, 5′-CTACACGACGCTCTTCCGATCT-3′, for cDNA amplification. .. We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C. .. Reactions were column-cleaned and 400 ng of each insert was ligated with T4 DNA ligase into 1 ug of recipient vector ( > 7:1 insert:vector) treated with NotI, AscI, as well as CIP (NEB) – either pKR216 ( SEC14 library) or pKR348 (natural variants library) – in a total volume of 20 uL.

    Article Title: A simple and efficient cloning system for CRISPR/Cas9-mediated genome editing in rice
    Article Snippet: .. The reagents were recommended as following: one ul of PCR product, 50 ng of PJG112, 1 ul of Cutsmart Buffer (NEB), 0.4 ul of T4 ligase buffer (NEB), 5 U of Bsa I (NEB), 20 U of T4 DNA ligase (NEB) and add ddH2 O to 10 ul. ..

    Immunoprecipitation:

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: Paragraph title: Crosslink-assistant DNA modification immunoprecipitation assay ... The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min.

    CRISPR:

    Article Title: A simple and efficient cloning system for CRISPR/Cas9-mediated genome editing in rice
    Article Snippet: The reagents were recommended as following: one ul of PCR product, 50 ng of PJG112, 1 ul of Cutsmart Buffer (NEB), 0.4 ul of T4 ligase buffer (NEB), 5 U of Bsa I (NEB), 20 U of T4 DNA ligase (NEB) and add ddH2 O to 10 ul. .. Then the expression vector for CRISPR/Cas9 mediated genome editing was verified by DNA sequencing and renamed as PJF943.

    Plasmid Preparation:

    Article Title: Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection
    Article Snippet: .. Portions of lysates were further heat inactivated (HI) at 95°C for 10 min. One µg of the commercial plasmid pECFP-N1 (Clonetech, CA, USA) was subjected to either MS11 P+ lysate or HI lysate together with CutSmart buffer (New England Biolabs, Ipswich, MA, USA) for 1 h. As controls, circular/uncut pECFP-N1 was used as well as HindIII (Roche, Mannheim, Germany) linearized pECFP-N1. .. The plasmid reactions were run on 1% agarose gel electrophoresis in 1xTBE buffer and stained with ethidium bromide.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: NotI and AscI sites enable sticky end cloning into a multi-copy recipient vector, with the AscI site at the 3′-end of the guide RNA promoter. .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Article Title: A simple and efficient cloning system for CRISPR/Cas9-mediated genome editing in rice
    Article Snippet: The reagents were recommended as following: one ul of PCR product, 50 ng of PJG112, 1 ul of Cutsmart Buffer (NEB), 0.4 ul of T4 ligase buffer (NEB), 5 U of Bsa I (NEB), 20 U of T4 DNA ligase (NEB) and add ddH2 O to 10 ul. .. Then the expression vector for CRISPR/Cas9 mediated genome editing was verified by DNA sequencing and renamed as PJF943.

    Agarose Gel Electrophoresis:

    Article Title: Divergent patterns of telomere shortening in tropical compared to temperate stonechats, et al. Divergent patterns of telomere shortening in tropical compared to temperate stonechats
    Article Snippet: A 10 µg quantity of DNA was digested using 1.0 ml of RsaI (New England Biolabs, R0167L) and 0.2 ml of HinfI (New England Biolabs, R0155M) in CutSmart Buffer (New England Biolabs, B7204S) overnight at 37°C. .. The digested DNA was separated using pulsed‐field gel electrophoresis (3 V/cm, 0.5‐ to 7.0‐s switch times, 14°C) for 19 hr on a 0.8% nondenaturing agarose gel.

    Article Title: Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection
    Article Snippet: Portions of lysates were further heat inactivated (HI) at 95°C for 10 min. One µg of the commercial plasmid pECFP-N1 (Clonetech, CA, USA) was subjected to either MS11 P+ lysate or HI lysate together with CutSmart buffer (New England Biolabs, Ipswich, MA, USA) for 1 h. As controls, circular/uncut pECFP-N1 was used as well as HindIII (Roche, Mannheim, Germany) linearized pECFP-N1. .. The plasmid reactions were run on 1% agarose gel electrophoresis in 1xTBE buffer and stained with ethidium bromide.

    Spectrophotometry:

    Article Title: Mixing alters the lytic activity of viruses in the dark ocean
    Article Snippet: Each 15 μL restriction digest contained 1.5 μL 10× CutSmart buffer (500 mmol/L K‐acetate, 200 mmol/L Tris‐acetate, 100 mmol/L Mg‐acetate, 1 mg/mL BSA, pH 7.9) and 0.5 μL of restriction enzyme Hha I (20,000 units/mL; Cat. No. R0139S, both from New England BioLabs, Ipswich, Massachusetts, USA). .. The amount of PCR products added to the restriction digests (1–12 μL) was standardized using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific).

