dam methyltransferase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    dam Methyltransferase
    Description:
    dam Methyltransferase 2 500 units
    Catalog Number:
    m0222l
    Price:
    314
    Size:
    2 500 units
    Category:
    DNA Methylases
    Buy from Supplier


    Structured Review

    New England Biolabs dam methyltransferase
    dam Methyltransferase
    dam Methyltransferase 2 500 units
    https://www.bioz.com/result/dam methyltransferase/product/New England Biolabs
    Average 96 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    dam methyltransferase - by Bioz Stars, 2020-08
    96/100 stars

    Images

    1) Product Images from "N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA"

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    Journal: Genome Biology

    doi: 10.1186/s13059-018-1573-3

    TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate
    Figure Legend Snippet: TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Techniques Used: Methylation, Tandem Mass Spectroscopy, Knock-Out, In Vitro, Activity Assay, Sequencing, Mutagenesis

    2) Product Images from "N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA"

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    Journal: Genome Biology

    doi: 10.1186/s13059-018-1573-3

    TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate
    Figure Legend Snippet: TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Techniques Used: Methylation, Mass Spectrometry, Knock-Out, In Vitro, Activity Assay, Sequencing, Mutagenesis

    Nucleosome profile and transcriptome change in 6mA defective Tetrahymena . a Fuzziness of genome-wide nucleosome profile in wild-type (WT1, WT2) and methyltransferase knockout (NP61, NP62, NP71, NP72) cells. Fuzziness is defined as the deviation of nucleosome positions within each unit and is calculated by software DANPOS [ 32 ]. Two biological replicates for KO cells were constructed. NP61 and NP62 are two technical replicates for one cell strain, and NP71 and NP72 are two technical replicates for another cell strain. The smaller score represents better well-phased nucleosomes. b Clustering analysis of transcriptome for WT (WT61/WT62 and WT71/WT72 are two wild-type strains; each strain contains two technical replicates) and KO (NP61/NP62 and NP71/NP72 are two KO strains; each strain contains two technical replicates) cells. WT and KO cells are distinctly separated with a large difference. c Scheme for the model that 6mA stabilizes gene expression. In WT, 6mA is positioned to constrain nucleosome positioning which regulates gene expression. In KO, the level of 6mA significantly reduced. Nucleosomes lacking of 6mA constraints tend to be fuzzier which leads to larger transcriptional fluctuation
    Figure Legend Snippet: Nucleosome profile and transcriptome change in 6mA defective Tetrahymena . a Fuzziness of genome-wide nucleosome profile in wild-type (WT1, WT2) and methyltransferase knockout (NP61, NP62, NP71, NP72) cells. Fuzziness is defined as the deviation of nucleosome positions within each unit and is calculated by software DANPOS [ 32 ]. Two biological replicates for KO cells were constructed. NP61 and NP62 are two technical replicates for one cell strain, and NP71 and NP72 are two technical replicates for another cell strain. The smaller score represents better well-phased nucleosomes. b Clustering analysis of transcriptome for WT (WT61/WT62 and WT71/WT72 are two wild-type strains; each strain contains two technical replicates) and KO (NP61/NP62 and NP71/NP72 are two KO strains; each strain contains two technical replicates) cells. WT and KO cells are distinctly separated with a large difference. c Scheme for the model that 6mA stabilizes gene expression. In WT, 6mA is positioned to constrain nucleosome positioning which regulates gene expression. In KO, the level of 6mA significantly reduced. Nucleosomes lacking of 6mA constraints tend to be fuzzier which leads to larger transcriptional fluctuation

    Techniques Used: Genome Wide, Knock-Out, Software, Construct, Expressing

    3) Product Images from "Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans"

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-465

    Promoter specific expression of DAM methyltransferase in transgenic animals . (a-d) PD5122 animals expressing DAM-GFP fusion driven by the myo-3 (body wall muscle) promoter. (a = L4,10X; b = adult,10X; c = adult,10X; d = adult,100X). (e-f) PD3995 animals expressing a DAM-GFP fusion construct driven by the rol-6 (hypodermal) promoter. (e = 200X; f = 400X). (g-h) PD3997 animals expressing a DAM-GFP construct driven by the vit-2 (gut) promoter. (g = 200X; h = 200X)
    Figure Legend Snippet: Promoter specific expression of DAM methyltransferase in transgenic animals . (a-d) PD5122 animals expressing DAM-GFP fusion driven by the myo-3 (body wall muscle) promoter. (a = L4,10X; b = adult,10X; c = adult,10X; d = adult,100X). (e-f) PD3995 animals expressing a DAM-GFP fusion construct driven by the rol-6 (hypodermal) promoter. (e = 200X; f = 400X). (g-h) PD3997 animals expressing a DAM-GFP construct driven by the vit-2 (gut) promoter. (g = 200X; h = 200X)

