hiscribe  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    HiScribe T7 ARCA mRNA Kit
    Description:

    Catalog Number:
    E2065
    Price:
    328
    Category:
    Other Kits
    Applications:
    Functional Genomics
    Size:
    20 reactions
    Buy from Supplier


    Structured Review

    New England Biolabs hiscribe
    HiScribe T7 ARCA mRNA Kit

    https://www.bioz.com/result/hiscribe/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hiscribe - by Bioz Stars, 2021-09
    86/100 stars

    Images

    Related Articles

    In Vitro:

    Article Title: The RNA helicase DHX36–G4R1 modulates C9orf72 GGGGCC hexanucleotide repeat–associated translation
    Article Snippet: .. pcDNA3.1(+)/NLuc-3xF and pcDNA3.1(+)/FF were linearized by PspOMI and XbaI restriction enzymes, respectively, and recovered using DNA Clean and Concentrator-25 kits (Zymo Research; catalog no. D4033). m7 G-capped and polyadenylated RNAs were transcribed in vitro from these plasmids using HiScribe T7 ARCA mRNA Kit, with polyA tailing (NEB; catalog no. E2065S) following the manufacturer's instructions and recovered using RNA Clean and Concentrator-25 kits (Zymo Research; catalog no. R1017). ..

    Article Title: Promyelocytic leukemia nuclear body (PML-NB) -free intranuclear milieu facilitates development of oocytes in mice
    Article Snippet: .. Each plasmid, including v5-hPML VI and v5-hPML VI (K160, 490R), was diluted to a concentration of 5 ng/µL with Milli-Q water. mRNA preparation was conducted by BEX (Tokyo, Japan) by in vitro transcription from v5-hPML VI or v5-hPML VI (K160, 490R) using a HiScribeTM T7 ARCA mRNA Kit with tailing (New England Biolabs, Ipswich, MA, USA) and a MEGAclearTM Transcription Clean-Up Kit (Thermo Fisher Scientific). ..

    Article Title: MyD88/CD40 signaling retains CAR T cells in a less differentiated state
    Article Snippet: .. A guide RNA targeting the sequence GGGGGGCCGCTCACCCGCAA was selected using the online CRISPRscan scoring algorithm ( ) to maximize cutting efficiency and minimize off-target effects. sgRNA was generated using the HiScribe T7 In Vitro Transcription Kit (New England Biolabs). ..

    Article Title: Multiplexed detection of SARS-CoV-2 and other respiratory infections in high throughput by SARSeq
    Article Snippet: .. In vitro transcription was carried out using NEB HiScribe™ kit according to the manufacturer’s instructions. ..

    Article Title: The RNA helicase DHX36/G4R1 modulates C9orf72 GGGGCC repeat-associated translation
    Article Snippet: .. RNA synthesis pcDNA3.1(+)/NLuc-3xF and pcDNA3.1(+)/FF were linearized by PspOMI and XbaI restriction enzymes respectively and recovered using DNA Clean and Concentrator-25 kits (Zymo Research, Cat# D4033). m7G-capped and poly-adenylated RNAs were transcribed in vitro from these plasmids using HiScribe T7 ARCA mRNA Kit, with polyA tailing (NEB, Cat# E2065S) following the manufacturer’s instructions and recovered using RNA Clean and Concentrator-25 kits (Zymo Research, Cat# R1017). ..

    Expressing:

    Article Title: Parental genome unification is highly error-prone in mammalian embryos
    Article Snippet: .. Expression constructs, messenger RNA (mRNA) synthesis, protein expression and purification All mRNAs were synthesized using HiScribe T7 ARCA mRNA Kit (NEB # E2065S) following the manufacturer’s protocol and quantified using the Qubit RNA HS Assay Kit (Thermo Fisher Scientific # Q32852). mClover3-MAP4-MTBD, H2B-miRFP, H2B-mScarlet, and bTrim21 mRNAs were synthesized from previously published constructs ( ). ..

