t4 pnk  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    T4 Polynucleotide Kinase
    Description:
    T4 Polynucleotide Kinase 2 500 units
    Catalog Number:
    m0201l
    Price:
    228
    Size:
    2 500 units
    Category:
    Polynucleotide Kinases
    Buy from Supplier


    Structured Review

    New England Biolabs t4 pnk
    T4 Polynucleotide Kinase
    T4 Polynucleotide Kinase 2 500 units
    https://www.bioz.com/result/t4 pnk/product/New England Biolabs
    Average 95 stars, based on 334 article reviews
    Price from $9.99 to $1999.99
    t4 pnk - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities"

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00484-w

    yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1
    Figure Legend Snippet: yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1

    Techniques Used: In Vitro, Synthesized, Labeling, Incubation, Nuclear Magnetic Resonance

    2) Product Images from "Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities"

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00484-w

    yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1
    Figure Legend Snippet: yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1

    Techniques Used: In Vitro, Synthesized, Labeling, Incubation, Nuclear Magnetic Resonance

    3) Product Images from "PARP3 is a sensor of nicked nucleosomes and monoribosylates histone H2BGlu2"

    Article Title: PARP3 is a sensor of nicked nucleosomes and monoribosylates histone H2BGlu2

    Journal: Nature Communications

    doi: 10.1038/ncomms12404

    PARP3 monoribosylates H2B in damaged chromatin. ( a , left) 10μg of the chicken chromatin employed in these experiments was fractionated by SDS–PAGE and stained with Coomassie blue. (right) One microgram of soluble MNase-treated chicken chromatin or 50-mer oligonucleotide duplex (200 nM) harbouring a nick with 3′-P/5′-OH termini was mock-treated (0) or treated with 1, 0.5 or 0.25 U T4 PNK to restore 3′-OH/5′-P termini. These DNA substrates were then incubated with 100 nM hPARP3 and 12.5 μM biotin-NAD + for 30 min and biotinylated products separated by 15% SDS–PAGE and detected with streptavidin-HRP. ( b ) 1 μg chicken chromatin or the indicated recombinant histone was incubated with 100 nM hPARP3 in the presence of 300 nM 32 P-NAD + or 12.5 μM biotin-NAD and oligonucleotide harbouring either a DSB (middle) or SSB (right) and the reaction products fractionated by 15% SDS–PAGE and detected by autoradiography or streptavidin-HRP. (left) An aliquot of the chicken chromatin and recombinant histones was fractionated by SDS–PAGE and stained with Coomassie blue. ( c , left) Aliquots of recombinant histone standards were fractionated separately or together as an octamer on triton-acid urea gels and analysed by staining with Coomassie blue. (right) The products of the PARP3 ribosylation reactions conducted in b were fractionated on triton-acid urea gels and analysed by autoradiography. HRP, horseradish peroxidase.
    Figure Legend Snippet: PARP3 monoribosylates H2B in damaged chromatin. ( a , left) 10μg of the chicken chromatin employed in these experiments was fractionated by SDS–PAGE and stained with Coomassie blue. (right) One microgram of soluble MNase-treated chicken chromatin or 50-mer oligonucleotide duplex (200 nM) harbouring a nick with 3′-P/5′-OH termini was mock-treated (0) or treated with 1, 0.5 or 0.25 U T4 PNK to restore 3′-OH/5′-P termini. These DNA substrates were then incubated with 100 nM hPARP3 and 12.5 μM biotin-NAD + for 30 min and biotinylated products separated by 15% SDS–PAGE and detected with streptavidin-HRP. ( b ) 1 μg chicken chromatin or the indicated recombinant histone was incubated with 100 nM hPARP3 in the presence of 300 nM 32 P-NAD + or 12.5 μM biotin-NAD and oligonucleotide harbouring either a DSB (middle) or SSB (right) and the reaction products fractionated by 15% SDS–PAGE and detected by autoradiography or streptavidin-HRP. (left) An aliquot of the chicken chromatin and recombinant histones was fractionated by SDS–PAGE and stained with Coomassie blue. ( c , left) Aliquots of recombinant histone standards were fractionated separately or together as an octamer on triton-acid urea gels and analysed by staining with Coomassie blue. (right) The products of the PARP3 ribosylation reactions conducted in b were fractionated on triton-acid urea gels and analysed by autoradiography. HRP, horseradish peroxidase.

    Techniques Used: SDS Page, Staining, Incubation, TNKS1 Histone Ribosylation Assay, Recombinant, Autoradiography

    4) Product Images from "The wobble nucleotide-excising anticodon nuclease RloC is governed by the zinc-hook and DNA-dependent ATPase of its Rad50-like region"

    Article Title: The wobble nucleotide-excising anticodon nuclease RloC is governed by the zinc-hook and DNA-dependent ATPase of its Rad50-like region

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks593

    Gka RloC’s ATPase activates its ACNase. Gka RloC’s ACNase of the IMAC fraction was assayed in vitro in panels ( A )–( C ) and ( E ) essentially as described in Materials and Methods but in the absence of added DNA. ( A ) Dependence of Gka RloC’s ACNase activity on ATP’s level. ( B ) Gka RloC’s ACNase activity was assayed in the presence of 500 µM of the indicated nucleotides. ( C ) Time courses of Gka RloC’s ACNase activity in the presence of 0.5 mM ATP and indicated amounts of AMPPNP. ( D ) In vivo ACNase activity of the indicated Gka RloC alleles. Left panel—RNA extracted from cells expressing these alleles was 5′-end labelled using T4 Pnk and separated by denaturing PAGE. Right panel—the expression of the indicated Gka RloC alleles were monitored by Western using an anti-His tag monoclonal antibody ( 4 ). ( E ) Nucleotide specificity of Gka RloC’s ACNase activation. The activation reaction was performed in the presence of the indicated nucleotides (GTP and ATP at 0.5 mM each, dTTP at 5 µM).
    Figure Legend Snippet: Gka RloC’s ATPase activates its ACNase. Gka RloC’s ACNase of the IMAC fraction was assayed in vitro in panels ( A )–( C ) and ( E ) essentially as described in Materials and Methods but in the absence of added DNA. ( A ) Dependence of Gka RloC’s ACNase activity on ATP’s level. ( B ) Gka RloC’s ACNase activity was assayed in the presence of 500 µM of the indicated nucleotides. ( C ) Time courses of Gka RloC’s ACNase activity in the presence of 0.5 mM ATP and indicated amounts of AMPPNP. ( D ) In vivo ACNase activity of the indicated Gka RloC alleles. Left panel—RNA extracted from cells expressing these alleles was 5′-end labelled using T4 Pnk and separated by denaturing PAGE. Right panel—the expression of the indicated Gka RloC alleles were monitored by Western using an anti-His tag monoclonal antibody ( 4 ). ( E ) Nucleotide specificity of Gka RloC’s ACNase activation. The activation reaction was performed in the presence of the indicated nucleotides (GTP and ATP at 0.5 mM each, dTTP at 5 µM).

    Techniques Used: In Vitro, Activity Assay, In Vivo, Expressing, Polyacrylamide Gel Electrophoresis, Western Blot, Activation Assay

    5) Product Images from "Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects"

    Article Title: Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects

    Journal: Nature Communications

    doi: 10.1038/ncomms9430

    Cleavage at the 3′ end of the siRNA precursor by the HDV ribozyme enhances its expression and knockdown efficiency. ( a ) Secondary structure of saiRNA with HDV ribozyme at the 3′ end. The left part represents the saiRNA, with the guide sequence in red. The right part represents the HDV ribozyme. The blue arrow indicates the HDV ribozyme cleavage site. ( b ) Cleavage of the HDV ribozyme in vitro . The saiRNAs fused with a wild-type (saiRNA-RZ) or mutant (saiRNA-mRZ) HDV ribozyme at the 3′ end were transcribed in vitro by the T7 RNA polymerase. The transcripts were treated with T4 PNK without ATP and then analysed on a 20% denaturing polyacrylamide gel by ethidium bromide (EB) staining. ( c ) Schematic diagram of the shRNA and saiRNA with or without the HDV ribozyme (HDV-RZ) downstream of the 3′ end of the siRNA precursor. Expression of the siRNA precursors in mammalian cells was driven by an H1 promoter. The blue arrow indicates the cleavage site of HDV-RZ, and nucleotides marked in red represent the guide strand. ( d ) Knockdown efficiency and processing of shGP and saiGP transcribed by the H1 promoter as described in c . ( e , f ) Knockdown efficiency and processing of shRNA and saiRNA targeting the laminC (LC) and P53 genes in HEK293 cells. Luciferase and Northern blotting assays were performed as in d . Changes in protein levels on siRNA expression were determined by western blotting assays with antibodies recognizing laminC or p53. β-actin served as the loading control. ( g ) Effect of transfection dosages on the repression activity of shGP and saiGP-RZ. ( h ) Knockdown efficiency of the endogenous P53 gene by shRNA or saiRNA stably expressed in HEK293 cells transduced with lentiviral vectors. HEK293 cells were transduced with lentivirus encoding shp53, saip53 or saip53-RZ at different MOIs and selected by puromycin for 6 days. Expression of the P53 gene was measured by western blotting as in f . All the error bars represent the s.d. of three independent measurements.
    Figure Legend Snippet: Cleavage at the 3′ end of the siRNA precursor by the HDV ribozyme enhances its expression and knockdown efficiency. ( a ) Secondary structure of saiRNA with HDV ribozyme at the 3′ end. The left part represents the saiRNA, with the guide sequence in red. The right part represents the HDV ribozyme. The blue arrow indicates the HDV ribozyme cleavage site. ( b ) Cleavage of the HDV ribozyme in vitro . The saiRNAs fused with a wild-type (saiRNA-RZ) or mutant (saiRNA-mRZ) HDV ribozyme at the 3′ end were transcribed in vitro by the T7 RNA polymerase. The transcripts were treated with T4 PNK without ATP and then analysed on a 20% denaturing polyacrylamide gel by ethidium bromide (EB) staining. ( c ) Schematic diagram of the shRNA and saiRNA with or without the HDV ribozyme (HDV-RZ) downstream of the 3′ end of the siRNA precursor. Expression of the siRNA precursors in mammalian cells was driven by an H1 promoter. The blue arrow indicates the cleavage site of HDV-RZ, and nucleotides marked in red represent the guide strand. ( d ) Knockdown efficiency and processing of shGP and saiGP transcribed by the H1 promoter as described in c . ( e , f ) Knockdown efficiency and processing of shRNA and saiRNA targeting the laminC (LC) and P53 genes in HEK293 cells. Luciferase and Northern blotting assays were performed as in d . Changes in protein levels on siRNA expression were determined by western blotting assays with antibodies recognizing laminC or p53. β-actin served as the loading control. ( g ) Effect of transfection dosages on the repression activity of shGP and saiGP-RZ. ( h ) Knockdown efficiency of the endogenous P53 gene by shRNA or saiRNA stably expressed in HEK293 cells transduced with lentiviral vectors. HEK293 cells were transduced with lentivirus encoding shp53, saip53 or saip53-RZ at different MOIs and selected by puromycin for 6 days. Expression of the P53 gene was measured by western blotting as in f . All the error bars represent the s.d. of three independent measurements.

    Techniques Used: Expressing, Sequencing, In Vitro, Mutagenesis, Staining, shRNA, Luciferase, Northern Blot, Western Blot, Transfection, Activity Assay, Stable Transfection, Transduction

    6) Product Images from "Evidence that base stacking potential in annealed 3' overhangs determines polymerase utilization in yeast nonhomologous end joining"

    Article Title: Evidence that base stacking potential in annealed 3' overhangs determines polymerase utilization in yeast nonhomologous end joining

    Journal:

    doi: 10.1016/j.dnarep.2007.07.018

    5’ dRP lesions demand gap filling by Pol4, but do not require the Pol4 lyase activity or Rad27. (A) Schematic for construction of OMPs with 5’ dRP termini. Deoxyuracil residues are indicated in gray. Treatment with T4 PNK followed by UDG
    Figure Legend Snippet: 5’ dRP lesions demand gap filling by Pol4, but do not require the Pol4 lyase activity or Rad27. (A) Schematic for construction of OMPs with 5’ dRP termini. Deoxyuracil residues are indicated in gray. Treatment with T4 PNK followed by UDG

    Techniques Used: Activity Assay

    7) Product Images from "Genome-wide identification of short 2′,3′-cyclic phosphate-containing RNAs and their regulation in aging"

    Article Title: Genome-wide identification of short 2′,3′-cyclic phosphate-containing RNAs and their regulation in aging

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1008469

    Sequencing of cP-RNAs in mouse tissues. (A)  Total RNAs extracted from mouse tissues were subjected to northern blots for the 5′-halves of cyto tRNA LysCUU  and tRNA AspGUC .  (B)  Terminal structures of the 5′-tRNA half were analyzed enzymatically. Total RNA from the mouse lung was treated with CIP, T4 PNK, or acid followed by CIP treatment (HCl + CIP). NT designates the non-treated sample used as a negative control. The treated total RNA was subjected to northern blots targeting the 5′-tRNA AspGUC  half and microRNA-16 (miR-16). miR-16 was investigated as a control RNA containing 5′-P and 3′-OH ends.  (C)  Gel-purified 20–45-nt RNAs were subjected to cP-RNA-seq, which amplified 140–160-bp cDNA products (5′-adapter, 55 bp; 3′-adapter, 63 bp; and thereby estimated inserted sequences, 22–42 bp). The cDNAs in the region designated with a red line were purified and subjected to Illumina sequencing.  (D)  Proportion of cP-RNAs annotated to the indicated RNAs.
    Figure Legend Snippet: Sequencing of cP-RNAs in mouse tissues. (A) Total RNAs extracted from mouse tissues were subjected to northern blots for the 5′-halves of cyto tRNA LysCUU and tRNA AspGUC . (B) Terminal structures of the 5′-tRNA half were analyzed enzymatically. Total RNA from the mouse lung was treated with CIP, T4 PNK, or acid followed by CIP treatment (HCl + CIP). NT designates the non-treated sample used as a negative control. The treated total RNA was subjected to northern blots targeting the 5′-tRNA AspGUC half and microRNA-16 (miR-16). miR-16 was investigated as a control RNA containing 5′-P and 3′-OH ends. (C) Gel-purified 20–45-nt RNAs were subjected to cP-RNA-seq, which amplified 140–160-bp cDNA products (5′-adapter, 55 bp; 3′-adapter, 63 bp; and thereby estimated inserted sequences, 22–42 bp). The cDNAs in the region designated with a red line were purified and subjected to Illumina sequencing. (D) Proportion of cP-RNAs annotated to the indicated RNAs.