    Techniques Used: Expressing, Transgenic Assay, Construct

    4) Product Images from "N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA"

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    Journal: Genome Biology

    doi: 10.1186/s13059-018-1573-3

    TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate
    Figure Legend Snippet: TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Techniques Used: Methylation, Mass Spectrometry, Knock-Out, In Vitro, Activity Assay, Sequencing, Mutagenesis

    5) Product Images from "N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA"

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    Journal: Genome Biology

    doi: 10.1186/s13059-018-1573-3

    TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate
    Figure Legend Snippet: TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Techniques Used: Methylation, Tandem Mass Spectroscopy, Knock-Out, In Vitro, Activity Assay, Sequencing, Mutagenesis

    Nucleosome profile and transcriptome change in 6mA defective Tetrahymena . a Fuzziness of genome-wide nucleosome profile in wild-type (WT1, WT2) and methyltransferase knockout (NP61, NP62, NP71, NP72) cells. Fuzziness is defined as the deviation of nucleosome positions within each unit and is calculated by software DANPOS [ 32 ]. Two biological replicates for KO cells were constructed. NP61 and NP62 are two technical replicates for one cell strain, and NP71 and NP72 are two technical replicates for another cell strain. The smaller score represents better well-phased nucleosomes. b Clustering analysis of transcriptome for WT (WT61/WT62 and WT71/WT72 are two wild-type strains; each strain contains two technical replicates) and KO (NP61/NP62 and NP71/NP72 are two KO strains; each strain contains two technical replicates) cells. WT and KO cells are distinctly separated with a large difference. c Scheme for the model that 6mA stabilizes gene expression. In WT, 6mA is positioned to constrain nucleosome positioning which regulates gene expression. In KO, the level of 6mA significantly reduced. Nucleosomes lacking of 6mA constraints tend to be fuzzier which leads to larger transcriptional fluctuation
    Figure Legend Snippet: Nucleosome profile and transcriptome change in 6mA defective Tetrahymena . a Fuzziness of genome-wide nucleosome profile in wild-type (WT1, WT2) and methyltransferase knockout (NP61, NP62, NP71, NP72) cells. Fuzziness is defined as the deviation of nucleosome positions within each unit and is calculated by software DANPOS [ 32 ]. Two biological replicates for KO cells were constructed. NP61 and NP62 are two technical replicates for one cell strain, and NP71 and NP72 are two technical replicates for another cell strain. The smaller score represents better well-phased nucleosomes. b Clustering analysis of transcriptome for WT (WT61/WT62 and WT71/WT72 are two wild-type strains; each strain contains two technical replicates) and KO (NP61/NP62 and NP71/NP72 are two KO strains; each strain contains two technical replicates) cells. WT and KO cells are distinctly separated with a large difference. c Scheme for the model that 6mA stabilizes gene expression. In WT, 6mA is positioned to constrain nucleosome positioning which regulates gene expression. In KO, the level of 6mA significantly reduced. Nucleosomes lacking of 6mA constraints tend to be fuzzier which leads to larger transcriptional fluctuation

    Techniques Used: Genome Wide, Knock-Out, Software, Construct, Expressing

    Related Articles

    In Vitro:

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: .. Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB). .. After methylation, reaction mixtures were run through a Performa spin column to remove excess S -adenosylmethionine and to desalt the mixtures.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. .. DNA library was constructed by NEBNext® DNA Library Prep Kit (NEB, Cat. No. E6040S) according to the standard Illumina DNA library preparation procedures.

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans
    Article Snippet: .. in vitro methylation of N2 genomic DNA N2 genomic DNA was methylated using the following 200 μl reaction mixture: 30.0 μl (≈20-30 μg) N2 genomic DNA, 0.5 μl 32 mM S-adenosyl methionine, 1.0 μl E. coli DAM (8 U/μl, NEB M0222S), 20.0 μl 10× DAM buffer, 148.5 μl dH2 O. .. Following one hour incubation at 37°C, the reaction was terminated with 1× STOP buffer.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. ..