    Construct:

    Article Title: Parental genome unification is highly error-prone in mammalian embryos
    Article Snippet: .. Expression constructs, messenger RNA (mRNA) synthesis, protein expression and purification All mRNAs were synthesized using HiScribe T7 ARCA mRNA Kit (NEB # E2065S) following the manufacturer’s protocol and quantified using the Qubit RNA HS Assay Kit (Thermo Fisher Scientific # Q32852). mClover3-MAP4-MTBD, H2B-miRFP, H2B-mScarlet, and bTrim21 mRNAs were synthesized from previously published constructs ( ). ..

    Purification:

    Article Title: Parental genome unification is highly error-prone in mammalian embryos
    Article Snippet: .. Expression constructs, messenger RNA (mRNA) synthesis, protein expression and purification All mRNAs were synthesized using HiScribe T7 ARCA mRNA Kit (NEB # E2065S) following the manufacturer’s protocol and quantified using the Qubit RNA HS Assay Kit (Thermo Fisher Scientific # Q32852). mClover3-MAP4-MTBD, H2B-miRFP, H2B-mScarlet, and bTrim21 mRNAs were synthesized from previously published constructs ( ). ..

    Synthesized:

    Article Title: Parental genome unification is highly error-prone in mammalian embryos
    Article Snippet: .. Expression constructs, messenger RNA (mRNA) synthesis, protein expression and purification All mRNAs were synthesized using HiScribe T7 ARCA mRNA Kit (NEB # E2065S) following the manufacturer’s protocol and quantified using the Qubit RNA HS Assay Kit (Thermo Fisher Scientific # Q32852). mClover3-MAP4-MTBD, H2B-miRFP, H2B-mScarlet, and bTrim21 mRNAs were synthesized from previously published constructs ( ). ..

    RNA HS Assay:

    Article Title: Parental genome unification is highly error-prone in mammalian embryos
    Article Snippet: .. Expression constructs, messenger RNA (mRNA) synthesis, protein expression and purification All mRNAs were synthesized using HiScribe T7 ARCA mRNA Kit (NEB # E2065S) following the manufacturer’s protocol and quantified using the Qubit RNA HS Assay Kit (Thermo Fisher Scientific # Q32852). mClover3-MAP4-MTBD, H2B-miRFP, H2B-mScarlet, and bTrim21 mRNAs were synthesized from previously published constructs ( ). ..

    Plasmid Preparation:

    Article Title: Promyelocytic leukemia nuclear body (PML-NB) -free intranuclear milieu facilitates development of oocytes in mice
    Article Snippet: .. Each plasmid, including v5-hPML VI and v5-hPML VI (K160, 490R), was diluted to a concentration of 5 ng/µL with Milli-Q water. mRNA preparation was conducted by BEX (Tokyo, Japan) by in vitro transcription from v5-hPML VI or v5-hPML VI (K160, 490R) using a HiScribeTM T7 ARCA mRNA Kit with tailing (New England Biolabs, Ipswich, MA, USA) and a MEGAclearTM Transcription Clean-Up Kit (Thermo Fisher Scientific). ..

    Concentration Assay:

    Article Title: Promyelocytic leukemia nuclear body (PML-NB) -free intranuclear milieu facilitates development of oocytes in mice
    Article Snippet: .. Each plasmid, including v5-hPML VI and v5-hPML VI (K160, 490R), was diluted to a concentration of 5 ng/µL with Milli-Q water. mRNA preparation was conducted by BEX (Tokyo, Japan) by in vitro transcription from v5-hPML VI or v5-hPML VI (K160, 490R) using a HiScribeTM T7 ARCA mRNA Kit with tailing (New England Biolabs, Ipswich, MA, USA) and a MEGAclearTM Transcription Clean-Up Kit (Thermo Fisher Scientific). ..

    Sequencing:

    Article Title: MyD88/CD40 signaling retains CAR T cells in a less differentiated state
    Article Snippet: .. A guide RNA targeting the sequence GGGGGGCCGCTCACCCGCAA was selected using the online CRISPRscan scoring algorithm ( ) to maximize cutting efficiency and minimize off-target effects. sgRNA was generated using the HiScribe T7 In Vitro Transcription Kit (New England Biolabs). ..