    Techniques Used: Sequencing, Northern Blot, Negative Control, Purification, RNA Sequencing Assay, Amplification

    TaqMan RT-qPCR quantification of cP-RNAs. (A) The alignment patterns of cP-RNAs for Ncbp3 mRNA and 28S rRNA. The positions of representative cP-RNAs, cPR-Ncbp3 and cPR-28S, are indicated. (B) The regions from which 5′-tRNA GlyGCC half (5′-GlyGCC), cPR-Ncbp3, and cPR-28S were derived are shown in red in the secondary structure of respective substrate RNAs. Secondary structure of Ncbp3 mRNA was predicted by ViennaRNA Package 2.0 [ 34 ]. (C) The total RNA from 24-week old mouse skeletal muscle, treated with CIP, wild-type (WT) T4 PNK, or mutant (Mut) T4 PNK lacking 3′-dephosphorylation activity, was subjected to TaqMan RT-qPCR. NT designates a non-treated sample used as a negative control. The amounts from WT T4 PNK-treated RNA were set as 1, and relative amounts are indicated. Averages of three experiments with SD values are shown. (D) The expression of cP-RNAs in the lung and skeletal muscle of 24-week old mice were quantified using TaqMan RT-qPCR. The cP-RNA amounts were estimated based on the standard curves shown in S9 Fig . Averages of three independent experiments with SD values are shown.
    Figure Legend Snippet: TaqMan RT-qPCR quantification of cP-RNAs. (A) The alignment patterns of cP-RNAs for Ncbp3 mRNA and 28S rRNA. The positions of representative cP-RNAs, cPR-Ncbp3 and cPR-28S, are indicated. (B) The regions from which 5′-tRNA GlyGCC half (5′-GlyGCC), cPR-Ncbp3, and cPR-28S were derived are shown in red in the secondary structure of respective substrate RNAs. Secondary structure of Ncbp3 mRNA was predicted by ViennaRNA Package 2.0 [ 34 ]. (C) The total RNA from 24-week old mouse skeletal muscle, treated with CIP, wild-type (WT) T4 PNK, or mutant (Mut) T4 PNK lacking 3′-dephosphorylation activity, was subjected to TaqMan RT-qPCR. NT designates a non-treated sample used as a negative control. The amounts from WT T4 PNK-treated RNA were set as 1, and relative amounts are indicated. Averages of three experiments with SD values are shown. (D) The expression of cP-RNAs in the lung and skeletal muscle of 24-week old mice were quantified using TaqMan RT-qPCR. The cP-RNA amounts were estimated based on the standard curves shown in S9 Fig . Averages of three independent experiments with SD values are shown.

    Techniques Used: Quantitative RT-PCR, Derivative Assay, Mutagenesis, De-Phosphorylation Assay, Activity Assay, Negative Control, Expressing, Mouse Assay

    8) Product Images from "A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi"

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2017.07.008

    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.
    Figure Legend Snippet: Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Techniques Used: Transfection, Concentration Assay, Real-time Polymerase Chain Reaction, Expressing

    9) Product Images from "Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA"

    Article Title: Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp1163

    Predicted activity of UDG and endoVIII in 454 library preparation of ancient DNA. T4 PNK phosphorylates 5′-ends leaving 5′-phosphate groups. UDG removes uracils, which are concentrated in short 5′- and 3′-overhangs in ancient DNA, leaving abasic sites. EndoVIII then cleaves on both sides of the abasic sites, leaving 5′- and 3′-phosphate groups. T4 polymerase fills in remaining 5′-overhangs and chews back 3′-overhangs, possibly aided by the 3′-phosphatase activity of PNK. Blunt-end ligation and fill-in of sequencing adaptors can then take place.
    Figure Legend Snippet: Predicted activity of UDG and endoVIII in 454 library preparation of ancient DNA. T4 PNK phosphorylates 5′-ends leaving 5′-phosphate groups. UDG removes uracils, which are concentrated in short 5′- and 3′-overhangs in ancient DNA, leaving abasic sites. EndoVIII then cleaves on both sides of the abasic sites, leaving 5′- and 3′-phosphate groups. T4 polymerase fills in remaining 5′-overhangs and chews back 3′-overhangs, possibly aided by the 3′-phosphatase activity of PNK. Blunt-end ligation and fill-in of sequencing adaptors can then take place.

    Techniques Used: Activity Assay, Ancient DNA Assay, Ligation, Sequencing

    10) Product Images from "Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)"

    Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)

    Journal: RNA

    doi: 10.1261/rna.5247704

    5′-adenylation of long RNA substrates. ( A ) Schematic diagram of the experimental strategy. The  > 100-mer RNA substrate is too long for 5′-AppRNA formation to induce a measurable gel shift relative to a 5′-monophosphate. Therefore, an appropriate 8–17 deoxyribozyme is used to cleave the 5′-portion of the RNA substrate, leaving a small fragment for which 5′-AppRNA formation does cause a gel shift. ( B ) The strategy in  A  applied to the 160-nt P4–P6 domain of the  Tetrahymena  group I intron RNA. Blocking oligos were uncapped. The three time points are at 0.5 min, 10 min, and 1 h (6% PAGE). The RNA substrate was internally radiolabeled by transcription incorporating α- 32 P-ATP; the 5′-monophosphate was provided by performing the transcription in the presence of excess GMP (see Materials and Methods). Although the side products have not been studied in great detail, the side product formed in the first experiment (P4–P6 with no DNA blocking oligo) is tentatively assigned as circularized P4–P6 on the basis of attempted 5′- 32 P-radiolabeling with T4 polynucleotide kinase and γ- 32 P-ATP; no reaction was observed alongside a positive control. Only the  lower  band (a mixture of 5′-monophosphate and 5′-AppRNA) was carried to the 8–17 deoxyribozyme cleavage experiment. std, P4–P6 standard RNA carried through all reactions with no blocking oligo, except that T4 RNA ligase was omitted. ( C ) The strategy in  A ).
    Figure Legend Snippet: 5′-adenylation of long RNA substrates. ( A ) Schematic diagram of the experimental strategy. The > 100-mer RNA substrate is too long for 5′-AppRNA formation to induce a measurable gel shift relative to a 5′-monophosphate. Therefore, an appropriate 8–17 deoxyribozyme is used to cleave the 5′-portion of the RNA substrate, leaving a small fragment for which 5′-AppRNA formation does cause a gel shift. ( B ) The strategy in A applied to the 160-nt P4–P6 domain of the Tetrahymena group I intron RNA. Blocking oligos were uncapped. The three time points are at 0.5 min, 10 min, and 1 h (6% PAGE). The RNA substrate was internally radiolabeled by transcription incorporating α- 32 P-ATP; the 5′-monophosphate was provided by performing the transcription in the presence of excess GMP (see Materials and Methods). Although the side products have not been studied in great detail, the side product formed in the first experiment (P4–P6 with no DNA blocking oligo) is tentatively assigned as circularized P4–P6 on the basis of attempted 5′- 32 P-radiolabeling with T4 polynucleotide kinase and γ- 32 P-ATP; no reaction was observed alongside a positive control. Only the lower band (a mixture of 5′-monophosphate and 5′-AppRNA) was carried to the 8–17 deoxyribozyme cleavage experiment. std, P4–P6 standard RNA carried through all reactions with no blocking oligo, except that T4 RNA ligase was omitted. ( C ) The strategy in A ).

    Techniques Used: Electrophoretic Mobility Shift Assay, Blocking Assay, Polyacrylamide Gel Electrophoresis, Radioactivity, Positive Control

    11) Product Images from "Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver"

    Article Title: Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1515308112

    Technical validation of ribosome profiling experiments. ( A ) Simplified representation of the modified ribosome profiling method. RNase I digestion leaves a 5′-OH and a 3′-cyclophosphate. T4 polynucleotide kinase treatment performed in
    Figure Legend Snippet: Technical validation of ribosome profiling experiments. ( A ) Simplified representation of the modified ribosome profiling method. RNase I digestion leaves a 5′-OH and a 3′-cyclophosphate. T4 polynucleotide kinase treatment performed in

    Techniques Used: Modification

    12) Product Images from "The wobble nucleotide-excising anticodon nuclease RloC is governed by the zinc-hook and DNA-dependent ATPase of its Rad50-like region"

    Article Title: The wobble nucleotide-excising anticodon nuclease RloC is governed by the zinc-hook and DNA-dependent ATPase of its Rad50-like region

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks593

    Gka RloC’s ATPase activates its ACNase. Gka RloC’s ACNase of the IMAC fraction was assayed in vitro in panels ( A )–( C ) and ( E ) essentially as described in Materials and Methods but in the absence of added DNA. ( A ) Dependence of Gka RloC’s ACNase activity on ATP’s level. ( B ) Gka RloC’s ACNase activity was assayed in the presence of 500 µM of the indicated nucleotides. ( C ) Time courses of Gka RloC’s ACNase activity in the presence of 0.5 mM ATP and indicated amounts of AMPPNP. ( D ) In vivo ACNase activity of the indicated Gka RloC alleles. Left panel—RNA extracted from cells expressing these alleles was 5′-end labelled using T4 Pnk and separated by denaturing PAGE. Right panel—the expression of the indicated Gka RloC alleles were monitored by Western using an anti-His tag monoclonal antibody ( 4 ). ( E ) Nucleotide specificity of Gka RloC’s ACNase activation. The activation reaction was performed in the presence of the indicated nucleotides (GTP and ATP at 0.5 mM each, dTTP at 5 µM).
    Figure Legend Snippet: Gka RloC’s ATPase activates its ACNase. Gka RloC’s ACNase of the IMAC fraction was assayed in vitro in panels ( A )–( C ) and ( E ) essentially as described in Materials and Methods but in the absence of added DNA. ( A ) Dependence of Gka RloC’s ACNase activity on ATP’s level. ( B ) Gka RloC’s ACNase activity was assayed in the presence of 500 µM of the indicated nucleotides. ( C ) Time courses of Gka RloC’s ACNase activity in the presence of 0.5 mM ATP and indicated amounts of AMPPNP. ( D ) In vivo ACNase activity of the indicated Gka RloC alleles. Left panel—RNA extracted from cells expressing these alleles was 5′-end labelled using T4 Pnk and separated by denaturing PAGE. Right panel—the expression of the indicated Gka RloC alleles were monitored by Western using an anti-His tag monoclonal antibody ( 4 ). ( E ) Nucleotide specificity of Gka RloC’s ACNase activation. The activation reaction was performed in the presence of the indicated nucleotides (GTP and ATP at 0.5 mM each, dTTP at 5 µM).

    Techniques Used: In Vitro, Activity Assay, In Vivo, Expressing, Polyacrylamide Gel Electrophoresis, Western Blot, Activation Assay

    13) Product Images from "A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi"

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2017.07.008

    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.
    Figure Legend Snippet: Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Techniques Used: Transfection, Concentration Assay, Real-time Polymerase Chain Reaction, Expressing

    14) Product Images from "Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities"

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00484-w

    yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1
    Figure Legend Snippet: yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1

    Techniques Used: In Vitro, Synthesized, Labeling, Incubation, Nuclear Magnetic Resonance

    15) Product Images from "Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations"

    Article Title: Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations

    Journal: eLife

    doi: 10.7554/eLife.51605

    Purification and activity assays of PNKP and Polβ. ( A ) Purified Polβ-His 6 (17 ng) and PNKP-His 6 (127 ng) from E. coli were subjected to PAGE and stained with Coomassie blue. ( B ) Incorporation of [α- 32 P]-dCTP by Polβ using APE1-generated product. ddC, di-deoxynucleotide; P, product. ( C ) Schematic of the preparation of S (substrate) and subsequent enzymatic reactions for testing PNKP activity. ( D ) Efficiency of oligonucleotide labeling, annealing, and ligation leading to S indicated in ( C ). ( E ) Fpg (NEB, 1 U) completely digested S and the 3’ phosphate was completely removed by PNKP (12.7 ng and 127 ng, lanes 2 and 3), or by T4 PNK (NEB, 0.1 U and 1 U, lanes 7 and 8). NEIL2 (272 ng) only partially digested S and its 3’P was resistant to the PNKP phosphatase (lanes 4 and 5).
    Figure Legend Snippet: Purification and activity assays of PNKP and Polβ. ( A ) Purified Polβ-His 6 (17 ng) and PNKP-His 6 (127 ng) from E. coli were subjected to PAGE and stained with Coomassie blue. ( B ) Incorporation of [α- 32 P]-dCTP by Polβ using APE1-generated product. ddC, di-deoxynucleotide; P, product. ( C ) Schematic of the preparation of S (substrate) and subsequent enzymatic reactions for testing PNKP activity. ( D ) Efficiency of oligonucleotide labeling, annealing, and ligation leading to S indicated in ( C ). ( E ) Fpg (NEB, 1 U) completely digested S and the 3’ phosphate was completely removed by PNKP (12.7 ng and 127 ng, lanes 2 and 3), or by T4 PNK (NEB, 0.1 U and 1 U, lanes 7 and 8). NEIL2 (272 ng) only partially digested S and its 3’P was resistant to the PNKP phosphatase (lanes 4 and 5).