    Methylation:

    Article Title: Characterization of Undermethylated Sites in Vibrio cholerae
    Article Snippet: .. Where indicated, EMSA probes were in vitro methylated with Dam methylase according to the manufacturer's instruction (NEB). .. After methylation, reaction mixtures were run through a Performa spin column to remove excess S -adenosylmethionine and to desalt the mixtures.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. .. DNA library was constructed by NEBNext® DNA Library Prep Kit (NEB, Cat. No. E6040S) according to the standard Illumina DNA library preparation procedures.

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans
    Article Snippet: .. in vitro methylation of N2 genomic DNA N2 genomic DNA was methylated using the following 200 μl reaction mixture: 30.0 μl (≈20-30 μg) N2 genomic DNA, 0.5 μl 32 mM S-adenosyl methionine, 1.0 μl E. coli DAM (8 U/μl, NEB M0222S), 20.0 μl 10× DAM buffer, 148.5 μl dH2 O. .. Following one hour incubation at 37°C, the reaction was terminated with 1× STOP buffer.

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: .. All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. The PCR thermocycling conditions were conducted as described previously [ ].

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. ..

    Isolation:

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: .. All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. The PCR thermocycling conditions were conducted as described previously [ ].

    Purification:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. .. DNA library was constructed by NEBNext® DNA Library Prep Kit (NEB, Cat. No. E6040S) according to the standard Illumina DNA library preparation procedures.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. ..

    Concentration Assay:

    Article Title: Cell cycle dynamics of lamina associated DNA
    Article Snippet: .. A concentration range (0.125, 0.5, 2 µL) of pA-Dam protein was incubated with 500 ng of unmethylated plasmid in 20 µL of 1x dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 µM S-adenosylmethionine (SAM) for 30 minutes at 37°C. .. As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S).

    Incubation:

    Article Title: Cell cycle dynamics of lamina associated DNA
    Article Snippet: .. A concentration range (0.125, 0.5, 2 µL) of pA-Dam protein was incubated with 500 ng of unmethylated plasmid in 20 µL of 1x dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 µM S-adenosylmethionine (SAM) for 30 minutes at 37°C. .. As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S).

    Sequencing:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. .. DNA library was constructed by NEBNext® DNA Library Prep Kit (NEB, Cat. No. E6040S) according to the standard Illumina DNA library preparation procedures.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. ..

    Recombinant:

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. .. DNA library was constructed by NEBNext® DNA Library Prep Kit (NEB, Cat. No. E6040S) according to the standard Illumina DNA library preparation procedures.

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA
    Article Snippet: .. The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer. ..

    Plasmid Preparation:

    Article Title: Cell cycle dynamics of lamina associated DNA
    Article Snippet: .. A concentration range (0.125, 0.5, 2 µL) of pA-Dam protein was incubated with 500 ng of unmethylated plasmid in 20 µL of 1x dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 µM S-adenosylmethionine (SAM) for 30 minutes at 37°C. .. As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S).

    Article Title: Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model
    Article Snippet: .. All plasmid template isolated from NZ9000 strains was methylated with Dam methylase following manufacturer recommendations (New England Biolabs). .. The PCR thermocycling conditions were conducted as described previously [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    New England Biolabs dam methyltransferase
    TAMT-1 is a <t>methyltransferase</t> for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate
    Dam Methyltransferase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dam methyltransferase/product/New England Biolabs
    Average 96 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    dam methyltransferase - by Bioz Stars, 2020-08
    96/100 stars
      Buy from Supplier

    Image Search Results


    TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Journal: Genome Biology

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    doi: 10.1186/s13059-018-1573-3

    Figure Lengend Snippet: TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Article Snippet: The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCC G ( A ) TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Techniques: Methylation, Tandem Mass Spectroscopy, Knock-Out, In Vitro, Activity Assay, Sequencing, Mutagenesis

    TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Journal: Genome Biology

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    doi: 10.1186/s13059-018-1573-3

    Figure Lengend Snippet: TAMT-1 is a methyltransferase for N 6 -deoxyadenosine methylation in Tetrahymena . a UHPLC-MS/MS quantification of 6mA level in wide-type and TAMT-1 knockout cells. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicates. b In vitro methyltransferase activity of TAMT-1 was tested using different DNA probes (numbered 1–3) with the consensus sequence of CATG, GATC, and random AT. The methylation yields were calculated by the molar ratio of d 3 -m6A to digested probes. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate. c Mutation of TAMT-1 strongly depleted the methylation activity as detected by UHPLC-MS/MS. Error bars indicate mean ± s.d. of three biological replicates, each measured in duplicate

    Article Snippet: The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Techniques: Methylation, Mass Spectrometry, Knock-Out, In Vitro, Activity Assay, Sequencing, Mutagenesis