    Generated:

    Article Title: MyD88/CD40 signaling retains CAR T cells in a less differentiated state
    Article Snippet: .. A guide RNA targeting the sequence GGGGGGCCGCTCACCCGCAA was selected using the online CRISPRscan scoring algorithm ( ) to maximize cutting efficiency and minimize off-target effects. sgRNA was generated using the HiScribe T7 In Vitro Transcription Kit (New England Biolabs). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs hiscribe sp6 rna synthesis kit
    Analysis of <t>SP6</t> promoter sequences. a 5 ′ RACE-seq using SP6 polymerase. Normalized average nucleotide composition from position +2 to +16 in <t>RNA</t> transcribed by SP6 RNA polymerase from a randomized SP6 promoter library. Substantial sequence preference was observed until the +3 nucleotide position. b Box plot showing relative abundances of +2 to +16 SP6 promoter variants detected in 5 ′ RACE-seq, separated by +2/3 dinucleotide sequence. All variants have a G at +1. Promoters with +1 to +3 GAA showed highest activity. Each whisker plot represents 948–985 +1 to +8 motifs, dependent on homopolymer filtering. Whiskers reach to 1.5× IQR away from the 1st/3rd quartile. c IVT using high ranking +2 to +8 SP6 promoter variants with the indicated +2/3 dinucleotides. The +2/3 dinucleotide sequence appeared as main determinant of SP6 transcriptional activity. d IVT using SP6 promoter templates harboring +1 to +3 GAA followed by +4 to +8 sequence motifs of varying 5 ′ RACE-seq rank. IVT was performed for 2 h. Shown is the resulting fold amplification of the template DNA. Sequence elements after +4 showed no effects on SP6 promoter activity. All error bars represent standard deviation for triplicate experiments.
    Hiscribe Sp6 Rna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiscribe sp6 rna synthesis kit/product/New England Biolabs
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hiscribe sp6 rna synthesis kit - by Bioz Stars, 2021-09
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs t7 quick high yield rna synthesis kit
    The effect of long ssRNA on dsDNA extension at low force (e.g. Figure 2B ) is dependent on concentration, homology, and length. Box-and-whisker plots (see Materials and Methods) show the slopes of the low force–extension curves (Figure 2B ) of the indicated samples. ( A ) <t>DNA:RNA</t> molar ratio was varied from 1:1 to 1:10 5 . Statistical analysis (asterisks) compared 1:1 versus all other ratios. ( B ) The effects of non-homologous ssRNA controls. Fluc is a 1766-nt control transcript provided in the <t>T7</t> Quick High Yield RNA Synthesis Kit, showing 43% identity with the 37 441–39 524 region of the genome of λ dsDNA. Y-RNA is the total RNA of S. cerevisiae strain. For 6KM13, bacteriophage M13mp18 circular ssDNA ∼7200 nt was amplified as the template for in vitro transcription. The resulting ssRNA is 6001 nt and presents 44% identity with the genome of λ dsDNA (region 22 893–31 255). 6L and 6H are ∼6k nt species homologous to adjacent regions of λ dsDNA (Figure 1B ). DNA:RNA molar ratio = 1:1000 in all samples; statistical analysis was performed for the ratio of λ dsDNA alone versus all other ratios. ( C ) The effects of various lengths of ssRNA (described in Figure 1B ), DNA:RNA molar ratio = 1:1000. (a, b, c) n = 10, * P
    T7 Quick High Yield Rna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 quick high yield rna synthesis kit/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t7 quick high yield rna synthesis kit - by Bioz Stars, 2021-09
    99/100 stars
      Buy from Supplier

