methyltransferase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    dam Methyltransferase
    Description:
    dam Methyltransferase 2 500 units
    Catalog Number:
    m0222l
    Price:
    314
    Size:
    2 500 units
    Category:
    DNA Methylases
    Buy from Supplier


    Structured Review

    New England Biolabs methyltransferase
    dam Methyltransferase
    dam Methyltransferase 2 500 units
    https://www.bioz.com/result/methyltransferase/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    methyltransferase - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Acetylene Reduction Assay:

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: Plasmids isolated from the dam+ dcm+ strain DH5α [F− Φ80 lac ZΔM15 Δ( lac ZYA- arg F) U169 rec A1 end A1 hsd R17 pho A sup E 44 thi -1 gyr A96 rel A1] were designated as fully methylated, while those isolated from a dam- dcm strain [ ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210∷Tn10) TetS endA1 rspL136 (StrR ) dam13∷Tn9 (CamR ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2; New England Biolabs] were considered to be un-methylated. .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I.

    Amplification:

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius
    Article Snippet: Genomic DNA extracted from asynchronous S. acidocaldarius cells (10 ng) was amplified during 17 h at 30°C using the Repli-g mini kit (Qiagen) and used as negative control for the search of all DNA modifications. .. An aliquot (250 ng) of the whole genome amplification (WGA) sample was methylated for 1 h at 37°C by 0.002 Units of Dam methyltransferase in presence of 80 μM S-adenosylmethionine (New England BioLabs) in order to create the positive control for the detection of m6A methylations.

    Article Title: AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration
    Article Snippet: For each construct, pAGDI was first methylated with Dam methylase and S -adenosylmethionine (New England BioLabs, Hertfordshire, United Kingdom) following the manufacturer's instructions. .. The whole pAGDI plasmid was amplified using divergent primers ( ) flanking the region of PaguB to be deleted.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: Construction of Lc. lactis expression plasmids Plasmid pGIR100 was constructed by cloning of a DNA fragment comprising the whole larABCDE operon from L. plantarum NCIMB8826, which was amplified by PCR with primers StrepBZ_A2 and StrepB_B2, digested with PciI and SacI, and then ligated in the pNZ8048 plasmid digested with NcoI and SacI. .. For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs).

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: The linear HBV DNA used in this study, as shown in Fig. B, was obtained from linearized pBS-HBV3 DNA by PCR amplification (20 cycles of 95°C for 30 s, 55°C for 1 min, and 68°C for 8 min), using Pfu DNA polymerase (Stratagene). .. The resulting DNA was methylated at 37°C for 1 h with Dam methylase (New England Biolabs), and then unmethylated DNA was eliminated by Mbo I treatment at 37°C for 1 h. The methylated linear HBV DNA was gel purified with a QIAquick gel extraction kit (Qiagen) and then used for transfection.

    Whole Genome Amplification:

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius
    Article Snippet: .. An aliquot (250 ng) of the whole genome amplification (WGA) sample was methylated for 1 h at 37°C by 0.002 Units of Dam methyltransferase in presence of 80 μM S-adenosylmethionine (New England BioLabs) in order to create the positive control for the detection of m6A methylations. .. Genomic DNA isolated from asynchronous S. acidocaldarius cells was cleaved independently with a specific REase in order to decipher the presence or the absence of m4C or m6A: BsuRI, BamHI, MboI, and DpnI (Thermo Scientific).

    DNA Ligation:

    Article Title: Cascading MutS and MutL sliding clamps control DNA diffusion to activate mismatch repair
    Article Snippet: The DNA ligation products were separated on a 0.5% low melting agarose (Promega) gel; the 17.3-kb band was excised and treated with β-agarase (New England Biolabs) followed by isopropanol precipitation. .. To methylate the mismatched DNA ( , ), 1 µg mismatched DNA was incubated with 80 µM S -adenosylmethionine and 8 U of Dam methyltransferase (New England Biolabs) at 37 °C for 2 h in an 100-µl reaction, followed by inactivation of the enzyme at 65 °C for 15 min. Control experiments demonstrate that the DNA becomes completely resistant to MboI, indicating full methylation.

    Clone Assay:

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: Construction of Lc. lactis expression plasmids Plasmid pGIR100 was constructed by cloning of a DNA fragment comprising the whole larABCDE operon from L. plantarum NCIMB8826, which was amplified by PCR with primers StrepBZ_A2 and StrepB_B2, digested with PciI and SacI, and then ligated in the pNZ8048 plasmid digested with NcoI and SacI. .. For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs).

    Construct:

    Article Title: AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration
    Article Snippet: .. For each construct, pAGDI was first methylated with Dam methylase and S -adenosylmethionine (New England BioLabs, Hertfordshire, United Kingdom) following the manufacturer's instructions. .. The whole pAGDI plasmid was amplified using divergent primers ( ) flanking the region of PaguB to be deleted.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: Construction of Lc. lactis expression plasmids Plasmid pGIR100 was constructed by cloning of a DNA fragment comprising the whole larABCDE operon from L. plantarum NCIMB8826, which was amplified by PCR with primers StrepBZ_A2 and StrepB_B2, digested with PciI and SacI, and then ligated in the pNZ8048 plasmid digested with NcoI and SacI. .. For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs).