    Techniques Used: Purification, Activity Assay, Polyacrylamide Gel Electrophoresis, Staining, Generated, Oligonucleotide Labeling, Ligation

    16) Product Images from "Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations"

    Article Title: Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations

    Journal: eLife

    doi: 10.7554/eLife.51605

    Purification and activity assays of PNKP and Polβ. ( A ) Purified Polβ-His 6 (17 ng) and PNKP-His 6 (127 ng) from E. coli were subjected to PAGE and stained with Coomassie blue. ( B ) Incorporation of [α- 32 P]-dCTP by Polβ using APE1-generated product. ddC, di-deoxynucleotide; P, product. ( C ) Schematic of the preparation of S (substrate) and subsequent enzymatic reactions for testing PNKP activity. ( D ) Efficiency of oligonucleotide labeling, annealing, and ligation leading to S indicated in ( C ). ( E ) Fpg (NEB, 1 U) completely digested S and the 3’ phosphate was completely removed by PNKP (12.7 ng and 127 ng, lanes 2 and 3), or by T4 PNK (NEB, 0.1 U and 1 U, lanes 7 and 8). NEIL2 (272 ng) only partially digested S and its 3’P was resistant to the PNKP phosphatase (lanes 4 and 5).
    Figure Legend Snippet: Purification and activity assays of PNKP and Polβ. ( A ) Purified Polβ-His 6 (17 ng) and PNKP-His 6 (127 ng) from E. coli were subjected to PAGE and stained with Coomassie blue. ( B ) Incorporation of [α- 32 P]-dCTP by Polβ using APE1-generated product. ddC, di-deoxynucleotide; P, product. ( C ) Schematic of the preparation of S (substrate) and subsequent enzymatic reactions for testing PNKP activity. ( D ) Efficiency of oligonucleotide labeling, annealing, and ligation leading to S indicated in ( C ). ( E ) Fpg (NEB, 1 U) completely digested S and the 3’ phosphate was completely removed by PNKP (12.7 ng and 127 ng, lanes 2 and 3), or by T4 PNK (NEB, 0.1 U and 1 U, lanes 7 and 8). NEIL2 (272 ng) only partially digested S and its 3’P was resistant to the PNKP phosphatase (lanes 4 and 5).

    Techniques Used: Purification, Activity Assay, Polyacrylamide Gel Electrophoresis, Staining, Generated, Oligonucleotide Labeling, Ligation

    17) Product Images from "Capped small RNAs and MOV10 in Human Hepatitis Delta Virus replication"

    Article Title: Capped small RNAs and MOV10 in Human Hepatitis Delta Virus replication

    Journal: Nature structural & molecular biology

    doi: 10.1038/nsmb.1440

    The antigenomic HDV small RNA is 2′-3′ hydroxylated and has an mRNA-like 5′ cap (Northern Blot, 293 cells, RNA induction). ( a ) 3′ end by β-elimination. The mobility of the HDV small RNA is increased following β-elimination. miR-15a: 2′-3′ hydroxylated positive control; +β: +β-elimination; -β: untreated RNA. ( b ) 5′ end by enzymatic analysis. 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: PNK (+HDV); 4: Decapping enzyme (TAP; +HDV); 5: T4 RNA Ligase (+HDV); 6: Terminator Exonuclease (+HDV). The size of the HDV small RNA was estimated to be ∼24nt based on the largely 22nt, 5′ phosphorylated miR15-a shown in the inset (IS). ( c ) Confirmation that the 5′ end of the HDV small RNA is capped, not triphosphorylated (enlarged image to emphasize changes in gel mobility for miR-15a, but not HDV small RNA). 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: Antarctic Phosphatase (+HDV); 4: Antarctic Phosphatase followed by T4 PNK (+HDV). ( d ) RNA immunoprecipitation with anti-2,2,7-trimethylguanosine antibody K121. The immunoprecipitation efficiency of the HDV small RNA, U5 snRNA (positive control) and microRNAs miR-15a and let-7a (negative controls) was analysed by Northern blot. ‘S’: supernatant; ‘I’: IP fraction. ( e ) Predicted structure of the HDV small RNA. The various RNAs in a - d were detected after stripping and rehybridisation to the same blot. M: RNA marker.
    Figure Legend Snippet: The antigenomic HDV small RNA is 2′-3′ hydroxylated and has an mRNA-like 5′ cap (Northern Blot, 293 cells, RNA induction). ( a ) 3′ end by β-elimination. The mobility of the HDV small RNA is increased following β-elimination. miR-15a: 2′-3′ hydroxylated positive control; +β: +β-elimination; -β: untreated RNA. ( b ) 5′ end by enzymatic analysis. 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: PNK (+HDV); 4: Decapping enzyme (TAP; +HDV); 5: T4 RNA Ligase (+HDV); 6: Terminator Exonuclease (+HDV). The size of the HDV small RNA was estimated to be ∼24nt based on the largely 22nt, 5′ phosphorylated miR15-a shown in the inset (IS). ( c ) Confirmation that the 5′ end of the HDV small RNA is capped, not triphosphorylated (enlarged image to emphasize changes in gel mobility for miR-15a, but not HDV small RNA). 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: Antarctic Phosphatase (+HDV); 4: Antarctic Phosphatase followed by T4 PNK (+HDV). ( d ) RNA immunoprecipitation with anti-2,2,7-trimethylguanosine antibody K121. The immunoprecipitation efficiency of the HDV small RNA, U5 snRNA (positive control) and microRNAs miR-15a and let-7a (negative controls) was analysed by Northern blot. ‘S’: supernatant; ‘I’: IP fraction. ( e ) Predicted structure of the HDV small RNA. The various RNAs in a - d were detected after stripping and rehybridisation to the same blot. M: RNA marker.

    Techniques Used: Northern Blot, Positive Control, Immunoprecipitation, Stripping Membranes, Marker

    Cloning and characterization of an HDV small RNA of genomic polarity. ( a ) Relative location and cloning frequency of sequenced HDV small RNAs derived from the genomic and antigenomic pode hairpins (main species highlighted in red). ( b ) Detection of genomic HDV small RNA by Northern Blot (293 cells, day 5). 1: DNA induction, wt HDAg; 2: DNA induction, mutant HDAg. ( c ) Enzymatic analysis of genomic small RNA 5′ end. 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: PNK (+HDV); 4: Antarctic Phosphatase (+HDV); 5: Antarctic Phosphatase followed by T4 PNK (+HDV); 6: Decapping enzyme (TAP; +HDV); 7: T4 RNA Ligase (+HDV); 8: Terminator Exonuclease (+HDV). Note that unlike the antigenomic small RNA, a minor fraction of the genomic small RNA does not appear to be shifted following TAP treatment. ( d - f ) Localization of the HDV small RNAs. ( d ) Nuclear-cytoplasmic fractionation of antigenomic HDV small RNA (polyacrylamide gel) and full-length antigenomic and genomic HDV RNA (denaturing agarose gel). The main species in the full-length genomic/antigenomic RNA blot corresponds to the monomer, the higher molecular weight species to dimer, trimer etc. 1: DNA induction, mutant HDAg; 2: DNA induction, wt HDAg; 3: untransfected. ( e ) Genomic small RNA is restricted to the nucleus (nuclear-cytoplasmic fractionation). 1: DNA induction, wt HDAg; 2: DNA induction, mutant HDAg. miR-15a and U6 snRNA chosen as largely cytoplasmic and nuclear RNA controls, respectively. ( f ) The HDV small RNA can be found in the HDV virion. 1: RNA induction (same RNA as in Fig. 2c ); 2: virion RNA isolated from tissue culture media (∼1.25×10 9 particles). MR: RNA Marker. The various RNAs in c-f were detected after stripping and re-hybridization to the same blot.
    Figure Legend Snippet: Cloning and characterization of an HDV small RNA of genomic polarity. ( a ) Relative location and cloning frequency of sequenced HDV small RNAs derived from the genomic and antigenomic pode hairpins (main species highlighted in red). ( b ) Detection of genomic HDV small RNA by Northern Blot (293 cells, day 5). 1: DNA induction, wt HDAg; 2: DNA induction, mutant HDAg. ( c ) Enzymatic analysis of genomic small RNA 5′ end. 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: PNK (+HDV); 4: Antarctic Phosphatase (+HDV); 5: Antarctic Phosphatase followed by T4 PNK (+HDV); 6: Decapping enzyme (TAP; +HDV); 7: T4 RNA Ligase (+HDV); 8: Terminator Exonuclease (+HDV). Note that unlike the antigenomic small RNA, a minor fraction of the genomic small RNA does not appear to be shifted following TAP treatment. ( d - f ) Localization of the HDV small RNAs. ( d ) Nuclear-cytoplasmic fractionation of antigenomic HDV small RNA (polyacrylamide gel) and full-length antigenomic and genomic HDV RNA (denaturing agarose gel). The main species in the full-length genomic/antigenomic RNA blot corresponds to the monomer, the higher molecular weight species to dimer, trimer etc. 1: DNA induction, mutant HDAg; 2: DNA induction, wt HDAg; 3: untransfected. ( e ) Genomic small RNA is restricted to the nucleus (nuclear-cytoplasmic fractionation). 1: DNA induction, wt HDAg; 2: DNA induction, mutant HDAg. miR-15a and U6 snRNA chosen as largely cytoplasmic and nuclear RNA controls, respectively. ( f ) The HDV small RNA can be found in the HDV virion. 1: RNA induction (same RNA as in Fig. 2c ); 2: virion RNA isolated from tissue culture media (∼1.25×10 9 particles). MR: RNA Marker. The various RNAs in c-f were detected after stripping and re-hybridization to the same blot.

    Techniques Used: Clone Assay, Derivative Assay, Northern Blot, Mutagenesis, Fractionation, Agarose Gel Electrophoresis, Northern blot, Molecular Weight, Isolation, Marker, Stripping Membranes, Hybridization

    18) Product Images from "Four Methods of Preparing mRNA 5? End Libraries Using the Illumina Sequencing Platform"

    Article Title: Four Methods of Preparing mRNA 5? End Libraries Using the Illumina Sequencing Platform

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0101812

    Library preparation using the CapSMART method. A) The protocol used either poly A+ (0.50–10 µg) or total (10–200 µg) RNA. B) De-phosphorylation of mono-, di-, and tri- phosphate groups from non-capped 5′ end molecules using alkaline phosphatase. C) Phosphorylation to add mono-phosphate to the non-capped 5′ end molecules using T4 Polynucleotide Kinase. D) Ligation of STOP oligos. A total of three kinds of oligonucleotides ( Table 2 : STOP1: iGiCiG, STOP2: iCiGiC, STOPMix: mixture of STOP1 and STOP2) were used in the present study. E) First-strand cDNA synthesis. F) Second-strand cDNA amplification by PCR with biotinylated 5′ end primers. G) Fragmentation of cDNA using a Bioruptor and collection of biotinylated 5′ ends using beads. H) Illumina sequencing library preparation.
    Figure Legend Snippet: Library preparation using the CapSMART method. A) The protocol used either poly A+ (0.50–10 µg) or total (10–200 µg) RNA. B) De-phosphorylation of mono-, di-, and tri- phosphate groups from non-capped 5′ end molecules using alkaline phosphatase. C) Phosphorylation to add mono-phosphate to the non-capped 5′ end molecules using T4 Polynucleotide Kinase. D) Ligation of STOP oligos. A total of three kinds of oligonucleotides ( Table 2 : STOP1: iGiCiG, STOP2: iCiGiC, STOPMix: mixture of STOP1 and STOP2) were used in the present study. E) First-strand cDNA synthesis. F) Second-strand cDNA amplification by PCR with biotinylated 5′ end primers. G) Fragmentation of cDNA using a Bioruptor and collection of biotinylated 5′ ends using beads. H) Illumina sequencing library preparation.

    Techniques Used: De-Phosphorylation Assay, Ligation, Amplification, Polymerase Chain Reaction, Sequencing

    19) Product Images from "Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities"

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00484-w

    yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1
    Figure Legend Snippet: yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1

    Techniques Used: In Vitro, Synthesized, Labeling, Incubation, Nuclear Magnetic Resonance

    20) Product Images from "Crystal structure of a PIWI protein suggests mechanisms for siRNA recognition and slicer activity"

    Article Title: Crystal structure of a PIWI protein suggests mechanisms for siRNA recognition and slicer activity

    Journal: The EMBO Journal

    doi: 10.1038/sj.emboj.7600488

    AfPiwi forms a distinct complex with an siRNA-like RNA duplex. ( A ) Sequence and structure of the self-complementary RNA oligonucleotide used in this study. The RNA was labelled with  32 P at the 5′ end ( * ) using T4 PNK. ( B ) EMSA assessing complex formation between the end-labelled RNA (
    Figure Legend Snippet: AfPiwi forms a distinct complex with an siRNA-like RNA duplex. ( A ) Sequence and structure of the self-complementary RNA oligonucleotide used in this study. The RNA was labelled with 32 P at the 5′ end ( * ) using T4 PNK. ( B ) EMSA assessing complex formation between the end-labelled RNA (

    Techniques Used: Sequencing

    21) Product Images from "No-Go Decay mRNA cleavage in the ribosome exit tunnel produces 5′-OH ends phosphorylated by Trl1"

    Article Title: No-Go Decay mRNA cleavage in the ribosome exit tunnel produces 5′-OH ends phosphorylated by Trl1