    95
    New England Biolabs hchrr6 mrna in vitro
    Schematic of IVT EXO-DEPT preparation and use, involving several steps. (1) Generation of in vitro transcribed (IVT) <t>HChrR6</t> mRNA. (2) Its transfection into HEK293 cells in the presence of Polyethylenimine. (3) Confirmation that extracellular vesicles (EVs) generated by loaded HEK293 producer cells contain HChrR6 mRNA. (4) Conversion of loaded EVs into IVT EXO-DEPTs by incubation with purified EVHB protein. (5) IVT EXO-DEPT-mediated delivery of HChrR6 mRNA to BT474 cells. (6) Addition of the prodrug CNOB or CB1954/Tretazicar. (7) Prodrug conversion within the cells into the drug. (8) Cell death.
    Hchrr6 Mrna In Vitro, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hchrr6 mrna in vitro/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hchrr6 mrna in vitro - by Bioz Stars, 2021-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    Analysis of SP6 promoter sequences. a 5 ′ RACE-seq using SP6 polymerase. Normalized average nucleotide composition from position +2 to +16 in RNA transcribed by SP6 RNA polymerase from a randomized SP6 promoter library. Substantial sequence preference was observed until the +3 nucleotide position. b Box plot showing relative abundances of +2 to +16 SP6 promoter variants detected in 5 ′ RACE-seq, separated by +2/3 dinucleotide sequence. All variants have a G at +1. Promoters with +1 to +3 GAA showed highest activity. Each whisker plot represents 948–985 +1 to +8 motifs, dependent on homopolymer filtering. Whiskers reach to 1.5× IQR away from the 1st/3rd quartile. c IVT using high ranking +2 to +8 SP6 promoter variants with the indicated +2/3 dinucleotides. The +2/3 dinucleotide sequence appeared as main determinant of SP6 transcriptional activity. d IVT using SP6 promoter templates harboring +1 to +3 GAA followed by +4 to +8 sequence motifs of varying 5 ′ RACE-seq rank. IVT was performed for 2 h. Shown is the resulting fold amplification of the template DNA. Sequence elements after +4 showed no effects on SP6 promoter activity. All error bars represent standard deviation for triplicate experiments.

    Journal: Communications Biology

    Article Title: Maximizing transcription of nucleic acids with efficient T7 promoters

    doi: 10.1038/s42003-020-01167-x

    Figure Lengend Snippet: Analysis of SP6 promoter sequences. a 5 ′ RACE-seq using SP6 polymerase. Normalized average nucleotide composition from position +2 to +16 in RNA transcribed by SP6 RNA polymerase from a randomized SP6 promoter library. Substantial sequence preference was observed until the +3 nucleotide position. b Box plot showing relative abundances of +2 to +16 SP6 promoter variants detected in 5 ′ RACE-seq, separated by +2/3 dinucleotide sequence. All variants have a G at +1. Promoters with +1 to +3 GAA showed highest activity. Each whisker plot represents 948–985 +1 to +8 motifs, dependent on homopolymer filtering. Whiskers reach to 1.5× IQR away from the 1st/3rd quartile. c IVT using high ranking +2 to +8 SP6 promoter variants with the indicated +2/3 dinucleotides. The +2/3 dinucleotide sequence appeared as main determinant of SP6 transcriptional activity. d IVT using SP6 promoter templates harboring +1 to +3 GAA followed by +4 to +8 sequence motifs of varying 5 ′ RACE-seq rank. IVT was performed for 2 h. Shown is the resulting fold amplification of the template DNA. Sequence elements after +4 showed no effects on SP6 promoter activity. All error bars represent standard deviation for triplicate experiments.

    Article Snippet: Generation of 5′ RACE-seq libraries Totally, 10 ng of dsDNA template (T7_15N/SP6_15N) containing a T7/SP6 RNA polymerase promoter randomized from position +2 to +16 (gBlocks Gene Fragments, Integrated DNA Technologies) was used as input for IVT in a 20 µl reaction using 1.5 µl T7 or T6 RNA polymerase mix and 7.5 mM each of GTP, ATP, CTP, and UTP from the HiScribe T7/SP6 RNA Synthesis Kit (NEB E2040S, E2070S).