    Electrophoresis:

    Article Title: Phase variation controls expression of Salmonella lipopolysaccharide modification genes by a DNA methylation-dependent mechanism
    Article Snippet: DNA was methylated in vitro using Dam methylase (NEB) and digested with MboI (NEB). .. Protein–DNA complexes were subjected to electrophoresis in 5% non-denaturing gels in high ionic strength buffer (50 mM Tris base, 380 mM glycine, 1.5 mM EDTA), and bands were visualized using FX Molecular imager (Biorad).

    Acrylamide Gel Assay:

    Article Title: An Epigenetic Switch Involving Overlapping Fur and DNA Methylation Optimizes Expression of a Type VI Secretion Gene Cluster
    Article Snippet: Briefly, purified radio-labelled PCR products were in vitro methylated by the Dam methylase (New England Biolabs) in methylation buffer (50 mM Tris-HCl pH 7.5, 5 mM dithiothreitol (DTT), 5% glycerol, 20 mM KCl, 1 mM MgCl2 , 100 µM MnCl2 , bovine serum albumine (BSA) 100 µg/ml, in presence of 80 µM of S-adenosylmethionine (SAM)), as recommended by the manufacturer at 37°C for 4 hours. .. Half of the mixture was loaded on an acrylamide gel to verify Fur binding by EMSA.

    Incubation:

    Article Title: Ultrasound-Mediated DNA Transformation in Thermophilic Gram-Positive Anaerobes
    Article Snippet: .. The mixture was incubated at 60°C for 16 h. As a control for methylation experiments, a commercial Dam methyltransferase was purchased from New England Biolabs. ..

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB). .. The reaction mixtures were incubated for 30 min at room temperature prior to loading onto prerun 6% native polyacrylamide gels.

    Article Title: Cascading MutS and MutL sliding clamps control DNA diffusion to activate mismatch repair
    Article Snippet: .. To methylate the mismatched DNA ( , ), 1 µg mismatched DNA was incubated with 80 µM S -adenosylmethionine and 8 U of Dam methyltransferase (New England Biolabs) at 37 °C for 2 h in an 100-µl reaction, followed by inactivation of the enzyme at 65 °C for 15 min. Control experiments demonstrate that the DNA becomes completely resistant to MboI, indicating full methylation. .. EcMutS and EcMutL expression constructs have been previously described .

    Article Title: An Epigenetic Switch Involving Overlapping Fur and DNA Methylation Optimizes Expression of a Type VI Secretion Gene Cluster
    Article Snippet: Briefly, purified radio-labelled PCR products were in vitro methylated by the Dam methylase (New England Biolabs) in methylation buffer (50 mM Tris-HCl pH 7.5, 5 mM dithiothreitol (DTT), 5% glycerol, 20 mM KCl, 1 mM MgCl2 , 100 µM MnCl2 , bovine serum albumine (BSA) 100 µg/ml, in presence of 80 µM of S-adenosylmethionine (SAM)), as recommended by the manufacturer at 37°C for 4 hours. .. For competition experiments, the PCR products were first incubated with purified the Fur protein in methylation buffer for 30 min at 37°C before addition of the Dam methylase.

    Expressing:

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: Paragraph title: Construction of Lc. lactis expression plasmids ... For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs).

    Modification:

    Article Title: Ultrasound-Mediated DNA Transformation in Thermophilic Gram-Positive Anaerobes
    Article Snippet: In vitro methylation of DNA The DNA modification assay was performed as described elsewhere by combining 53 µl TNE buffer (50 mM Tris pH 7.5, 50 mM NaCl, 10 mM EDTA), 10 µl SAM (0.8 mM), 1 µl BSA (10 mg/ml), 25 µl X514 cell extract and 3 µg plasmid DNA (pHL015) prepared from E. coli DH5α (Dam+ /Dcm+ ) or JM110 (Dam− /Dcm− ) in a final volume of 100 µl. .. The mixture was incubated at 60°C for 16 h. As a control for methylation experiments, a commercial Dam methyltransferase was purchased from New England Biolabs.

    Transformation Assay:

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: To isolate independent NCO events for sequence analyses, cells were transformed with a CEN plasmid containing the same gapped HIS3 substrate (pSR1015; [ ]). .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I.

    Article Title: AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration
    Article Snippet: For each construct, pAGDI was first methylated with Dam methylase and S -adenosylmethionine (New England BioLabs, Hertfordshire, United Kingdom) following the manufacturer's instructions. .. The ligation mixture was digested with DpnI (in order to digest the original pAGDI plasmid used as a Dam-methylated template) before transformation into L. lactis subsp. cremoris NZ9000.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: The resulting plasmid was transformed in Lc. lactis . .. For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs).