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13991-9

    Endonucleolytically cleaved 5′-OH RNAs are phosphorylated by Trl1. a 8% PAGE followed by northern blot analysis using probe prA. Levels of 3′-NGD RNA fragments in trl1/dom34 cells compared with those from TRL1/dom34 cells. b B1 and B4 RNA quantification relative to 5S rRNA from three independent experiments as shown in a . c 12% PAGE followed by northern blot analysis using probe prA. Treatment using T4 PNK to determine 5’-OH and 5’-P B4 RNA positions in the indicated strains. One-fourth of trl1/dom34 total RNA treated was loaded to limit scan saturation and allow TRL1/dom34 B4 RNA detection. The 5S rRNA served as a loading control. d As in Fig. 3a , Xrn1 digestion of total RNA extracts from trl1/dom34 mutant cells in the presence or absence of T4 PNK treatment in vitro. A minor band detected in trl1 is indicated by an asterisk (see also Supplementary Fig. 5 in which this band is detectable in TRL1 cells). Error bars indicate standard deviation (s.d.) calculated from three independent experiments. Source data are provided as a Source Data file.
    Figure Legend Snippet: Endonucleolytically cleaved 5′-OH RNAs are phosphorylated by Trl1. a 8% PAGE followed by northern blot analysis using probe prA. Levels of 3′-NGD RNA fragments in trl1/dom34 cells compared with those from TRL1/dom34 cells. b B1 and B4 RNA quantification relative to 5S rRNA from three independent experiments as shown in a . c 12% PAGE followed by northern blot analysis using probe prA. Treatment using T4 PNK to determine 5’-OH and 5’-P B4 RNA positions in the indicated strains. One-fourth of trl1/dom34 total RNA treated was loaded to limit scan saturation and allow TRL1/dom34 B4 RNA detection. The 5S rRNA served as a loading control. d As in Fig. 3a , Xrn1 digestion of total RNA extracts from trl1/dom34 mutant cells in the presence or absence of T4 PNK treatment in vitro. A minor band detected in trl1 is indicated by an asterisk (see also Supplementary Fig. 5 in which this band is detectable in TRL1 cells). Error bars indicate standard deviation (s.d.) calculated from three independent experiments. Source data are provided as a Source Data file.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Northern Blot, RNA Detection, Mutagenesis, In Vitro, Standard Deviation

    22) Product Images from "Highly efficient expression of circular RNA aptamers in cells using autocatalytic transcripts"

    Article Title: Highly efficient expression of circular RNA aptamers in cells using autocatalytic transcripts

    Journal: Nature biotechnology

    doi: 10.1038/s41587-019-0090-6

    Tornado expression system generates circular RNA a , Ribozymes efficiently self-cleave during transcription reactions.. The construct containing Twister P1 and Twister P3 U2A ribozymes was transcribed  in vitro  and quenched with urea before running on denaturing PAGE and visualizing RNA. Fully cleaved products and the side products of cleavage accumulate efficiently and rapidly after transcription. b , Fully-cleaved products of transcription in  a  contain appropriate ends for circularization by the endogenous ligase, RtcB. We excised the fully-cleaved RNA from  a  and performed an RtcB ligation reactions. RtcB treatment produces a shift in gel mobility that is not observed without ligation or with pre-treatment with T4 PNK. This shift in gel mobility suggests that the fully-cleaved RNA contains the appropriate ends for ligation. Staining of the gel with DFHBI-1T and comparison of fluorescence relative to SYBR Gold signal demonstrates that circular Broccoli is brighter than linear Broccoli. c , Twister-based ribozyme-assisted circular RNA (racRNA) expression generates significantly higher levels of circular RNA than the previous circular RNA expressing system. HEK293T cells expressed racRNA Broccoli from a variety of racRNA expression systems (see  Fig. 1 ) with different combinations of 5’ and 3’ ribozymes and were compared to expression using the tricY system. Cells were treated with actinomycin D (ActD) for 6 h to observe the drop in RNA levels after new RNA synthesis was inhibited. The Twister P1 and Twister P3 U2A construct, dubbed “Tornado”, expresses high levels of Broccoli RNA that exhibit high stability, characteristic of circRNA. d , Tornado-expressed RNA is decisively circular. DNA-directed cleavage by RNase H of a linear RNA produces two bands, each of expected size given the transcript length and probe site. The identical treatment of the same sequence expressed from Tornado produces a single band similar in size to the uncleaved transcribed sample.
    Figure Legend Snippet: Tornado expression system generates circular RNA a , Ribozymes efficiently self-cleave during transcription reactions.. The construct containing Twister P1 and Twister P3 U2A ribozymes was transcribed in vitro and quenched with urea before running on denaturing PAGE and visualizing RNA. Fully cleaved products and the side products of cleavage accumulate efficiently and rapidly after transcription. b , Fully-cleaved products of transcription in a contain appropriate ends for circularization by the endogenous ligase, RtcB. We excised the fully-cleaved RNA from a and performed an RtcB ligation reactions. RtcB treatment produces a shift in gel mobility that is not observed without ligation or with pre-treatment with T4 PNK. This shift in gel mobility suggests that the fully-cleaved RNA contains the appropriate ends for ligation. Staining of the gel with DFHBI-1T and comparison of fluorescence relative to SYBR Gold signal demonstrates that circular Broccoli is brighter than linear Broccoli. c , Twister-based ribozyme-assisted circular RNA (racRNA) expression generates significantly higher levels of circular RNA than the previous circular RNA expressing system. HEK293T cells expressed racRNA Broccoli from a variety of racRNA expression systems (see Fig. 1 ) with different combinations of 5’ and 3’ ribozymes and were compared to expression using the tricY system. Cells were treated with actinomycin D (ActD) for 6 h to observe the drop in RNA levels after new RNA synthesis was inhibited. The Twister P1 and Twister P3 U2A construct, dubbed “Tornado”, expresses high levels of Broccoli RNA that exhibit high stability, characteristic of circRNA. d , Tornado-expressed RNA is decisively circular. DNA-directed cleavage by RNase H of a linear RNA produces two bands, each of expected size given the transcript length and probe site. The identical treatment of the same sequence expressed from Tornado produces a single band similar in size to the uncleaved transcribed sample.

    Techniques Used: Expressing, Construct, In Vitro, Polyacrylamide Gel Electrophoresis, Ligation, Staining, Fluorescence, Sequencing

    23) Product Images from "Comprehensive analysis of the Corynebacterium glutamicum transcriptome using an improved RNAseq technique"

    Article Title: Comprehensive analysis of the Corynebacterium glutamicum transcriptome using an improved RNAseq technique

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-14-888

    Experimental workflow for the preparation of a whole transcriptome library (a) and of a library enriched for primary 5′-transcript ends (b). Both protocols start with isolated total RNA. Stable RNA is then depleted using the Ribo-Zero rRNA removal kit and the obtained RNA is fragmented my metal hydrolysis to a size of 200 - 500 nt. For the whole transcriptome library (a) the 5′-triphosphate ends are processed to 5′-monophosphate ends by a RNA 5′-polyphosphatase, unphosphorylated 5′-ends are phosphorylated, and phosphorylated 3′-ends are then dephosphorylated using T4 polynucleotide kinase. For the native 5′-end protocol (b) , all fragments containing a 5′-monophosphate are degraded by treatment with a 5′-phosphate dependent exonuclease and the 5′-triphosphate ends of native transcripts are then processed to 5′-monophosphate ends by a RNA 5′-polyphosphatase. Next, for both libraries RNA adapters are ligated to the 5′-ends carrying a 5′-monophosphate group. The tagging of the 3′-end of the RNA with flanking sequences necessary for reverse transcription is performed in a ligation-free approach with a loop DNA adapter containing seven unpaired wobble bases at its 3′-end. After reverse transcription of the RNA fragments into cDNA fragments, the cDNA fragments are amplified, tagged with sequencing linkers at their ends by PCR and finally sequenced. Stable RNA species (rRNA, tRNA) are depicted in red, other RNAs are given in green, and DNA in blue.
    Figure Legend Snippet: Experimental workflow for the preparation of a whole transcriptome library (a) and of a library enriched for primary 5′-transcript ends (b). Both protocols start with isolated total RNA. Stable RNA is then depleted using the Ribo-Zero rRNA removal kit and the obtained RNA is fragmented my metal hydrolysis to a size of 200 - 500 nt. For the whole transcriptome library (a) the 5′-triphosphate ends are processed to 5′-monophosphate ends by a RNA 5′-polyphosphatase, unphosphorylated 5′-ends are phosphorylated, and phosphorylated 3′-ends are then dephosphorylated using T4 polynucleotide kinase. For the native 5′-end protocol (b) , all fragments containing a 5′-monophosphate are degraded by treatment with a 5′-phosphate dependent exonuclease and the 5′-triphosphate ends of native transcripts are then processed to 5′-monophosphate ends by a RNA 5′-polyphosphatase. Next, for both libraries RNA adapters are ligated to the 5′-ends carrying a 5′-monophosphate group. The tagging of the 3′-end of the RNA with flanking sequences necessary for reverse transcription is performed in a ligation-free approach with a loop DNA adapter containing seven unpaired wobble bases at its 3′-end. After reverse transcription of the RNA fragments into cDNA fragments, the cDNA fragments are amplified, tagged with sequencing linkers at their ends by PCR and finally sequenced. Stable RNA species (rRNA, tRNA) are depicted in red, other RNAs are given in green, and DNA in blue.

    Techniques Used: Isolation, Ligation, Amplification, Sequencing, Polymerase Chain Reaction

    24) Product Images from "High-throughput determination of RNA structure by proximity ligation"

    Article Title: High-throughput determination of RNA structure by proximity ligation

    Journal: Nature biotechnology

    doi: 10.1038/nbt.3289

    RNA Proximity Ligation identifies structurally proximate regions within the complex secondary structures of S. cerevisiae ribosomal RNAs. a.) A schematic representation of the RPL method. Whole cells are spheroplasted with zymolyase and RNA is allowed to react with endogenous RNases. RNA ends are repaired in situ via T4 PNK to yield 5′-phosphate termini. Complexes are ligated overnight in the presence of T4 RNA Ligase I. Ligation products are cleaned up via acid guanidinium-phenol and subsequent DNase treatment, and subjected to Illumina TruSeq RNA-seq library preparation. These libraries are sequenced to map and count ligation junctions; b.-c.) We examined the distribution of ligation junctions as a function of distance from known base-pair partners in the 25S/5.8S rRNA and 18S rRNAs. Ligation products capture the structural proximity implied by base-pairing relationships, as evidenced by the enrichment for ligation junctions immediately near paired bases. Y-axes are shown as ligation counts per million reads analyzed. d.) Contact probability map for the eukaryotic 5.8S/25S rRNA based on RPL scores, which are calculated from the frequencies of ligation events between pairs of 21 nt windows ( Methods ). Lower inset : Ligation events, shown for bases 1300 to 1475 of the LSU rRNA in orange, primarily occur across digested single-stranded loops. RPL scores effectively smooth this noisy signal and are enriched for pairs of interacting regions. Plotted here are the 8,463 ligation events where both nucleotides fall within the displayed domain (compared to 17,029 ligation events where one nucleotide falls within the displayed domain and one does not, not shown). Right inset: RPL scores localize known pseudo-knots in the LSU rRNA structure, such as the interaction between bases 1727-1812 (shown in red) and bases 1941 – 2038 (shown in blue).
    Figure Legend Snippet: RNA Proximity Ligation identifies structurally proximate regions within the complex secondary structures of S. cerevisiae ribosomal RNAs. a.) A schematic representation of the RPL method. Whole cells are spheroplasted with zymolyase and RNA is allowed to react with endogenous RNases. RNA ends are repaired in situ via T4 PNK to yield 5′-phosphate termini. Complexes are ligated overnight in the presence of T4 RNA Ligase I. Ligation products are cleaned up via acid guanidinium-phenol and subsequent DNase treatment, and subjected to Illumina TruSeq RNA-seq library preparation. These libraries are sequenced to map and count ligation junctions; b.-c.) We examined the distribution of ligation junctions as a function of distance from known base-pair partners in the 25S/5.8S rRNA and 18S rRNAs. Ligation products capture the structural proximity implied by base-pairing relationships, as evidenced by the enrichment for ligation junctions immediately near paired bases. Y-axes are shown as ligation counts per million reads analyzed. d.) Contact probability map for the eukaryotic 5.8S/25S rRNA based on RPL scores, which are calculated from the frequencies of ligation events between pairs of 21 nt windows ( Methods ). Lower inset : Ligation events, shown for bases 1300 to 1475 of the LSU rRNA in orange, primarily occur across digested single-stranded loops. RPL scores effectively smooth this noisy signal and are enriched for pairs of interacting regions. Plotted here are the 8,463 ligation events where both nucleotides fall within the displayed domain (compared to 17,029 ligation events where one nucleotide falls within the displayed domain and one does not, not shown). Right inset: RPL scores localize known pseudo-knots in the LSU rRNA structure, such as the interaction between bases 1727-1812 (shown in red) and bases 1941 – 2038 (shown in blue).

    Techniques Used: Ligation, In Situ, RNA Sequencing Assay

    25) Product Images from "The RNA Binding Specificity of Human APOBEC3 Proteins Resembles That of HIV-1 Nucleocapsid"

    Article Title: The RNA Binding Specificity of Human APOBEC3 Proteins Resembles That of HIV-1 Nucleocapsid

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1005833

    Flow diagram of CLIP-seq. Cells are fed with the ribonucleoside analog 4-thiouridine (4SU) which is incorporated into nascent RNA. Live cells are then irradiated with ultraviolet (UV) light, which induces covalent cross-links between proteins and RNA at sites of contact and 4SU incorporation. Cells are then lysed and treated with RNase A to generate oligonucleotides crosslinked to proteins of interest. Protein-RNA complexes are then immunopurified, and then the RNA is dephosphorylated at the 3'-end with alkaline phosphatase. The RNA is subsequently radiolabeled with  32 P using T4 polynucleotide kinase (PNK) for detection by autoradiography. Protein-RNA complexes are then separated by SDS-PAGE, transferred to nitrocellulose and a region corresponding to protein-RNA adducts is excised. Cross-linked RNA is isolated by proteinase K treatment and phenol:chloroform extraction. After sequential adapter ligations, the RNA library is reverse transcribed. Reverse transcriptase often misincorporates a G opposite the 4SU cross-linking site, which leads to T to C substitutions in positive-strand of the cDNA, enabling the precise mapping of protein-RNA interaction sites. After PCR amplification, the cDNA library is sequenced by Illumina sequencing.
    Figure Legend Snippet: Flow diagram of CLIP-seq. Cells are fed with the ribonucleoside analog 4-thiouridine (4SU) which is incorporated into nascent RNA. Live cells are then irradiated with ultraviolet (UV) light, which induces covalent cross-links between proteins and RNA at sites of contact and 4SU incorporation. Cells are then lysed and treated with RNase A to generate oligonucleotides crosslinked to proteins of interest. Protein-RNA complexes are then immunopurified, and then the RNA is dephosphorylated at the 3'-end with alkaline phosphatase. The RNA is subsequently radiolabeled with 32 P using T4 polynucleotide kinase (PNK) for detection by autoradiography. Protein-RNA complexes are then separated by SDS-PAGE, transferred to nitrocellulose and a region corresponding to protein-RNA adducts is excised. Cross-linked RNA is isolated by proteinase K treatment and phenol:chloroform extraction. After sequential adapter ligations, the RNA library is reverse transcribed. Reverse transcriptase often misincorporates a G opposite the 4SU cross-linking site, which leads to T to C substitutions in positive-strand of the cDNA, enabling the precise mapping of protein-RNA interaction sites. After PCR amplification, the cDNA library is sequenced by Illumina sequencing.