    Techniques: Sequencing, Activity Assay, Whisker Assay, Amplification, Standard Deviation

    The effect of long ssRNA on dsDNA extension at low force (e.g. Figure 2B ) is dependent on concentration, homology, and length. Box-and-whisker plots (see Materials and Methods) show the slopes of the low force–extension curves (Figure 2B ) of the indicated samples. ( A ) DNA:RNA molar ratio was varied from 1:1 to 1:10 5 . Statistical analysis (asterisks) compared 1:1 versus all other ratios. ( B ) The effects of non-homologous ssRNA controls. Fluc is a 1766-nt control transcript provided in the T7 Quick High Yield RNA Synthesis Kit, showing 43% identity with the 37 441–39 524 region of the genome of λ dsDNA. Y-RNA is the total RNA of S. cerevisiae strain. For 6KM13, bacteriophage M13mp18 circular ssDNA ∼7200 nt was amplified as the template for in vitro transcription. The resulting ssRNA is 6001 nt and presents 44% identity with the genome of λ dsDNA (region 22 893–31 255). 6L and 6H are ∼6k nt species homologous to adjacent regions of λ dsDNA (Figure 1B ). DNA:RNA molar ratio = 1:1000 in all samples; statistical analysis was performed for the ratio of λ dsDNA alone versus all other ratios. ( C ) The effects of various lengths of ssRNA (described in Figure 1B ), DNA:RNA molar ratio = 1:1000. (a, b, c) n = 10, * P

    Journal: Nucleic Acids Research

    Article Title: Single molecule identification of homology-dependent interactions between long ssRNA and dsDNA

    doi: 10.1093/nar/gkw758

    Figure Lengend Snippet: The effect of long ssRNA on dsDNA extension at low force (e.g. Figure 2B ) is dependent on concentration, homology, and length. Box-and-whisker plots (see Materials and Methods) show the slopes of the low force–extension curves (Figure 2B ) of the indicated samples. ( A ) DNA:RNA molar ratio was varied from 1:1 to 1:10 5 . Statistical analysis (asterisks) compared 1:1 versus all other ratios. ( B ) The effects of non-homologous ssRNA controls. Fluc is a 1766-nt control transcript provided in the T7 Quick High Yield RNA Synthesis Kit, showing 43% identity with the 37 441–39 524 region of the genome of λ dsDNA. Y-RNA is the total RNA of S. cerevisiae strain. For 6KM13, bacteriophage M13mp18 circular ssDNA ∼7200 nt was amplified as the template for in vitro transcription. The resulting ssRNA is 6001 nt and presents 44% identity with the genome of λ dsDNA (region 22 893–31 255). 6L and 6H are ∼6k nt species homologous to adjacent regions of λ dsDNA (Figure 1B ). DNA:RNA molar ratio = 1:1000 in all samples; statistical analysis was performed for the ratio of λ dsDNA alone versus all other ratios. ( C ) The effects of various lengths of ssRNA (described in Figure 1B ), DNA:RNA molar ratio = 1:1000. (a, b, c) n = 10, * P

    Article Snippet: Other RNAs (Figure ) were transcribed in vitro using T7 Quick High Yield RNA Synthesis Kit (NEB) and DNA templates prepared by amplification with Crimson LongAmp® Taq DNA polymerase (NEB).

    Techniques: Concentration Assay, Whisker Assay, Amplification, In Vitro

    Schematic of IVT EXO-DEPT preparation and use, involving several steps. (1) Generation of in vitro transcribed (IVT) HChrR6 mRNA. (2) Its transfection into HEK293 cells in the presence of Polyethylenimine. (3) Confirmation that extracellular vesicles (EVs) generated by loaded HEK293 producer cells contain HChrR6 mRNA. (4) Conversion of loaded EVs into IVT EXO-DEPTs by incubation with purified EVHB protein. (5) IVT EXO-DEPT-mediated delivery of HChrR6 mRNA to BT474 cells. (6) Addition of the prodrug CNOB or CB1954/Tretazicar. (7) Prodrug conversion within the cells into the drug. (8) Cell death.