    Derivative Assay:

    Article Title: AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration
    Article Snippet: Plasmids pAGDIΔ1, pAGDIΔ2, pAGDIΔ3, and pAGDIΔ4, bearing versions of PaguB with different deletions, were all derived from previously constructed plasmid pAGDI ( ). .. For each construct, pAGDI was first methylated with Dam methylase and S -adenosylmethionine (New England BioLabs, Hertfordshire, United Kingdom) following the manufacturer's instructions.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: Plasmids bearing deleted versions of the larA-E operon for expression in Lc. lactis were all derived from pGIR100: pGIR200 (ΔlarA ), pGIR300 (ΔlarB ), pGIR500 (ΔlarC ), pGIR600 (ΔlarD ) and pGIR700 (ΔlarE ). .. For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs).

    Transfection:

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: .. The resulting DNA was methylated at 37°C for 1 h with Dam methylase (New England Biolabs), and then unmethylated DNA was eliminated by Mbo I treatment at 37°C for 1 h. The methylated linear HBV DNA was gel purified with a QIAquick gel extraction kit (Qiagen) and then used for transfection. .. DNA primers used for PCR amplification were as follows.

    Positive Control:

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius
    Article Snippet: .. An aliquot (250 ng) of the whole genome amplification (WGA) sample was methylated for 1 h at 37°C by 0.002 Units of Dam methyltransferase in presence of 80 μM S-adenosylmethionine (New England BioLabs) in order to create the positive control for the detection of m6A methylations. .. Genomic DNA isolated from asynchronous S. acidocaldarius cells was cleaved independently with a specific REase in order to decipher the presence or the absence of m4C or m6A: BsuRI, BamHI, MboI, and DpnI (Thermo Scientific).

    Ligation:

    Article Title: AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration
    Article Snippet: For each construct, pAGDI was first methylated with Dam methylase and S -adenosylmethionine (New England BioLabs, Hertfordshire, United Kingdom) following the manufacturer's instructions. .. The ligation mixture was digested with DpnI (in order to digest the original pAGDI plasmid used as a Dam-methylated template) before transformation into L. lactis subsp. cremoris NZ9000.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs). .. The ligation mixture was digested with DpnI before transformation in Lc. lactis in order to digest the original pGIR100 plasmid used as template.

    Generated:

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I. .. Gap-repair efficiency was measured as previously described using a mix of Bss HII-digested pSR987 [ ] and a circular LEU2 -containing plasmid (pRS315; [ ]) in a 10:1 weight ratio.

    Sequencing:

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: To isolate independent NCO events for sequence analyses, cells were transformed with a CEN plasmid containing the same gapped HIS3 substrate (pSR1015; [ ]). .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs). .. The plasmid sequences were confirmed by sequencing with primers UP_PNZ8048′ and 632SEQA4 to 632SEQA14.

    Binding Assay:

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB). .. The binding reaction was done in a 20-μl mixture that contained probe (2 nM), Fur protein (as indicated below), 10 mM Tris-borate buffer, 40 mM KCl, 1 mM MgCl2 , 100 μM MnCl2 , 2 mM dithiothreitol (DTT), 100 μg/ml bovine serum albumin (BSA), 5 μg sheared calf thymus DNA, and 10% glycerol.

    Article Title: Phase variation controls expression of Salmonella lipopolysaccharide modification genes by a DNA methylation-dependent mechanism
    Article Snippet: DNA was methylated in vitro using Dam methylase (NEB) and digested with MboI (NEB). .. OxyR binding reactions were carried out at 30°C for 30 min using 200 fmol FAM-labelled probe as described ( ).

    Article Title: An Epigenetic Switch Involving Overlapping Fur and DNA Methylation Optimizes Expression of a Type VI Secretion Gene Cluster
    Article Snippet: Briefly, purified radio-labelled PCR products were in vitro methylated by the Dam methylase (New England Biolabs) in methylation buffer (50 mM Tris-HCl pH 7.5, 5 mM dithiothreitol (DTT), 5% glycerol, 20 mM KCl, 1 mM MgCl2 , 100 µM MnCl2 , bovine serum albumine (BSA) 100 µg/ml, in presence of 80 µM of S-adenosylmethionine (SAM)), as recommended by the manufacturer at 37°C for 4 hours. .. Half of the mixture was loaded on an acrylamide gel to verify Fur binding by EMSA.

    DNA Extraction:

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius
    Article Snippet: Paragraph title: DNA extraction, whole genome amplification (WGA), and methylated DNA production ... An aliquot (250 ng) of the whole genome amplification (WGA) sample was methylated for 1 h at 37°C by 0.002 Units of Dam methyltransferase in presence of 80 μM S-adenosylmethionine (New England BioLabs) in order to create the positive control for the detection of m6A methylations.

    In Vivo:

    Article Title: Atomic Force Microscopy Captures the Initiation of Methyl-Directed DNA Mismatch Repair
    Article Snippet: .. During replication, there is a limited window of time during which to correct these errors as d(GATC) sites become occupied by SeqA foci or are fully-methylated by Dam methyltransferase ( ) and as nicks at the boundaries of Okazaki fragments (suggested to also be a strand discrimination signal in vivo ( )) are sealed by ligases. .. Furthermore, in vivo , endogenous errors in replication which can result in a mutation without repair occur extremely infrequently (2.75 × 10−8 per nucleotide per generation ( )), which is a significant difference from most in vitro studies in which all DNA molecules possess a mismatch.