    Techniques Used: Flow Cytometry, Cross-linking Immunoprecipitation, Irradiation, Autoradiography, SDS Page, Isolation, Polymerase Chain Reaction, Amplification, cDNA Library Assay, Sequencing

    26) Product Images from "A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi"

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2017.07.008

    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.
    Figure Legend Snippet: Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Techniques Used: Transfection, Concentration Assay, Real-time Polymerase Chain Reaction, Expressing

    27) Product Images from "siRNA function in RNAi: A chemical modification analysis"

    Article Title: siRNA function in RNAi: A chemical modification analysis

    Journal: RNA

    doi: 10.1261/rna.5103703

    Extending the half-life of siRNA duplexes prolongs the persistence of RNA interference in vivo. ( A ) Comparing the stability of unmodified siRNAs with siRNAs containing 2′-fluoro-uridine and 2′-fluoro-cytidine (2′-FU, 2′-FC) modifications ( a ) and thioate linkage (P–S) modifications ( b ). Unmodified or modified EGFP antisense strand siRNAs (AS) were 5′-labeled with [γ- 32 P]ATP by T4 polynucleotide kinases. Duplex siRNAs were formed by annealing equal molar ratios of sense-strand (SS) siRNAs with the 5′- 32 P-labeled antisense strand. To analyze siRNA stability in HeLa cell extract, 50 pmole of siRNA was incubated with 500 μg of HeLa cell extract in 50 μL of reaction mixture containing 20 mM HEPES (pH 7.9), 100 mM KCl, 10 mM NaCl, 2 mM MgCl 2 , and 10% glycerol. At various time points, siRNAs were extracted and analyzed on 20% polyacrylamide gels containing 7 M urea followed by phosphorimage analysis (Fugi). ( B ) Kinetics of RNAi effects of duplex siRNA with 2′-fluoro-uridine and 2′-fluoro-cytidine modification in HeLa cells over a 144-h time course. The fluorescence intensity ratio of target (GFP) to control (RFP) protein was determined in the presence of unmodified dsRNA (blue bars) and duplex siRNA with 2′-fluoro-uridine and -cytidine modifications (DS-2′-FU, 2′-FC, cyan bar) and normalized to the ratio observed in the presence of mock-treated cells (red bars). Normalized ratios at
    Figure Legend Snippet: Extending the half-life of siRNA duplexes prolongs the persistence of RNA interference in vivo. ( A ) Comparing the stability of unmodified siRNAs with siRNAs containing 2′-fluoro-uridine and 2′-fluoro-cytidine (2′-FU, 2′-FC) modifications ( a ) and thioate linkage (P–S) modifications ( b ). Unmodified or modified EGFP antisense strand siRNAs (AS) were 5′-labeled with [γ- 32 P]ATP by T4 polynucleotide kinases. Duplex siRNAs were formed by annealing equal molar ratios of sense-strand (SS) siRNAs with the 5′- 32 P-labeled antisense strand. To analyze siRNA stability in HeLa cell extract, 50 pmole of siRNA was incubated with 500 μg of HeLa cell extract in 50 μL of reaction mixture containing 20 mM HEPES (pH 7.9), 100 mM KCl, 10 mM NaCl, 2 mM MgCl 2 , and 10% glycerol. At various time points, siRNAs were extracted and analyzed on 20% polyacrylamide gels containing 7 M urea followed by phosphorimage analysis (Fugi). ( B ) Kinetics of RNAi effects of duplex siRNA with 2′-fluoro-uridine and 2′-fluoro-cytidine modification in HeLa cells over a 144-h time course. The fluorescence intensity ratio of target (GFP) to control (RFP) protein was determined in the presence of unmodified dsRNA (blue bars) and duplex siRNA with 2′-fluoro-uridine and -cytidine modifications (DS-2′-FU, 2′-FC, cyan bar) and normalized to the ratio observed in the presence of mock-treated cells (red bars). Normalized ratios at

    Techniques Used: In Vivo, Modification, Labeling, Incubation, Fluorescence

    28) Product Images from "Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver"

    Article Title: Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1515308112

    Technical validation of ribosome profiling experiments. ( A ) Simplified representation of the modified ribosome profiling method. RNase I digestion leaves a 5′-OH and a 3′-cyclophosphate. T4 polynucleotide kinase treatment performed in
    Figure Legend Snippet: Technical validation of ribosome profiling experiments. ( A ) Simplified representation of the modified ribosome profiling method. RNase I digestion leaves a 5′-OH and a 3′-cyclophosphate. T4 polynucleotide kinase treatment performed in

    Techniques Used: Modification

    29) Product Images from "Evidence that base stacking potential in annealed 3' overhangs determines polymerase utilization in yeast nonhomologous end joining"

    Article Title: Evidence that base stacking potential in annealed 3' overhangs determines polymerase utilization in yeast nonhomologous end joining

    Journal:

    doi: 10.1016/j.dnarep.2007.07.018

    5’ dRP lesions demand gap filling by Pol4, but do not require the Pol4 lyase activity or Rad27. (A) Schematic for construction of OMPs with 5’ dRP termini. Deoxyuracil residues are indicated in gray. Treatment with T4 PNK followed by UDG
    Figure Legend Snippet: 5’ dRP lesions demand gap filling by Pol4, but do not require the Pol4 lyase activity or Rad27. (A) Schematic for construction of OMPs with 5’ dRP termini. Deoxyuracil residues are indicated in gray. Treatment with T4 PNK followed by UDG

    Techniques Used: Activity Assay

    30) Product Images from "Life without tRNAIle-lysidine synthetase: translation of the isoleucine codon AUA in Bacillus subtilis lacking the canonical tRNA2Ile"

    Article Title: Life without tRNAIle-lysidine synthetase: translation of the isoleucine codon AUA in Bacillus subtilis lacking the canonical tRNA2Ile

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt1009

    Lysidine is absent in tRNA 2 Ile from Bacillus subtilis JJS80 lacking tilS . ( A ) 1D TLC analysis of the wobble position 34 in tRNA 2 Ile purified from B. subtilis wild-type and JJS80. Purified wild-type tRNA 2 and mutant tRNA 2 were partially hydrolyzed by alkali, the 5′ termini of the fragments were 32 P-labeled using T4-PNK. 32 P-labeled fragments were subsequently digested with nuclease P1 and the nature of the 5′ terminal nucleotide was determined by TLC. The solvent used was isobutyric acid:concentrated ammonia:water (66:1:33) ( v : v : v ). The mobility of each nucleotide (pA, pC, pG, pU) was confirmed with non-radiolabeled standards used as internal markers and visualized by UV shadowing. ( B and C ) Template-dependent binding of purified wild-type 3 H-Ile-tRNA 2 (B) and mutant 35 S-Met-tRNA 2 (C) to ribosomes isolated from B. subtilis . Oligonucleotides used were AUG AUA, AUG AUC, AUG AUG, AUG AUU and AUG UUU; the oligonucleotide concentration was 200 μM.
    Figure Legend Snippet: Lysidine is absent in tRNA 2 Ile from Bacillus subtilis JJS80 lacking tilS . ( A ) 1D TLC analysis of the wobble position 34 in tRNA 2 Ile purified from B. subtilis wild-type and JJS80. Purified wild-type tRNA 2 and mutant tRNA 2 were partially hydrolyzed by alkali, the 5′ termini of the fragments were 32 P-labeled using T4-PNK. 32 P-labeled fragments were subsequently digested with nuclease P1 and the nature of the 5′ terminal nucleotide was determined by TLC. The solvent used was isobutyric acid:concentrated ammonia:water (66:1:33) ( v : v : v ). The mobility of each nucleotide (pA, pC, pG, pU) was confirmed with non-radiolabeled standards used as internal markers and visualized by UV shadowing. ( B and C ) Template-dependent binding of purified wild-type 3 H-Ile-tRNA 2 (B) and mutant 35 S-Met-tRNA 2 (C) to ribosomes isolated from B. subtilis . Oligonucleotides used were AUG AUA, AUG AUC, AUG AUG, AUG AUU and AUG UUU; the oligonucleotide concentration was 200 μM.

    Techniques Used: Thin Layer Chromatography, Purification, Mutagenesis, Labeling, Binding Assay, Isolation, Concentration Assay

    31) Product Images from "High-throughput determination of RNA structure by proximity ligation"

    Article Title: High-throughput determination of RNA structure by proximity ligation

    Journal: Nature biotechnology

    doi: 10.1038/nbt.3289

    RNA Proximity Ligation identifies structurally proximate regions within the complex secondary structures of S. cerevisiae ribosomal RNAs. a.) A schematic representation of the RPL method. Whole cells are spheroplasted with zymolyase and RNA is allowed to react with endogenous RNases. RNA ends are repaired in situ via T4 PNK to yield 5′-phosphate termini. Complexes are ligated overnight in the presence of T4 RNA Ligase I. Ligation products are cleaned up via acid guanidinium-phenol and subsequent DNase treatment, and subjected to Illumina TruSeq RNA-seq library preparation. These libraries are sequenced to map and count ligation junctions; b.-c.) We examined the distribution of ligation junctions as a function of distance from known base-pair partners in the 25S/5.8S rRNA and 18S rRNAs. Ligation products capture the structural proximity implied by base-pairing relationships, as evidenced by the enrichment for ligation junctions immediately near paired bases. Y-axes are shown as ligation counts per million reads analyzed. d.) Contact probability map for the eukaryotic 5.8S/25S rRNA based on RPL scores, which are calculated from the frequencies of ligation events between pairs of 21 nt windows ( Methods ). Lower inset : Ligation events, shown for bases 1300 to 1475 of the LSU rRNA in orange, primarily occur across digested single-stranded loops. RPL scores effectively smooth this noisy signal and are enriched for pairs of interacting regions. Plotted here are the 8,463 ligation events where both nucleotides fall within the displayed domain (compared to 17,029 ligation events where one nucleotide falls within the displayed domain and one does not, not shown). Right inset: RPL scores localize known pseudo-knots in the LSU rRNA structure, such as the interaction between bases 1727-1812 (shown in red) and bases 1941 – 2038 (shown in blue).
    Figure Legend Snippet: RNA Proximity Ligation identifies structurally proximate regions within the complex secondary structures of S. cerevisiae ribosomal RNAs. a.) A schematic representation of the RPL method. Whole cells are spheroplasted with zymolyase and RNA is allowed to react with endogenous RNases. RNA ends are repaired in situ via T4 PNK to yield 5′-phosphate termini. Complexes are ligated overnight in the presence of T4 RNA Ligase I. Ligation products are cleaned up via acid guanidinium-phenol and subsequent DNase treatment, and subjected to Illumina TruSeq RNA-seq library preparation. These libraries are sequenced to map and count ligation junctions; b.-c.) We examined the distribution of ligation junctions as a function of distance from known base-pair partners in the 25S/5.8S rRNA and 18S rRNAs. Ligation products capture the structural proximity implied by base-pairing relationships, as evidenced by the enrichment for ligation junctions immediately near paired bases. Y-axes are shown as ligation counts per million reads analyzed. d.) Contact probability map for the eukaryotic 5.8S/25S rRNA based on RPL scores, which are calculated from the frequencies of ligation events between pairs of 21 nt windows ( Methods ). Lower inset : Ligation events, shown for bases 1300 to 1475 of the LSU rRNA in orange, primarily occur across digested single-stranded loops. RPL scores effectively smooth this noisy signal and are enriched for pairs of interacting regions. Plotted here are the 8,463 ligation events where both nucleotides fall within the displayed domain (compared to 17,029 ligation events where one nucleotide falls within the displayed domain and one does not, not shown). Right inset: RPL scores localize known pseudo-knots in the LSU rRNA structure, such as the interaction between bases 1727-1812 (shown in red) and bases 1941 – 2038 (shown in blue).