    Concentration Assay:

    Article Title: Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Coconversion
    Article Snippet: .. The following restriction digestions were used: armi sgRNA-1 DSB: an Ava II site 6 bp away; 5 µl of PCR digested with Ava II [0.2 U/µl final concentration (f.c.)] in 0.5× CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA) in 10 µl final volume (f.v.) at 37° for 2 hr; armi sgRNA-2/3 DSBs: a BstNI site 1 bp (sgRNA-2) or 1 bp (sgRNA-3) away; 5 µl of PCR with Bst NI (0.5 U/µl f.c.) in 1× NEBuffer 3.1 (NEB) in 10.5 µl f.v. at 60° for 1 hr; armi sgRNA-4 DSB: no restriction enzyme site nearby; digested with T7E1 as described below; armi sgRNA-5/6 DSBs: a PmlI site 17 bp (sgRNA-5) or 11 bp (sgRNA-6) away; 10 µl PCR with Eco 72I (0.5 U/µl f.c., Thermo Fisher) in 12.5 µl f.v. at room temperature for 1 hr; zuc sgRNA-1 DSB: a BccI site 9 bp away; 5 µl of PCR with Bcc I (0.5 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 1 hr; zuc sgRNA-2 DSB: a Hpy CH4III site 7 bp away; 5 µl of PCR with Hpy CH4III (0.25 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 2 hr. .. T7 endonuclease I (T7E1) digestion: To complement the restriction enzyme digestion, the same PCR products were denatured, reannealed to form heteroduplex, and digested with the mismatch-specific, sequence-independent T7E1.

    Staining:

    Article Title: Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection
    Article Snippet: Portions of lysates were further heat inactivated (HI) at 95°C for 10 min. One µg of the commercial plasmid pECFP-N1 (Clonetech, CA, USA) was subjected to either MS11 P+ lysate or HI lysate together with CutSmart buffer (New England Biolabs, Ipswich, MA, USA) for 1 h. As controls, circular/uncut pECFP-N1 was used as well as HindIII (Roche, Mannheim, Germany) linearized pECFP-N1. .. The plasmid reactions were run on 1% agarose gel electrophoresis in 1xTBE buffer and stained with ethidium bromide.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs mtase m hae iii
    The transformation frequencies of pBU4 into L. sphaericus C3–41 and its derivate mutants. Light gray column: pBU4 untreated; deep gray column: pBU4 methylated with C3–41 CFE; black column: pBU4 methylated with MTase M. Hae <t>III.</t> *, no transformant observed
    Mtase M Hae Iii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mtase m hae iii/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    mtase m hae iii - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    The transformation frequencies of pBU4 into L. sphaericus C3–41 and its derivate mutants. Light gray column: pBU4 untreated; deep gray column: pBU4 methylated with C3–41 CFE; black column: pBU4 methylated with MTase M. Hae III. *, no transformant observed

    Journal: BMC Microbiology

    Article Title: The LspC3–41I restriction-modification system is the major determinant for genetic manipulations of Lysinibacillus sphaericus C3–41

    doi: 10.1186/s12866-017-1014-6

    Figure Lengend Snippet: The transformation frequencies of pBU4 into L. sphaericus C3–41 and its derivate mutants. Light gray column: pBU4 untreated; deep gray column: pBU4 methylated with C3–41 CFE; black column: pBU4 methylated with MTase M. Hae III. *, no transformant observed

    Article Snippet: The methylation with commercial MTase M. Hae III (New England Biolabs) was processed according to the recommended protocol by the manufacturer.

    Techniques: Transformation Assay, Methylation

    The effect of Bsph_0498 (encoding LspC3–41I) on the restriction role of L. sphaericus C3–41 CFE. Untreated and pre-treated plasmid pBU4 was incubated with CFE and then subjected to restriction assays, and the reaction mixture was analyzed by agarose gel electrophoresis as show in the left three pictures (L) and Southern blot analysis as show in the right three pictures (R). a untreated pBU4. Lane 1, C3–41; lane 2, Δ0498; lane 3, RC0498; lane 4, Hae III digested; lane 5, Untreated. b pBU4 methylated with C3–41 CFE. Lane 1, C3–41; lane 2, Δ0498; lane 3, RC0498; lane 4, Hae III digested; lane 5, Untreated. c pBU4 methylated with MTase M. Hae III. Lane 1, C3–41; lane 2, Δ0498; lane 3, RC0498; lane 4, Hae III digested; lane 5, Untreated. M: DNA marker

    Journal: BMC Microbiology

    Article Title: The LspC3–41I restriction-modification system is the major determinant for genetic manipulations of Lysinibacillus sphaericus C3–41

    doi: 10.1186/s12866-017-1014-6

    Figure Lengend Snippet: The effect of Bsph_0498 (encoding LspC3–41I) on the restriction role of L. sphaericus C3–41 CFE. Untreated and pre-treated plasmid pBU4 was incubated with CFE and then subjected to restriction assays, and the reaction mixture was analyzed by agarose gel electrophoresis as show in the left three pictures (L) and Southern blot analysis as show in the right three pictures (R). a untreated pBU4. Lane 1, C3–41; lane 2, Δ0498; lane 3, RC0498; lane 4, Hae III digested; lane 5, Untreated. b pBU4 methylated with C3–41 CFE. Lane 1, C3–41; lane 2, Δ0498; lane 3, RC0498; lane 4, Hae III digested; lane 5, Untreated. c pBU4 methylated with MTase M. Hae III. Lane 1, C3–41; lane 2, Δ0498; lane 3, RC0498; lane 4, Hae III digested; lane 5, Untreated. M: DNA marker

    Article Snippet: The methylation with commercial MTase M. Hae III (New England Biolabs) was processed according to the recommended protocol by the manufacturer.

    Techniques: Plasmid Preparation, Incubation, Agarose Gel Electrophoresis, Southern Blot, Methylation, Marker