    Methylation:

    Article Title: Ultrasound-Mediated DNA Transformation in Thermophilic Gram-Positive Anaerobes
    Article Snippet: .. The mixture was incubated at 60°C for 16 h. As a control for methylation experiments, a commercial Dam methyltransferase was purchased from New England Biolabs. ..

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius
    Article Snippet: .. An aliquot (250 ng) of the whole genome amplification (WGA) sample was methylated for 1 h at 37°C by 0.002 Units of Dam methyltransferase in presence of 80 μM S-adenosylmethionine (New England BioLabs) in order to create the positive control for the detection of m6A methylations. .. Genomic DNA isolated from asynchronous S. acidocaldarius cells was cleaved independently with a specific REase in order to decipher the presence or the absence of m4C or m6A: BsuRI, BamHI, MboI, and DpnI (Thermo Scientific).

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: .. Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB). .. After methylation, reaction mixtures were run through a Performa spin column to remove excess S -adenosylmethionine and to desalt the mixtures.

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I. .. Gap-repair efficiency was measured as previously described using a mix of Bss HII-digested pSR987 [ ] and a circular LEU2 -containing plasmid (pRS315; [ ]) in a 10:1 weight ratio.

    Article Title: Cascading MutS and MutL sliding clamps control DNA diffusion to activate mismatch repair
    Article Snippet: .. To methylate the mismatched DNA ( , ), 1 µg mismatched DNA was incubated with 80 µM S -adenosylmethionine and 8 U of Dam methyltransferase (New England Biolabs) at 37 °C for 2 h in an 100-µl reaction, followed by inactivation of the enzyme at 65 °C for 15 min. Control experiments demonstrate that the DNA becomes completely resistant to MboI, indicating full methylation. .. EcMutS and EcMutL expression constructs have been previously described .

    Article Title: OxyR-dependent formation of DNA methylation patterns in OpvABOFF and OpvABON cell lineages of Salmonella enterica
    Article Snippet: .. DNA methylation in vitro PCR fragments were methylated in vitro using Dam methylase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions and subsequently digested with MboI (New England Biolabs). .. The undigested product was purified using the Wizard® SV Clean-Up system (Promega, Madison, WI, USA).

    Article Title: Phase variation controls expression of Salmonella lipopolysaccharide modification genes by a DNA methylation-dependent mechanism
    Article Snippet: .. DNA was methylated in vitro using Dam methylase (NEB) and digested with MboI (NEB). ..

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: .. All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. The PCR thermocycling conditions were conducted as described previously [ ].

    Article Title: AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration
    Article Snippet: .. For each construct, pAGDI was first methylated with Dam methylase and S -adenosylmethionine (New England BioLabs, Hertfordshire, United Kingdom) following the manufacturer's instructions. .. The whole pAGDI plasmid was amplified using divergent primers ( ) flanking the region of PaguB to be deleted.

    Article Title: An Epigenetic Switch Involving Overlapping Fur and DNA Methylation Optimizes Expression of a Type VI Secretion Gene Cluster
    Article Snippet: .. Briefly, purified radio-labelled PCR products were in vitro methylated by the Dam methylase (New England Biolabs) in methylation buffer (50 mM Tris-HCl pH 7.5, 5 mM dithiothreitol (DTT), 5% glycerol, 20 mM KCl, 1 mM MgCl2 , 100 µM MnCl2 , bovine serum albumine (BSA) 100 µg/ml, in presence of 80 µM of S-adenosylmethionine (SAM)), as recommended by the manufacturer at 37°C for 4 hours. .. For competition experiments, the PCR products were first incubated with purified the Fur protein in methylation buffer for 30 min at 37°C before addition of the Dam methylase.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: .. For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs). .. PCR amplification was performed in order to obtain a fragment comprising the whole pGIR100 plasmid, deleted of the gene of interest, using primers LarZ-X_A and LarZ-X_B (X stands for the gene to be deleted), digested with ClaI and self-ligated, generating an in-frame deletion of the selected gene.

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: .. The resulting DNA was methylated at 37°C for 1 h with Dam methylase (New England Biolabs), and then unmethylated DNA was eliminated by Mbo I treatment at 37°C for 1 h. The methylated linear HBV DNA was gel purified with a QIAquick gel extraction kit (Qiagen) and then used for transfection. .. DNA primers used for PCR amplification were as follows.

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. To confirm the role of methylation in mismatch removal, the un-Me plasmid DNA was methylated in vitro using purified Dam methyltransferase. .. Use of Dam-methylated (Dam-Me) DNA reduced the overall transformation efficiency 2-fold, down to a level indistinguishable from that observed with the fully-Me plasmid ( ; p=0.60).