    Techniques Used: Ligation, In Situ, RNA Sequencing Assay

    32) Product Images from "Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities"

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00484-w

    yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1
    Figure Legend Snippet: yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1

    Techniques Used: In Vitro, Synthesized, Labeling, Incubation, Nuclear Magnetic Resonance

    33) Product Images from "Purification of cross-linked RNA-protein complexes by phenol-toluol extraction"

    Article Title: Purification of cross-linked RNA-protein complexes by phenol-toluol extraction

    Journal: Nature Communications

    doi: 10.1038/s41467-019-08942-3

    PTex recovers bacterial RNPs.  a Salmonella  Typhimurium SL1344 Hfq-FLAG was UV-cross-linked and HOT-PTex was performed to purify bacterial RNPs.  b  Western blot using an anti-FLAG antibody demonstrates recovery of Hfq monomers linked to RNA. Note that the physiologically active Hfq hexamer partially withstands SDS-PAGE conditions  49  and that this complex is also enriched after PTex.  c  RNPs in  Salmonella  were purified by PTex globally. 172 Proteins enriched after UV-cross-linking (PTex CL) contain ribosomal proteins (transparent red), known RBPs (red) and DNA-binders (orange). Individual enriched proteins not known to associate with RNA before were used for validation (in parentheses).  d  Validation of PTex-enriched RNA-interactors:  Salmonella  strains expressing FLAG-tagged proteins were immunoprecipitated  ±UV irradiation. RNA-association is confirmed by radioactive labelling of RNA 5′ ends by polynucleotide kinase (T4 PNK) using autoradiography; a signal is exclusively detectable after UV-cross-linking and radiolabelling of precipitated RNA. CsrA-FLAG (pos. ctr.), YigA-FLAG (neg. ctr.), AhpC-FLAG, SipA-FLAG and YihI-FLAG are bound to RNA in vivo.  e  GO terms significantly enriched among the RNA-associated proteins;  p -value derived from a one-tail Fisher Exact test  75 . For full gels/blots see Supplementary Figures   25 ,   26
    Figure Legend Snippet: PTex recovers bacterial RNPs. a Salmonella Typhimurium SL1344 Hfq-FLAG was UV-cross-linked and HOT-PTex was performed to purify bacterial RNPs. b Western blot using an anti-FLAG antibody demonstrates recovery of Hfq monomers linked to RNA. Note that the physiologically active Hfq hexamer partially withstands SDS-PAGE conditions 49 and that this complex is also enriched after PTex. c RNPs in Salmonella were purified by PTex globally. 172 Proteins enriched after UV-cross-linking (PTex CL) contain ribosomal proteins (transparent red), known RBPs (red) and DNA-binders (orange). Individual enriched proteins not known to associate with RNA before were used for validation (in parentheses). d Validation of PTex-enriched RNA-interactors: Salmonella strains expressing FLAG-tagged proteins were immunoprecipitated  ±UV irradiation. RNA-association is confirmed by radioactive labelling of RNA 5′ ends by polynucleotide kinase (T4 PNK) using autoradiography; a signal is exclusively detectable after UV-cross-linking and radiolabelling of precipitated RNA. CsrA-FLAG (pos. ctr.), YigA-FLAG (neg. ctr.), AhpC-FLAG, SipA-FLAG and YihI-FLAG are bound to RNA in vivo. e GO terms significantly enriched among the RNA-associated proteins; p -value derived from a one-tail Fisher Exact test 75 . For full gels/blots see Supplementary Figures  25 , 26

    Techniques Used: Western Blot, SDS Page, Purification, Expressing, Immunoprecipitation, Irradiation, Autoradiography, In Vivo, Derivative Assay

    34) Product Images from "Life without tRNAIle-lysidine synthetase: translation of the isoleucine codon AUA in Bacillus subtilis lacking the canonical tRNA2Ile"

    Article Title: Life without tRNAIle-lysidine synthetase: translation of the isoleucine codon AUA in Bacillus subtilis lacking the canonical tRNA2Ile

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt1009

    Lysidine is absent in tRNA 2 Ile from Bacillus subtilis JJS80 lacking tilS . ( A ) 1D TLC analysis of the wobble position 34 in tRNA 2 Ile purified from B. subtilis wild-type and JJS80. Purified wild-type tRNA 2 and mutant tRNA 2 were partially hydrolyzed by alkali, the 5′ termini of the fragments were 32 P-labeled using T4-PNK. 32 P-labeled fragments were subsequently digested with nuclease P1 and the nature of the 5′ terminal nucleotide was determined by TLC. The solvent used was isobutyric acid:concentrated ammonia:water (66:1:33) ( v : v : v ). The mobility of each nucleotide (pA, pC, pG, pU) was confirmed with non-radiolabeled standards used as internal markers and visualized by UV shadowing. ( B and C ) Template-dependent binding of purified wild-type 3 H-Ile-tRNA 2 (B) and mutant 35 S-Met-tRNA 2 (C) to ribosomes isolated from B. subtilis . Oligonucleotides used were AUG AUA, AUG AUC, AUG AUG, AUG AUU and AUG UUU; the oligonucleotide concentration was 200 μM.
    Figure Legend Snippet: Lysidine is absent in tRNA 2 Ile from Bacillus subtilis JJS80 lacking tilS . ( A ) 1D TLC analysis of the wobble position 34 in tRNA 2 Ile purified from B. subtilis wild-type and JJS80. Purified wild-type tRNA 2 and mutant tRNA 2 were partially hydrolyzed by alkali, the 5′ termini of the fragments were 32 P-labeled using T4-PNK. 32 P-labeled fragments were subsequently digested with nuclease P1 and the nature of the 5′ terminal nucleotide was determined by TLC. The solvent used was isobutyric acid:concentrated ammonia:water (66:1:33) ( v : v : v ). The mobility of each nucleotide (pA, pC, pG, pU) was confirmed with non-radiolabeled standards used as internal markers and visualized by UV shadowing. ( B and C ) Template-dependent binding of purified wild-type 3 H-Ile-tRNA 2 (B) and mutant 35 S-Met-tRNA 2 (C) to ribosomes isolated from B. subtilis . Oligonucleotides used were AUG AUA, AUG AUC, AUG AUG, AUG AUU and AUG UUU; the oligonucleotide concentration was 200 μM.

    Techniques Used: Thin Layer Chromatography, Purification, Mutagenesis, Labeling, Binding Assay, Isolation, Concentration Assay

    35) Product Images from "Capped small RNAs and MOV10 in Human Hepatitis Delta Virus replication"

    Article Title: Capped small RNAs and MOV10 in Human Hepatitis Delta Virus replication

    Journal: Nature structural & molecular biology

    doi: 10.1038/nsmb.1440

    The antigenomic HDV small RNA is 2′-3′ hydroxylated and has an mRNA-like 5′ cap (Northern Blot, 293 cells, RNA induction). ( a ) 3′ end by β-elimination. The mobility of the HDV small RNA is increased following β-elimination. miR-15a: 2′-3′ hydroxylated positive control; +β: +β-elimination; -β: untreated RNA. ( b ) 5′ end by enzymatic analysis. 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: PNK (+HDV); 4: Decapping enzyme (TAP; +HDV); 5: T4 RNA Ligase (+HDV); 6: Terminator Exonuclease (+HDV). The size of the HDV small RNA was estimated to be ∼24nt based on the largely 22nt, 5′ phosphorylated miR15-a shown in the inset (IS). ( c ) Confirmation that the 5′ end of the HDV small RNA is capped, not triphosphorylated (enlarged image to emphasize changes in gel mobility for miR-15a, but not HDV small RNA). 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: Antarctic Phosphatase (+HDV); 4: Antarctic Phosphatase followed by T4 PNK (+HDV). ( d ) RNA immunoprecipitation with anti-2,2,7-trimethylguanosine antibody K121. The immunoprecipitation efficiency of the HDV small RNA, U5 snRNA (positive control) and microRNAs miR-15a and let-7a (negative controls) was analysed by Northern blot. ‘S’: supernatant; ‘I’: IP fraction. ( e ) Predicted structure of the HDV small RNA. The various RNAs in a - d were detected after stripping and rehybridisation to the same blot. M: RNA marker.
    Figure Legend Snippet: The antigenomic HDV small RNA is 2′-3′ hydroxylated and has an mRNA-like 5′ cap (Northern Blot, 293 cells, RNA induction). ( a ) 3′ end by β-elimination. The mobility of the HDV small RNA is increased following β-elimination. miR-15a: 2′-3′ hydroxylated positive control; +β: +β-elimination; -β: untreated RNA. ( b ) 5′ end by enzymatic analysis. 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: PNK (+HDV); 4: Decapping enzyme (TAP; +HDV); 5: T4 RNA Ligase (+HDV); 6: Terminator Exonuclease (+HDV). The size of the HDV small RNA was estimated to be ∼24nt based on the largely 22nt, 5′ phosphorylated miR15-a shown in the inset (IS). ( c ) Confirmation that the 5′ end of the HDV small RNA is capped, not triphosphorylated (enlarged image to emphasize changes in gel mobility for miR-15a, but not HDV small RNA). 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: Antarctic Phosphatase (+HDV); 4: Antarctic Phosphatase followed by T4 PNK (+HDV). ( d ) RNA immunoprecipitation with anti-2,2,7-trimethylguanosine antibody K121. The immunoprecipitation efficiency of the HDV small RNA, U5 snRNA (positive control) and microRNAs miR-15a and let-7a (negative controls) was analysed by Northern blot. ‘S’: supernatant; ‘I’: IP fraction. ( e ) Predicted structure of the HDV small RNA. The various RNAs in a - d were detected after stripping and rehybridisation to the same blot. M: RNA marker.

    Techniques Used: Northern Blot, Positive Control, Immunoprecipitation, Stripping Membranes, Marker

    Cloning and characterization of an HDV small RNA of genomic polarity. ( a ) Relative location and cloning frequency of sequenced HDV small RNAs derived from the genomic and antigenomic pode hairpins (main species highlighted in red). ( b ) Detection of genomic HDV small RNA by Northern Blot (293 cells, day 5). 1: DNA induction, wt HDAg; 2: DNA induction, mutant HDAg. ( c ) Enzymatic analysis of genomic small RNA 5′ end. 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: PNK (+HDV); 4: Antarctic Phosphatase (+HDV); 5: Antarctic Phosphatase followed by T4 PNK (+HDV); 6: Decapping enzyme (TAP; +HDV); 7: T4 RNA Ligase (+HDV); 8: Terminator Exonuclease (+HDV). Note that unlike the antigenomic small RNA, a minor fraction of the genomic small RNA does not appear to be shifted following TAP treatment. ( d - f ) Localization of the HDV small RNAs. ( d ) Nuclear-cytoplasmic fractionation of antigenomic HDV small RNA (polyacrylamide gel) and full-length antigenomic and genomic HDV RNA (denaturing agarose gel). The main species in the full-length genomic/antigenomic RNA blot corresponds to the monomer, the higher molecular weight species to dimer, trimer etc. 1: DNA induction, mutant HDAg; 2: DNA induction, wt HDAg; 3: untransfected. ( e ) Genomic small RNA is restricted to the nucleus (nuclear-cytoplasmic fractionation). 1: DNA induction, wt HDAg; 2: DNA induction, mutant HDAg. miR-15a and U6 snRNA chosen as largely cytoplasmic and nuclear RNA controls, respectively. ( f ) The HDV small RNA can be found in the HDV virion. 1: RNA induction (same RNA as in Fig. 2c ); 2: virion RNA isolated from tissue culture media (∼1.25×10 9 particles). MR: RNA Marker. The various RNAs in c-f were detected after stripping and re-hybridization to the same blot.
    Figure Legend Snippet: Cloning and characterization of an HDV small RNA of genomic polarity. ( a ) Relative location and cloning frequency of sequenced HDV small RNAs derived from the genomic and antigenomic pode hairpins (main species highlighted in red). ( b ) Detection of genomic HDV small RNA by Northern Blot (293 cells, day 5). 1: DNA induction, wt HDAg; 2: DNA induction, mutant HDAg. ( c ) Enzymatic analysis of genomic small RNA 5′ end. 1: mock-treated (+HDV); 2: mock-treated (no HDV); 3: PNK (+HDV); 4: Antarctic Phosphatase (+HDV); 5: Antarctic Phosphatase followed by T4 PNK (+HDV); 6: Decapping enzyme (TAP; +HDV); 7: T4 RNA Ligase (+HDV); 8: Terminator Exonuclease (+HDV). Note that unlike the antigenomic small RNA, a minor fraction of the genomic small RNA does not appear to be shifted following TAP treatment. ( d - f ) Localization of the HDV small RNAs. ( d ) Nuclear-cytoplasmic fractionation of antigenomic HDV small RNA (polyacrylamide gel) and full-length antigenomic and genomic HDV RNA (denaturing agarose gel). The main species in the full-length genomic/antigenomic RNA blot corresponds to the monomer, the higher molecular weight species to dimer, trimer etc. 1: DNA induction, mutant HDAg; 2: DNA induction, wt HDAg; 3: untransfected. ( e ) Genomic small RNA is restricted to the nucleus (nuclear-cytoplasmic fractionation). 1: DNA induction, wt HDAg; 2: DNA induction, mutant HDAg. miR-15a and U6 snRNA chosen as largely cytoplasmic and nuclear RNA controls, respectively. ( f ) The HDV small RNA can be found in the HDV virion. 1: RNA induction (same RNA as in Fig. 2c ); 2: virion RNA isolated from tissue culture media (∼1.25×10 9 particles). MR: RNA Marker. The various RNAs in c-f were detected after stripping and re-hybridization to the same blot.

    Techniques Used: Clone Assay, Derivative Assay, Northern Blot, Mutagenesis, Fractionation, Agarose Gel Electrophoresis, Northern blot, Molecular Weight, Isolation, Marker, Stripping Membranes, Hybridization

    36) Product Images from "Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis"

    Article Title: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis

    Journal: JCI Insight

    doi: 10.1172/jci.insight.127317

    Treatment of total extracellular RNA with T4 polynucleotide kinase followed by small-RNA-sequencing. ( A ) Total RNA was isolated from 450 μl serum or platelet-depleted EDTA, acid citrate dextrose (ACD), and heparin plasma from 6 healthy individuals and purified using silica-based spin columns. Half of the RNA was treated with T4 polynucleotide kinase (T4 PNK) and repurified (PNK treated), and multiplexed small-RNA-sequencing (sRNA-seq) libraries were prepared separately for the untreated (libraries 1 and 3) and PNK-treated RNA (libraries 2 and 4). ( B ) Differences in read annotation in the 4 sample types for untreated RNA and PNK-treated RNA using initial annotation settings (reads 12–42 nt, up to 2 mismatches, multimapping). ( C ) Differences in ex‑mRNA capture between untreated and PNK-treated RNA using final annotation criteria (reads > 15 nt, no mismatch and up to 2 mapping locations). Box plots show the median and first and third quartiles (bottom and top hinges). Whiskers extend at most ×1.5 interquartile range from the hinges; any data outside this are shown as individual outlier points. Shown are results from n = 6 individual samples per condition.
    Figure Legend Snippet: Treatment of total extracellular RNA with T4 polynucleotide kinase followed by small-RNA-sequencing. ( A ) Total RNA was isolated from 450 μl serum or platelet-depleted EDTA, acid citrate dextrose (ACD), and heparin plasma from 6 healthy individuals and purified using silica-based spin columns. Half of the RNA was treated with T4 polynucleotide kinase (T4 PNK) and repurified (PNK treated), and multiplexed small-RNA-sequencing (sRNA-seq) libraries were prepared separately for the untreated (libraries 1 and 3) and PNK-treated RNA (libraries 2 and 4). ( B ) Differences in read annotation in the 4 sample types for untreated RNA and PNK-treated RNA using initial annotation settings (reads 12–42 nt, up to 2 mismatches, multimapping). ( C ) Differences in ex‑mRNA capture between untreated and PNK-treated RNA using final annotation criteria (reads > 15 nt, no mismatch and up to 2 mapping locations). Box plots show the median and first and third quartiles (bottom and top hinges). Whiskers extend at most ×1.5 interquartile range from the hinges; any data outside this are shown as individual outlier points. Shown are results from n = 6 individual samples per condition.