    Nucleosome profile and transcriptome change in 6mA defective Tetrahymena . a Fuzziness of genome-wide nucleosome profile in wild-type (WT1, WT2) and methyltransferase knockout (NP61, NP62, NP71, NP72) cells. Fuzziness is defined as the deviation of nucleosome positions within each unit and is calculated by software DANPOS [ 32 ]. Two biological replicates for KO cells were constructed. NP61 and NP62 are two technical replicates for one cell strain, and NP71 and NP72 are two technical replicates for another cell strain. The smaller score represents better well-phased nucleosomes. b Clustering analysis of transcriptome for WT (WT61/WT62 and WT71/WT72 are two wild-type strains; each strain contains two technical replicates) and KO (NP61/NP62 and NP71/NP72 are two KO strains; each strain contains two technical replicates) cells. WT and KO cells are distinctly separated with a large difference. c Scheme for the model that 6mA stabilizes gene expression. In WT, 6mA is positioned to constrain nucleosome positioning which regulates gene expression. In KO, the level of 6mA significantly reduced. Nucleosomes lacking of 6mA constraints tend to be fuzzier which leads to larger transcriptional fluctuation

    Journal: Genome Biology

    Article Title: N6-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNA

    doi: 10.1186/s13059-018-1573-3

    Figure Lengend Snippet: Nucleosome profile and transcriptome change in 6mA defective Tetrahymena . a Fuzziness of genome-wide nucleosome profile in wild-type (WT1, WT2) and methyltransferase knockout (NP61, NP62, NP71, NP72) cells. Fuzziness is defined as the deviation of nucleosome positions within each unit and is calculated by software DANPOS [ 32 ]. Two biological replicates for KO cells were constructed. NP61 and NP62 are two technical replicates for one cell strain, and NP71 and NP72 are two technical replicates for another cell strain. The smaller score represents better well-phased nucleosomes. b Clustering analysis of transcriptome for WT (WT61/WT62 and WT71/WT72 are two wild-type strains; each strain contains two technical replicates) and KO (NP61/NP62 and NP71/NP72 are two KO strains; each strain contains two technical replicates) cells. WT and KO cells are distinctly separated with a large difference. c Scheme for the model that 6mA stabilizes gene expression. In WT, 6mA is positioned to constrain nucleosome positioning which regulates gene expression. In KO, the level of 6mA significantly reduced. Nucleosomes lacking of 6mA constraints tend to be fuzzier which leads to larger transcriptional fluctuation

    Article Snippet: The entire sequence has only one GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG (A )TC ACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In in vitro nucleosome assembly experiments, purified recombinant human histone H2A and H2B were mixed to generate dimer in advance, as well as histone H3.1/H4 tetramer.

    Techniques: Genome Wide, Knock-Out, Software, Construct, Expressing

    Promoter specific expression of DAM methyltransferase in transgenic animals . (a-d) PD5122 animals expressing DAM-GFP fusion driven by the myo-3 (body wall muscle) promoter. (a = L4,10X; b = adult,10X; c = adult,10X; d = adult,100X). (e-f) PD3995 animals expressing a DAM-GFP fusion construct driven by the rol-6 (hypodermal) promoter. (e = 200X; f = 400X). (g-h) PD3997 animals expressing a DAM-GFP construct driven by the vit-2 (gut) promoter. (g = 200X; h = 200X)

    Journal: BMC Genomics

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans

    doi: 10.1186/1471-2164-11-465

    Figure Lengend Snippet: Promoter specific expression of DAM methyltransferase in transgenic animals . (a-d) PD5122 animals expressing DAM-GFP fusion driven by the myo-3 (body wall muscle) promoter. (a = L4,10X; b = adult,10X; c = adult,10X; d = adult,100X). (e-f) PD3995 animals expressing a DAM-GFP fusion construct driven by the rol-6 (hypodermal) promoter. (e = 200X; f = 400X). (g-h) PD3997 animals expressing a DAM-GFP construct driven by the vit-2 (gut) promoter. (g = 200X; h = 200X)

    Article Snippet: in vitro methylation of N2 genomic DNA N2 genomic DNA was methylated using the following 200 μl reaction mixture: 30.0 μl (≈20-30 μg) N2 genomic DNA, 0.5 μl 32 mM S-adenosyl methionine, 1.0 μl E. coli DAM (8 U/μl, NEB M0222S), 20.0 μl 10× DAM buffer, 148.5 μl dH2 O.

    Techniques: Expressing, Transgenic Assay, Construct