    Mutagenesis:

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: Paragraph title: QuikChange mutagenesis in L. lactis ... All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs).

    Isolation:

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: Plasmids isolated from the dam+ dcm+ strain DH5α [F− Φ80 lac ZΔM15 Δ( lac ZYA- arg F) U169 rec A1 end A1 hsd R17 pho A sup E 44 thi -1 gyr A96 rel A1] were designated as fully methylated, while those isolated from a dam- dcm strain [ ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210∷Tn10) TetS endA1 rspL136 (StrR ) dam13∷Tn9 (CamR ) xylA-5 mtl-1 thi-1 mcrB1 hsdR2; New England Biolabs] were considered to be un-methylated. .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I.

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: .. All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. The PCR thermocycling conditions were conducted as described previously [ ].

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. Plasmid DNA isolated from E. coli strains containing the Dam methyltransferase is standardly used in such gap-repair assays. .. The analyses presented here demonstrate that the subtle modification to DNA structure conferred by 6meA can lower the overall gap-repair efficiency and is sufficient to trigger the sporadic removal of mismatches present in recombination intermediates, resulting in conversion of continuous to discontinuous hetDNA.

    Size-exclusion Chromatography:

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. Separate 50 μl KOD hotstart high fidelity polymerase PCR reactions were preformed with each primer for 10 cycles and an extension time of 5 min 30 sec. After 10 cycles the reactions were combined and continued for an additional 18 cycles.

    Electrophoretic Mobility Shift Assay:

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: Paragraph title: Purification of Fur and electrophoretic mobility shift assays (EMSAs). ... Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB).

    Purification:

    Article Title: Ultrasound-Mediated DNA Transformation in Thermophilic Gram-Positive Anaerobes
    Article Snippet: The mixture was incubated at 60°C for 16 h. As a control for methylation experiments, a commercial Dam methyltransferase was purchased from New England Biolabs. .. Methylated DNA fragments were purified by the QIAquick PCR purification kit (Qiagen).

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: Paragraph title: Purification of Fur and electrophoretic mobility shift assays (EMSAs). ... Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB).

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I. .. Gap-repair efficiency was measured as previously described using a mix of Bss HII-digested pSR987 [ ] and a circular LEU2 -containing plasmid (pRS315; [ ]) in a 10:1 weight ratio.

    Article Title: Cascading MutS and MutL sliding clamps control DNA diffusion to activate mismatch repair
    Article Snippet: The purified DNA was resuspended in TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) and stored at −20 °C until use. .. To methylate the mismatched DNA ( , ), 1 µg mismatched DNA was incubated with 80 µM S -adenosylmethionine and 8 U of Dam methyltransferase (New England Biolabs) at 37 °C for 2 h in an 100-µl reaction, followed by inactivation of the enzyme at 65 °C for 15 min. Control experiments demonstrate that the DNA becomes completely resistant to MboI, indicating full methylation.

    Article Title: OxyR-dependent formation of DNA methylation patterns in OpvABOFF and OpvABON cell lineages of Salmonella enterica
    Article Snippet: DNA methylation in vitro PCR fragments were methylated in vitro using Dam methylase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions and subsequently digested with MboI (New England Biolabs). .. The undigested product was purified using the Wizard® SV Clean-Up system (Promega, Madison, WI, USA).

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. Amplimers were column purified (Qiaquick PCR purification kit, Qiagen) and digested overnight with Dpn I (Roche).

    Article Title: An Epigenetic Switch Involving Overlapping Fur and DNA Methylation Optimizes Expression of a Type VI Secretion Gene Cluster
    Article Snippet: .. Briefly, purified radio-labelled PCR products were in vitro methylated by the Dam methylase (New England Biolabs) in methylation buffer (50 mM Tris-HCl pH 7.5, 5 mM dithiothreitol (DTT), 5% glycerol, 20 mM KCl, 1 mM MgCl2 , 100 µM MnCl2 , bovine serum albumine (BSA) 100 µg/ml, in presence of 80 µM of S-adenosylmethionine (SAM)), as recommended by the manufacturer at 37°C for 4 hours. .. For competition experiments, the PCR products were first incubated with purified the Fur protein in methylation buffer for 30 min at 37°C before addition of the Dam methylase.

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: .. The resulting DNA was methylated at 37°C for 1 h with Dam methylase (New England Biolabs), and then unmethylated DNA was eliminated by Mbo I treatment at 37°C for 1 h. The methylated linear HBV DNA was gel purified with a QIAquick gel extraction kit (Qiagen) and then used for transfection. .. DNA primers used for PCR amplification were as follows.

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. To confirm the role of methylation in mismatch removal, the un-Me plasmid DNA was methylated in vitro using purified Dam methyltransferase. .. Use of Dam-methylated (Dam-Me) DNA reduced the overall transformation efficiency 2-fold, down to a level indistinguishable from that observed with the fully-Me plasmid ( ; p=0.60).