    Techniques Used: RNA Sequencing Assay, Isolation, Purification

    Related Articles

    Clone Assay:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: Together, these modifications allow for scarless cloning into the pX330 vector. .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA). .. Golden gate cloning was used to insert sgRNA oligos into FgH1tUTG (100 ng) by digesting with BsmbI (cat. no. ER0451; Fermentas, Vilnius, Lithuania) and annealing with T7 ligase (cat. no. M0318S; New England Biolabs) in the thermocycler: 37°C for 5 minutes then 23°C for 5 minutes, 15 cycles, and hold at 4°C.

    Centrifugation:

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: The powdered cells were recovered by centrifugation at 4000 g for 15 min at 4 °C, then the supernatant was additionally centrifuged at 16,000 g for 10 min at 4 °C. .. For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB).

    Amplification:

    Article Title: CMV2b-Dependent Regulation of Host Defense Pathways in the Context of Viral Infection
    Article Snippet: The mixture of three 1-kb fragments at the 3′-terminus of each CMV cDNA clone were amplified and labeled with [α-32 P] dCTP was used as probe. .. The mixture of DNA oligonucleotides [ ] specific to CMV RNA3 labeled with [r-32 P] using T4 PNK (NEB, M0201V, Ipswich, MA, USA) was used as probe.

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions. .. The library was amplified with limited cycles of PCR, gel-extracted on an 8% native PAGE gel, and sequenced on an Illumina MiSeq.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Fifteen-microliter reactions were incubated with the indicated enzymes at 37°C (Terminator Exonuclease: 30°C) for 60 min, acid phenol/chloroform extracted, ethanol precipitated, and resuspended for the second round of enzyme treatments, which was again followed by acid phenol/chloroform extraction, ethanol precipitation, and resuspension in PAGE loading buffer for Northern blot. .. Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB).

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: Samples were resolved on a 20% 19:1 acrylamide:bis-acrylamide PAGE gel containing 8 M urea, 89 mM Tris borate and 2 mM EDTA. .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Synthesized:

    Article Title: Boronic acid-mediated polymerase chain reaction for gene- and fragment-specific detection of 5-hydroxymethylcytosine
    Article Snippet: Firstly, oligo 1, oligo 3, oligo 4 and oligo 5 (150 pmol each) were phosphorylated by 10 units T4 PNK at 37°C for 2 h. The solution was buffer with 1 × ligation buffer (New England Biolabs, Ipswich, MA, USA). .. The control probe was synthesized according to the same procedure, but 5hmC-oligo 1 was replaced with the oligo 1 containing a C or 5mC at the same position of 5hmC.

    Construct:

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: Sequencing libraries were constructed using NEBNext® Small RNA Library Prep Set for Illumina® (NEB, E7330) according to the manufacturer’s instructions. .. The fragmented RNA was end-repaired using T4-polynucletide kinase (T4-PNK; NEB, M0201) by adding 2µl T4-PNK 10X buffer, 2 µl T4-PNK and then incubating the reaction at 37°C for 2h.

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. For library construction, the small RNA library prep kit for Illumina (NEB) was used and the constructed library was sequenced using the 50 bp read recipe on an Illumina Hiseq2500.

    Incubation:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer). .. The product was ligated into the pX330 vector using a single-step digestion-ligation with FastDigest BbsI (Thermo Fisher Scientific) and T4 ligase (New England Biolabs, Inc.).

    Article Title: Simplified ChIP-exo assays
    Article Snippet: .. The kinase reaction (30 µl) containing: 10 U T4 PNK (NEB), 1 × T4 DNA Ligase Buffer (NEB), and 2 × BSA was incubated for 15 min at 37 °C; then washed with 10 mM Tris-HCl, pH 8.0 at 4 °C. .. The λ exonuclease digestion (100 µl) containing: 20 U λ exonuclease (NEB), 1 × λ exonuclease reaction buffer (NEB), 0.1% Triton-X 100, and 5% DMSO was incubated for 30 min at 37 °C; then washed with 10 mM Tris-HCl, pH 8.0 at 4 °C.

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: .. The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking. .. The beads were washed once with PNK buffer and twice with PGB Cell Lysis Buffer (the last wash was rotated for at least 5 min in the cold room).

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Fifteen-microliter reactions were incubated with the indicated enzymes at 37°C (Terminator Exonuclease: 30°C) for 60 min, acid phenol/chloroform extracted, ethanol precipitated, and resuspended for the second round of enzyme treatments, which was again followed by acid phenol/chloroform extraction, ethanol precipitation, and resuspension in PAGE loading buffer for Northern blot. .. Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB).

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: .. For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. After purification of the RNA samples using an RNeasy MinElute Column (Qiagen), the concentration of purified RNA was measured using the Qubit RNA HS assay kit (Invitrogen).

    Article Title: Nucleotide Resolution Comparison of Transcription of Human Cytomegalovirus and Host Genomes Reveals Universal Use of RNA Polymerase II Elongation Control Driven by Dissimilar Core Promoter Elements
    Article Snippet: .. PRO-Seq samples were then incubated at 37°C for 1 h with 80 µl 5/4× T4 polynucleotide kinase (PNK) mix (0.313 U/µl T4 PNK [NEB M0201], 5/4× T4 PNK buffer, 1.25 mM ATP, and 0.625 U/µl SUPERase-In). ..

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK. ..

    Activity Assay:

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only. .. Assays for 3′ A-tailing activity were carried out at 37 °C or 65 °C using annealed oligonucleotides in a final concentration of 0.5 µM and 2 units of Taq DNA pol, Klenow Fragment (3′-5′ exo− ) or Hemo KlenTaq (NEB) in 10 µl reaction in the presence of 1x NEBNext End Repair Buffer (NEB) or a 3′ A tailing buffer.

    In Silico:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Small-guide RNAs (sgRNAs) were designed in silico (crispr.mit.edu) based on experimentally determined algorithms described previously by to be targeted at the promoter region or exon 5 and areas measured by ChIP primers. .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Expressing:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: CRISPR/Cas9 To target Ska1 exon 1, the guide 5′-TAATTGTTCCAGATCTGACG-3′ (Ska1 GuideA top) was cloned into the human codon optimized SpCas9 and chimeric guide expression plasmid (pX330; Addgene) using BbsI. .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Modification:

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Capillary Gel Electrophoresis Analysis Enzyme modification of the DNA substrates was monitored using fluorescence capillary gel electrophoresis (CE) as described previously . .. Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    Transformation Assay:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA). .. The reaction was then transformed into homemade Sbtl3 cells by following manufacturer’s instructions (cat. no. T3001; Zymo Research, Irvine, CA, made from cat. no. C737303; Thermo Scientific), plated on LB-Amp plates at 37°C, and grown overnight.

    Transfection:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer). .. Cells were transfected with 1.5 µg plasmid using Fugene6 (Roche) in 1.5 ml DMEM according to the manufacturer’s instructions.

    Ligation:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer). .. The product was ligated into the pX330 vector using a single-step digestion-ligation with FastDigest BbsI (Thermo Fisher Scientific) and T4 ligase (New England Biolabs, Inc.).

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: Paragraph title: hiCLIP (3′ end RNA dephosphorylation and 1st round of adaptor ligation) ... The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking.

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB). .. For 3′-adapter ligation with T4 RNA ligase, a noncommercial buffer without ATP was made up and 1 μg of the following activated 3′-adapter added: 5′-AppCTGTAGGCACCATCAAT–NH2-3′ (NEB 1315).

    Article Title: Boronic acid-mediated polymerase chain reaction for gene- and fragment-specific detection of 5-hydroxymethylcytosine
    Article Snippet: .. Firstly, oligo 1, oligo 3, oligo 4 and oligo 5 (150 pmol each) were phosphorylated by 10 units T4 PNK at 37°C for 2 h. The solution was buffer with 1 × ligation buffer (New England Biolabs, Ipswich, MA, USA). ..

    Northern Blot:

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Fifteen-microliter reactions were incubated with the indicated enzymes at 37°C (Terminator Exonuclease: 30°C) for 60 min, acid phenol/chloroform extracted, ethanol precipitated, and resuspended for the second round of enzyme treatments, which was again followed by acid phenol/chloroform extraction, ethanol precipitation, and resuspension in PAGE loading buffer for Northern blot. .. Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB).

    Cell Culture:

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Small RNA sequencing G. stearothermophilus was obtained from ATCC and cultured at 55 °C in nutrient broth (3 g beef extract and 5 g peptone per liter water, pH 6.8) to saturation. .. Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions.

    Sequencing:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: For BbsI compatibility, the sequence CACCG was added to the 5′ end (creating 5′-CACCG TAATTGTTCCAGATCTGACG-3′). .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: The sequencing reads were adapter trimmed using the FASTX-Toolkit (fastx_clipper -Q33 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -l 25 -c -n -v -i input_fastq_file) and inserts sized 25nt to 40nt were aligned to reference genome and analyzed as above. .. The fragmented RNA was end-repaired using T4-polynucletide kinase (T4-PNK; NEB, M0201) by adding 2µl T4-PNK 10X buffer, 2 µl T4-PNK and then incubating the reaction at 37°C for 2h.

    Recombinant:

    Article Title: Nucleotide Resolution Comparison of Transcription of Human Cytomegalovirus and Host Genomes Reveals Universal Use of RNA Polymerase II Elongation Control Driven by Dissimilar Core Promoter Elements
    Article Snippet: Finally, samples were incubated at 37°C for 1 h with 10 µl 2× recombinant SAP (rSAP) mix (0.1 U/µl recombinant shrimp alkaline phosphatase [NEB M0371], 2× CutSmart buffer, and 2 U/µl SUPERase-In). .. PRO-Seq samples were then incubated at 37°C for 1 h with 80 µl 5/4× T4 polynucleotide kinase (PNK) mix (0.313 U/µl T4 PNK [NEB M0201], 5/4× T4 PNK buffer, 1.25 mM ATP, and 0.625 U/µl SUPERase-In).

    Nucleic Acid Electrophoresis:

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Paragraph title: Capillary Gel Electrophoresis Analysis ... Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    RNA Sequencing Assay:

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Paragraph title: Small RNA sequencing ... Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions.

    RNA HS Assay:

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. After purification of the RNA samples using an RNeasy MinElute Column (Qiagen), the concentration of purified RNA was measured using the Qubit RNA HS assay kit (Invitrogen).

    Fluorescence:

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Capillary Gel Electrophoresis Analysis Enzyme modification of the DNA substrates was monitored using fluorescence capillary gel electrophoresis (CE) as described previously . .. Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: The gels were imaged directly through low fluorescence glass plates (CBS Scientific) using a Typhoon FLA 9000 (GE Healthcare Life Sciences). .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Isolation:

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: The recovered ribosome-bound RNA was isolated by using TRIzol and the remaining rRNAs were removed with the Ribo-Zero™ rRNA Removal Kit for Meta-bacteria. .. For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB).

    Article Title: Nucleotide Resolution Comparison of Transcription of Human Cytomegalovirus and Host Genomes Reveals Universal Use of RNA Polymerase II Elongation Control Driven by Dissimilar Core Promoter Elements
    Article Snippet: RNA was isolated with TRIzol LS and precipitated, and pellets were resuspended in 10 µl RNase-free H2 O, incubated at 65°C for 2 min, and snap-cooled on ice. .. PRO-Seq samples were then incubated at 37°C for 1 h with 80 µl 5/4× T4 polynucleotide kinase (PNK) mix (0.313 U/µl T4 PNK [NEB M0201], 5/4× T4 PNK buffer, 1.25 mM ATP, and 0.625 U/µl SUPERase-In).

    Subcloning:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: BsmBI sites (forward, 5′-TCCC-3′; reverse, 5′−AAAC-3′) were added to the CRISPR design to facilitate subcloning into the inducible vector (FgH1tUTG was a gift from Marco Herold [Addgene plasmid 70183]) ( ). .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Labeling:

    Article Title: CMV2b-Dependent Regulation of Host Defense Pathways in the Context of Viral Infection
    Article Snippet: .. The mixture of DNA oligonucleotides [ ] specific to CMV RNA3 labeled with [r-32 P] using T4 PNK (NEB, M0201V, Ipswich, MA, USA) was used as probe. .. RNA blotting signals were detected using ImageQuant TL 7.0 software (GE Healthcare, Cincinnati, OH, USA).

    Purification:

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. After purification of the RNA samples using an RNeasy MinElute Column (Qiagen), the concentration of purified RNA was measured using the Qubit RNA HS assay kit (Invitrogen).