    Polymerase Chain Reaction:

    Article Title: Ultrasound-Mediated DNA Transformation in Thermophilic Gram-Positive Anaerobes
    Article Snippet: The mixture was incubated at 60°C for 16 h. As a control for methylation experiments, a commercial Dam methyltransferase was purchased from New England Biolabs. .. Methylated DNA fragments were purified by the QIAquick PCR purification kit (Qiagen).

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: For the probe of PVCA0063 , oligonucleotides end labeled with Cy5 were ordered (IDT) and were annealed in vitro , while for PSodA and PAphA , Cy5 was incorporated into probes during PCR using Cy5-labeled dCTP (GE Healthcare). .. Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB).

    Article Title: OxyR-dependent formation of DNA methylation patterns in OpvABOFF and OpvABON cell lineages of Salmonella enterica
    Article Snippet: .. DNA methylation in vitro PCR fragments were methylated in vitro using Dam methylase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions and subsequently digested with MboI (New England Biolabs). .. The undigested product was purified using the Wizard® SV Clean-Up system (Promega, Madison, WI, USA).

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. The PCR thermocycling conditions were conducted as described previously [ ].

    Article Title: An Epigenetic Switch Involving Overlapping Fur and DNA Methylation Optimizes Expression of a Type VI Secretion Gene Cluster
    Article Snippet: .. Briefly, purified radio-labelled PCR products were in vitro methylated by the Dam methylase (New England Biolabs) in methylation buffer (50 mM Tris-HCl pH 7.5, 5 mM dithiothreitol (DTT), 5% glycerol, 20 mM KCl, 1 mM MgCl2 , 100 µM MnCl2 , bovine serum albumine (BSA) 100 µg/ml, in presence of 80 µM of S-adenosylmethionine (SAM)), as recommended by the manufacturer at 37°C for 4 hours. .. For competition experiments, the PCR products were first incubated with purified the Fur protein in methylation buffer for 30 min at 37°C before addition of the Dam methylase.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: Construction of Lc. lactis expression plasmids Plasmid pGIR100 was constructed by cloning of a DNA fragment comprising the whole larABCDE operon from L. plantarum NCIMB8826, which was amplified by PCR with primers StrepBZ_A2 and StrepB_B2, digested with PciI and SacI, and then ligated in the pNZ8048 plasmid digested with NcoI and SacI. .. For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs).

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: The linear HBV DNA used in this study, as shown in Fig. B, was obtained from linearized pBS-HBV3 DNA by PCR amplification (20 cycles of 95°C for 30 s, 55°C for 1 min, and 68°C for 8 min), using Pfu DNA polymerase (Stratagene). .. The resulting DNA was methylated at 37°C for 1 h with Dam methylase (New England Biolabs), and then unmethylated DNA was eliminated by Mbo I treatment at 37°C for 1 h. The methylated linear HBV DNA was gel purified with a QIAquick gel extraction kit (Qiagen) and then used for transfection.

    Labeling:

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: For the latter, we specifically determined the titer of the ratio of unlabeled dCTP to Cy5-labeled dCTP added to PCRs to result in the incorporation of only 1 or 2 labeled C residues, as we found this to be sufficient to result in a robustly labeled EMSA probe. .. Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB).

    Plasmid Preparation:

    Article Title: Ultrasound-Mediated DNA Transformation in Thermophilic Gram-Positive Anaerobes
    Article Snippet: In vitro methylation of DNA The DNA modification assay was performed as described elsewhere by combining 53 µl TNE buffer (50 mM Tris pH 7.5, 50 mM NaCl, 10 mM EDTA), 10 µl SAM (0.8 mM), 1 µl BSA (10 mg/ml), 25 µl X514 cell extract and 3 µg plasmid DNA (pHL015) prepared from E. coli DH5α (Dam+ /Dcm+ ) or JM110 (Dam− /Dcm− ) in a final volume of 100 µl. .. The mixture was incubated at 60°C for 16 h. As a control for methylation experiments, a commercial Dam methyltransferase was purchased from New England Biolabs.

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I. .. Gap-repair efficiency was measured as previously described using a mix of Bss HII-digested pSR987 [ ] and a circular LEU2 -containing plasmid (pRS315; [ ]) in a 10:1 weight ratio.

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: .. All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. The PCR thermocycling conditions were conducted as described previously [ ].

    Article Title: AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration
    Article Snippet: Plasmid pAGDI carries the cassette PaguR - aguR -PaguB fused to the gfp reporter gene. .. For each construct, pAGDI was first methylated with Dam methylase and S -adenosylmethionine (New England BioLabs, Hertfordshire, United Kingdom) following the manufacturer's instructions.

    Article Title: Lactate racemase is a nickel-dependent enzyme activated by a widespread maturation system
    Article Snippet: The resulting plasmid was transformed in Lc. lactis . .. For each construction, pGIR100 was first methylated with Dam methylase and S-adenosyl methionine (New England Biolabs).

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. Plasmid DNA isolated from E. coli strains containing the Dam methyltransferase is standardly used in such gap-repair assays. .. The analyses presented here demonstrate that the subtle modification to DNA structure conferred by 6meA can lower the overall gap-repair efficiency and is sufficient to trigger the sporadic removal of mismatches present in recombination intermediates, resulting in conversion of continuous to discontinuous hetDNA.

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. To confirm the role of methylation in mismatch removal, the un-Me plasmid DNA was methylated in vitro using purified Dam methyltransferase. .. Use of Dam-methylated (Dam-Me) DNA reduced the overall transformation efficiency 2-fold, down to a level indistinguishable from that observed with the fully-Me plasmid ( ; p=0.60).

    Negative Control:

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius
    Article Snippet: Genomic DNA extracted from asynchronous S. acidocaldarius cells (10 ng) was amplified during 17 h at 30°C using the Repli-g mini kit (Qiagen) and used as negative control for the search of all DNA modifications. .. An aliquot (250 ng) of the whole genome amplification (WGA) sample was methylated for 1 h at 37°C by 0.002 Units of Dam methyltransferase in presence of 80 μM S-adenosylmethionine (New England BioLabs) in order to create the positive control for the detection of m6A methylations.

    In Vitro:

    Article Title: Ultrasound-Mediated DNA Transformation in Thermophilic Gram-Positive Anaerobes
    Article Snippet: Paragraph title: In vitro methylation of DNA ... The mixture was incubated at 60°C for 16 h. As a control for methylation experiments, a commercial Dam methyltransferase was purchased from New England Biolabs.

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: .. Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB). .. After methylation, reaction mixtures were run through a Performa spin column to remove excess S -adenosylmethionine and to desalt the mixtures.

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. An in vitro methylated version of the un-methylated plasmid was generated using purified Dam methyltransferase (New England Biolabs) and methylation was confirmed by insensitivity to digestion with Mbo I. .. Gap-repair efficiency was measured as previously described using a mix of Bss HII-digested pSR987 [ ] and a circular LEU2 -containing plasmid (pRS315; [ ]) in a 10:1 weight ratio.

    Article Title: OxyR-dependent formation of DNA methylation patterns in OpvABOFF and OpvABON cell lineages of Salmonella enterica
    Article Snippet: .. DNA methylation in vitro PCR fragments were methylated in vitro using Dam methylase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions and subsequently digested with MboI (New England Biolabs). .. The undigested product was purified using the Wizard® SV Clean-Up system (Promega, Madison, WI, USA).

    Article Title: Phase variation controls expression of Salmonella lipopolysaccharide modification genes by a DNA methylation-dependent mechanism
    Article Snippet: .. DNA was methylated in vitro using Dam methylase (NEB) and digested with MboI (NEB). ..

    Article Title: An Epigenetic Switch Involving Overlapping Fur and DNA Methylation Optimizes Expression of a Type VI Secretion Gene Cluster
    Article Snippet: .. Briefly, purified radio-labelled PCR products were in vitro methylated by the Dam methylase (New England Biolabs) in methylation buffer (50 mM Tris-HCl pH 7.5, 5 mM dithiothreitol (DTT), 5% glycerol, 20 mM KCl, 1 mM MgCl2 , 100 µM MnCl2 , bovine serum albumine (BSA) 100 µg/ml, in presence of 80 µM of S-adenosylmethionine (SAM)), as recommended by the manufacturer at 37°C for 4 hours. .. For competition experiments, the PCR products were first incubated with purified the Fur protein in methylation buffer for 30 min at 37°C before addition of the Dam methylase.

    Article Title: Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates
    Article Snippet: .. To confirm the role of methylation in mismatch removal, the un-Me plasmid DNA was methylated in vitro using purified Dam methyltransferase. .. Use of Dam-methylated (Dam-Me) DNA reduced the overall transformation efficiency 2-fold, down to a level indistinguishable from that observed with the fully-Me plasmid ( ; p=0.60).

    DNA Methylation Assay:

    Article Title: OxyR-dependent formation of DNA methylation patterns in OpvABOFF and OpvABON cell lineages of Salmonella enterica
    Article Snippet: .. DNA methylation in vitro PCR fragments were methylated in vitro using Dam methylase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions and subsequently digested with MboI (New England Biolabs). .. The undigested product was purified using the Wizard® SV Clean-Up system (Promega, Madison, WI, USA).

    Concentration Assay:

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius
    Article Snippet: Dried pellets were resuspended in 0.22 μm filtered milliQ-water, the corresponding concentration and purity were measured using Nanodrop and then stored at −20°C. .. An aliquot (250 ng) of the whole genome amplification (WGA) sample was methylated for 1 h at 37°C by 0.002 Units of Dam methyltransferase in presence of 80 μM S-adenosylmethionine (New England BioLabs) in order to create the positive control for the detection of m6A methylations.