    Article Title: Boronic acid-mediated polymerase chain reaction for gene- and fragment-specific detection of 5-hydroxymethylcytosine
    Article Snippet: Paragraph title: Design, synthesis and purification of X-ds100mers ... Firstly, oligo 1, oligo 3, oligo 4 and oligo 5 (150 pmol each) were phosphorylated by 10 units T4 PNK at 37°C for 2 h. The solution was buffer with 1 × ligation buffer (New England Biolabs, Ipswich, MA, USA).

    Polymerase Chain Reaction:

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions. .. The library was amplified with limited cycles of PCR, gel-extracted on an 8% native PAGE gel, and sequenced on an Illumina MiSeq.

    De-Phosphorylation Assay:

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: Paragraph title: hiCLIP (3′ end RNA dephosphorylation and 1st round of adaptor ligation) ... The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking.

    CRISPR:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: Paragraph title: CRISPR/Cas9 ... The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: BsmBI sites (forward, 5′-TCCC-3′; reverse, 5′−AAAC-3′) were added to the CRISPR design to facilitate subcloning into the inducible vector (FgH1tUTG was a gift from Marco Herold [Addgene plasmid 70183]) ( ). .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Chromatin Immunoprecipitation:

    Article Title: Simplified ChIP-exo assays
    Article Snippet: Paragraph title: ChIP-exo 3.0 and 3.1 (tagmentation-based version) ... The kinase reaction (30 µl) containing: 10 U T4 PNK (NEB), 1 × T4 DNA Ligase Buffer (NEB), and 2 × BSA was incubated for 15 min at 37 °C; then washed with 10 mM Tris-HCl, pH 8.0 at 4 °C.

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Small-guide RNAs (sgRNAs) were designed in silico (crispr.mit.edu) based on experimentally determined algorithms described previously by to be targeted at the promoter region or exon 5 and areas measured by ChIP primers. .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Plasmid Preparation:

    Article Title: Congressing kinetochores progressively load Ska complexes to prevent force-dependent detachment
    Article Snippet: Together, these modifications allow for scarless cloning into the pX330 vector. .. The oligos were phosphorylated and annealed by incubation with T4 PNK (New England Biolabs, Inc.) and T4 ligation buffer (New England Biolabs, Inc.; replacing the supplied PNK buffer).

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: BsmBI sites (forward, 5′-TCCC-3′; reverse, 5′−AAAC-3′) were added to the CRISPR design to facilitate subcloning into the inducible vector (FgH1tUTG was a gift from Marco Herold [Addgene plasmid 70183]) ( ). .. Oligos (100 μ M of both forward and reverse) were then phosphorylated with T4 PNK ligase according to manufacturer’s instructions (cat. no. M0201S; New England Biolabs, Ipswich, MA).

    Software:

    Article Title: CMV2b-Dependent Regulation of Host Defense Pathways in the Context of Viral Infection
    Article Snippet: The mixture of DNA oligonucleotides [ ] specific to CMV RNA3 labeled with [r-32 P] using T4 PNK (NEB, M0201V, Ipswich, MA, USA) was used as probe. .. RNA blotting signals were detected using ImageQuant TL 7.0 software (GE Healthcare, Cincinnati, OH, USA).

    Ethanol Precipitation:

    Article Title: Human tRNA-derived small RNAs in the global regulation of RNA silencing
    Article Snippet: Fifteen-microliter reactions were incubated with the indicated enzymes at 37°C (Terminator Exonuclease: 30°C) for 60 min, acid phenol/chloroform extracted, ethanol precipitated, and resuspended for the second round of enzyme treatments, which was again followed by acid phenol/chloroform extraction, ethanol precipitation, and resuspension in PAGE loading buffer for Northern blot. .. Amounts of enzymes used: 15 units (U) of T4 PNK, 3′ phophatase ± (NEB M0201/m0236); 8 U of Tobacco Acid Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase (PAP; Ambion); and 15 U T4 RNA ligase (NEB).

    Article Title: Library preparation for highly accurate population sequencing of RNA viruses
    Article Snippet: Glycogen, RNA grade (Thermo Scientific, cat. no. R0551) ▴ CRITICAL In our experience, glycogen from other vendors can result in lower yield of nucleic acids after ethanol precipitation. .. T4 polynucleotide kinase, 10,000 U/ml (New England Biolabs, cat. no. M0201S/L) T4 RNA ligase 1, 10,000 U/ml, supplied with 10× T4 RNA ligase buffer and 10 mM ATP (New England Biolabs, cat. no. M0204S/L) Phenol:chloroform:isoamyl alcohol (25:24:1; Invitrogen, cat. no. 15593-031) !

    Produced:

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: Alkaline hydrolysis ladders were produced by incubating 5 µL of RNA substrate (200 nM) in buffer with 5 µL of 50 mM bicarbonate buffer pH 9.2, 1 mM EDTA at 95 °C for 10 min. .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Concentration Assay:

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking. .. We ligated the RNA duplexes bound to STAU1 to an equimolar concentration of RNA adaptors A and B.

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA
    Article Snippet: Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only. .. Assays for 3′ A-tailing activity were carried out at 37 °C or 65 °C using annealed oligonucleotides in a final concentration of 0.5 µM and 2 units of Taq DNA pol, Klenow Fragment (3′-5′ exo− ) or Hemo KlenTaq (NEB) in 10 µl reaction in the presence of 1x NEBNext End Repair Buffer (NEB) or a 3′ A tailing buffer.

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth
    Article Snippet: For the phosphorylation reaction, samples were denatured at 80 °C for 90 s, equilibrated to 37 °C, and incubated at 37 °C for 1 h with 5 μL of 10× T4 PNK buffer (NEB), 20 U SUPERase-In RNase Inhibitor, and 10 U T4 PNK (NEB). .. After purification of the RNA samples using an RNeasy MinElute Column (Qiagen), the concentration of purified RNA was measured using the Qubit RNA HS assay kit (Invitrogen).

    Lysis:

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: The supernatant was discarded and the beads were resuspended in 20 μl of the PNK mix (4 μl 5× PNK pH 6.5 buffer, 0.5 μl T4 PNK (NEB, M0201), 0.5 μl RNasin, 0.5 μl SUPERaseIn, 14.5 μl water) and incubated at 37°C for 20 min with 1100 rpm shaking. .. The beads were washed once with PNK buffer and twice with PGB Cell Lysis Buffer (the last wash was rotated for at least 5 min in the cold room).

    Clear Native PAGE:

    Article Title: A thermostable Cas9 with increased lifetime in human plasma
    Article Snippet: Total RNA was treated with TURBO DNase (Thermo Fisher Scientific), rSAP (NEB), and T4 PNK (NEB) according to manufactures instructions. .. The library was amplified with limited cycles of PCR, gel-extracted on an 8% native PAGE gel, and sequenced on an Illumina MiSeq.

    Hood:

    Article Title: Library preparation for highly accurate population sequencing of RNA viruses
    Article Snippet: T4 polynucleotide kinase, 10,000 U/ml (New England Biolabs, cat. no. M0201S/L) T4 RNA ligase 1, 10,000 U/ml, supplied with 10× T4 RNA ligase buffer and 10 mM ATP (New England Biolabs, cat. no. M0204S/L) Phenol:chloroform:isoamyl alcohol (25:24:1; Invitrogen, cat. no. 15593-031) ! .. Wear personal protective equipment and handle it in a fume hood.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs t4 pnk
    yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or <t>T4</t> PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1
    T4 Pnk, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 pnk/product/New England Biolabs
    Average 95 stars, based on 148 article reviews
    Price from $9.99 to $1999.99
    t4 pnk - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1

    Journal: Nature Communications

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities

    doi: 10.1038/s41467-017-00484-w

    Figure Lengend Snippet: yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1

    Article Snippet: Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Techniques: In Vitro, Synthesized, Labeling, Incubation, Nuclear Magnetic Resonance

    PARP3 monoribosylates H2B in damaged chromatin. ( a , left) 10μg of the chicken chromatin employed in these experiments was fractionated by SDS–PAGE and stained with Coomassie blue. (right) One microgram of soluble MNase-treated chicken chromatin or 50-mer oligonucleotide duplex (200 nM) harbouring a nick with 3′-P/5′-OH termini was mock-treated (0) or treated with 1, 0.5 or 0.25 U T4 PNK to restore 3′-OH/5′-P termini. These DNA substrates were then incubated with 100 nM hPARP3 and 12.5 μM biotin-NAD + for 30 min and biotinylated products separated by 15% SDS–PAGE and detected with streptavidin-HRP. ( b ) 1 μg chicken chromatin or the indicated recombinant histone was incubated with 100 nM hPARP3 in the presence of 300 nM 32 P-NAD + or 12.5 μM biotin-NAD and oligonucleotide harbouring either a DSB (middle) or SSB (right) and the reaction products fractionated by 15% SDS–PAGE and detected by autoradiography or streptavidin-HRP. (left) An aliquot of the chicken chromatin and recombinant histones was fractionated by SDS–PAGE and stained with Coomassie blue. ( c , left) Aliquots of recombinant histone standards were fractionated separately or together as an octamer on triton-acid urea gels and analysed by staining with Coomassie blue. (right) The products of the PARP3 ribosylation reactions conducted in b were fractionated on triton-acid urea gels and analysed by autoradiography. HRP, horseradish peroxidase.

    Journal: Nature Communications

    Article Title: PARP3 is a sensor of nicked nucleosomes and monoribosylates histone H2BGlu2

    doi: 10.1038/ncomms12404

    Figure Lengend Snippet: PARP3 monoribosylates H2B in damaged chromatin. ( a , left) 10μg of the chicken chromatin employed in these experiments was fractionated by SDS–PAGE and stained with Coomassie blue. (right) One microgram of soluble MNase-treated chicken chromatin or 50-mer oligonucleotide duplex (200 nM) harbouring a nick with 3′-P/5′-OH termini was mock-treated (0) or treated with 1, 0.5 or 0.25 U T4 PNK to restore 3′-OH/5′-P termini. These DNA substrates were then incubated with 100 nM hPARP3 and 12.5 μM biotin-NAD + for 30 min and biotinylated products separated by 15% SDS–PAGE and detected with streptavidin-HRP. ( b ) 1 μg chicken chromatin or the indicated recombinant histone was incubated with 100 nM hPARP3 in the presence of 300 nM 32 P-NAD + or 12.5 μM biotin-NAD and oligonucleotide harbouring either a DSB (middle) or SSB (right) and the reaction products fractionated by 15% SDS–PAGE and detected by autoradiography or streptavidin-HRP. (left) An aliquot of the chicken chromatin and recombinant histones was fractionated by SDS–PAGE and stained with Coomassie blue. ( c , left) Aliquots of recombinant histone standards were fractionated separately or together as an octamer on triton-acid urea gels and analysed by staining with Coomassie blue. (right) The products of the PARP3 ribosylation reactions conducted in b were fractionated on triton-acid urea gels and analysed by autoradiography. HRP, horseradish peroxidase.

    Article Snippet: DNA from the MNase concentration that produced the greatest SSB/DSB ratio (0.015 U) was mock-treated or treated with T4 PNK in the presence of 2 mM ATP and 10U T4 PNK enzyme (wild-type or 3′-phosphatase dead; New England Biolabs).

    Techniques: SDS Page, Staining, Incubation, TNKS1 Histone Ribosylation Assay, Recombinant, Autoradiography

    Gka RloC’s ATPase activates its ACNase. Gka RloC’s ACNase of the IMAC fraction was assayed in vitro in panels ( A )–( C ) and ( E ) essentially as described in Materials and Methods but in the absence of added DNA. ( A ) Dependence of Gka RloC’s ACNase activity on ATP’s level. ( B ) Gka RloC’s ACNase activity was assayed in the presence of 500 µM of the indicated nucleotides. ( C ) Time courses of Gka RloC’s ACNase activity in the presence of 0.5 mM ATP and indicated amounts of AMPPNP. ( D ) In vivo ACNase activity of the indicated Gka RloC alleles. Left panel—RNA extracted from cells expressing these alleles was 5′-end labelled using T4 Pnk and separated by denaturing PAGE. Right panel—the expression of the indicated Gka RloC alleles were monitored by Western using an anti-His tag monoclonal antibody ( 4 ). ( E ) Nucleotide specificity of Gka RloC’s ACNase activation. The activation reaction was performed in the presence of the indicated nucleotides (GTP and ATP at 0.5 mM each, dTTP at 5 µM).

    Journal: Nucleic Acids Research

    Article Title: The wobble nucleotide-excising anticodon nuclease RloC is governed by the zinc-hook and DNA-dependent ATPase of its Rad50-like region

    doi: 10.1093/nar/gks593

    Figure Lengend Snippet: Gka RloC’s ATPase activates its ACNase. Gka RloC’s ACNase of the IMAC fraction was assayed in vitro in panels ( A )–( C ) and ( E ) essentially as described in Materials and Methods but in the absence of added DNA. ( A ) Dependence of Gka RloC’s ACNase activity on ATP’s level. ( B ) Gka RloC’s ACNase activity was assayed in the presence of 500 µM of the indicated nucleotides. ( C ) Time courses of Gka RloC’s ACNase activity in the presence of 0.5 mM ATP and indicated amounts of AMPPNP. ( D ) In vivo ACNase activity of the indicated Gka RloC alleles. Left panel—RNA extracted from cells expressing these alleles was 5′-end labelled using T4 Pnk and separated by denaturing PAGE. Right panel—the expression of the indicated Gka RloC alleles were monitored by Western using an anti-His tag monoclonal antibody ( 4 ). ( E ) Nucleotide specificity of Gka RloC’s ACNase activation. The activation reaction was performed in the presence of the indicated nucleotides (GTP and ATP at 0.5 mM each, dTTP at 5 µM).

    Article Snippet: Such a reaction performed in vitro and followed by T4 Pnk and Rnl1-mediated repair in the presence of [γ-32 P]ATP yielded the desired internally labelled sc-tRNAGlu(UUC) .

    Techniques: In Vitro, Activity Assay, In Vivo, Expressing, Polyacrylamide Gel Electrophoresis, Western Blot, Activation Assay