    Gel Extraction:

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: .. The resulting DNA was methylated at 37°C for 1 h with Dam methylase (New England Biolabs), and then unmethylated DNA was eliminated by Mbo I treatment at 37°C for 1 h. The methylated linear HBV DNA was gel purified with a QIAquick gel extraction kit (Qiagen) and then used for transfection. .. DNA primers used for PCR amplification were as follows.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs dam methyltransferase
    TAMT-1 is a <t>methyltransferase</t> for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate
    Dam Methyltransferase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dam methyltransferase/product/New England Biolabs
    Average 95 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    dam methyltransferase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Journal: Genome Biology

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    doi: 10.1186/s13059-018-1573-3

    Figure Lengend Snippet: TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Article Snippet: The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Techniques: Methylation, Mass Spectrometry, Knock-Out, In Vitro, Activity Assay, Sequencing, Mutagenesis

    Nucleosome profile and transcriptome change in 6mA defective Tetrahymena . a Fuzziness of genome-wide nucleosome profile in wild-type (WT1, WT2) and methyltransferase knockout (NP61, NP62, NP71, NP72) cells. Fuzziness is defined as the deviation of nucleosome positions within each unit and is calculated by software DANPOS [ 32 ]. Two biological replicates for KO cells were constructed. NP61 and NP62 are two technical replicates for one cell strain, and NP71 and NP72 are two technical replicates for another cell strain. The smaller score represents better well-phased nucleosomes. b Clustering analysis of transcriptome for WT (WT61/WT62 and WT71/WT72 are two wild-type strains; each strain contains two technical replicates) and KO (NP61/NP62 and NP71/NP72 are two KO strains; each strain contains two technical replicates) cells. WT and KO cells are distinctly separated with a large difference. c Scheme for the model that 6mA stabilizes gene expression. In WT, 6mA is positioned to constrain nucleosome positioning which regulates gene expression. In KO, the level of 6mA significantly reduced. Nucleosomes lacking of 6mA constraints tend to be fuzzier which leads to larger transcriptional fluctuation

    Journal: Genome Biology

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    doi: 10.1186/s13059-018-1573-3

    Figure Lengend Snippet: Nucleosome profile and transcriptome change in 6mA defective Tetrahymena . a Fuzziness of genome-wide nucleosome profile in wild-type (WT1, WT2) and methyltransferase knockout (NP61, NP62, NP71, NP72) cells. Fuzziness is defined as the deviation of nucleosome positions within each unit and is calculated by software DANPOS [ 32 ]. Two biological replicates for KO cells were constructed. NP61 and NP62 are two technical replicates for one cell strain, and NP71 and NP72 are two technical replicates for another cell strain. The smaller score represents better well-phased nucleosomes. b Clustering analysis of transcriptome for WT (WT61/WT62 and WT71/WT72 are two wild-type strains; each strain contains two technical replicates) and KO (NP61/NP62 and NP71/NP72 are two KO strains; each strain contains two technical replicates) cells. WT and KO cells are distinctly separated with a large difference. c Scheme for the model that 6mA stabilizes gene expression. In WT, 6mA is positioned to constrain nucleosome positioning which regulates gene expression. In KO, the level of 6mA significantly reduced. Nucleosomes lacking of 6mA constraints tend to be fuzzier which leads to larger transcriptional fluctuation

    Article Snippet: The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Techniques: Genome Wide, Knock-Out, Software, Construct, Expressing

    Promoter specific expression of DAM methyltransferase in transgenic animals . (a-d) PD5122 animals expressing DAM-GFP fusion driven by the myo-3 (body wall muscle) promoter. (a = L4,10X; b = adult,10X; c = adult,10X; d = adult,100X). (e-f) PD3995 animals expressing a DAM-GFP fusion construct driven by the rol-6 (hypodermal) promoter. (e = 200X; f = 400X). (g-h) PD3997 animals expressing a DAM-GFP construct driven by the vit-2 (gut) promoter. (g = 200X; h = 200X)

    Journal: BMC Genomics

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans

    doi: 10.1186/1471-2164-11-465

    Figure Lengend Snippet: Promoter specific expression of DAM methyltransferase in transgenic animals . (a-d) PD5122 animals expressing DAM-GFP fusion driven by the myo-3 (body wall muscle) promoter. (a = L4,10X; b = adult,10X; c = adult,10X; d = adult,100X). (e-f) PD3995 animals expressing a DAM-GFP fusion construct driven by the rol-6 (hypodermal) promoter. (e = 200X; f = 400X). (g-h) PD3997 animals expressing a DAM-GFP construct driven by the vit-2 (gut) promoter. (g = 200X; h = 200X)

    Article Snippet: in vitro methylation of N2 genomic DNA N2 genomic DNA was methylated using the following 200 μl reaction mixture: 30.0 μl (≈20-30 μg) N2 genomic DNA, 0.5 μl 32 mM S-adenosyl methionine, 1.0 μl E. coli DAM (8 U/μl, NEB M0222S), 20.0 μl 10× DAM buffer, 148.5 μl dH2 O.

    Techniques: Expressing, Transgenic Assay, Construct

    TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Journal: Genome Biology

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    doi: 10.1186/s13059-018-1573-3

    Figure Lengend Snippet: TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Article Snippet: The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Techniques: Methylation, Mass Spectrometry, Knock-Out, In Vitro, Activity Assay, Sequencing, Mutagenesis