    Journal: Molecular cancer therapeutics

    Article Title: Extracellular vesicle-mediated in vitro transcribed mRNA delivery for treatment of HER2+ breast cancer xenografts in mice by prodrug CB1954 without general toxicity

    doi: 10.1158/1535-7163.MCT-19-0928

    Figure Lengend Snippet: Schematic of IVT EXO-DEPT preparation and use, involving several steps. (1) Generation of in vitro transcribed (IVT) HChrR6 mRNA. (2) Its transfection into HEK293 cells in the presence of Polyethylenimine. (3) Confirmation that extracellular vesicles (EVs) generated by loaded HEK293 producer cells contain HChrR6 mRNA. (4) Conversion of loaded EVs into IVT EXO-DEPTs by incubation with purified EVHB protein. (5) IVT EXO-DEPT-mediated delivery of HChrR6 mRNA to BT474 cells. (6) Addition of the prodrug CNOB or CB1954/Tretazicar. (7) Prodrug conversion within the cells into the drug. (8) Cell death.

    Article Snippet: To generate IVT mRNA, the HChrR6 gene was extracted from puC57-HChrR6, using KpnI ( , , ) and was cloned into pcDNA™6/myc-HisA (ThermoFisher); in-frame insertion was confirmed (Stanford University Protein and Nucleic Acid Facility). pcDNA™6/myc-HisA-SHChrR6 was used to transcribe HChrR6 mRNA in vitro (HiScribe™ T7 ARCA mRNA Kit with tailing; New England Biolabs, Ipswich, MA). mRNA was quantified (NanoDrop 1000 Spectrophotometer; Thermo Fisher; Wilmington, DE) and used to synthesize cDNA (M-MuLV reverse transcriptase, New England Biolabs); RNaseH treatment (New England Biolabs) removed any remaining mRNA.

    Techniques: In Vitro, Transfection, Generated, Incubation, Purification

    Comparative efficacy of IVT- and P EXO-DEPTs. Comparison of the kinetics of HChrR6 gene expression by BT474 cells (10 4 ) receiving the HChrR6 mRNA by IVT EXO-DEPTs (red bars) or by P EXO-DEPTs (blue bars), as determined by the MCHB test. The number of the two kinds of the EVs was adjusted to deliver 10 4 mRNA copies. This required 3×10 5 IVT- and 5×10 7 P EXO-DEPTs (* p

    Journal: Molecular cancer therapeutics

    Article Title: Extracellular vesicle-mediated in vitro transcribed mRNA delivery for treatment of HER2+ breast cancer xenografts in mice by prodrug CB1954 without general toxicity

    doi: 10.1158/1535-7163.MCT-19-0928

    Figure Lengend Snippet: Comparative efficacy of IVT- and P EXO-DEPTs. Comparison of the kinetics of HChrR6 gene expression by BT474 cells (10 4 ) receiving the HChrR6 mRNA by IVT EXO-DEPTs (red bars) or by P EXO-DEPTs (blue bars), as determined by the MCHB test. The number of the two kinds of the EVs was adjusted to deliver 10 4 mRNA copies. This required 3×10 5 IVT- and 5×10 7 P EXO-DEPTs (* p

    Article Snippet: To generate IVT mRNA, the HChrR6 gene was extracted from puC57-HChrR6, using KpnI ( , , ) and was cloned into pcDNA™6/myc-HisA (ThermoFisher); in-frame insertion was confirmed (Stanford University Protein and Nucleic Acid Facility). pcDNA™6/myc-HisA-SHChrR6 was used to transcribe HChrR6 mRNA in vitro (HiScribe™ T7 ARCA mRNA Kit with tailing; New England Biolabs, Ipswich, MA). mRNA was quantified (NanoDrop 1000 Spectrophotometer; Thermo Fisher; Wilmington, DE) and used to synthesize cDNA (M-MuLV reverse transcriptase, New England Biolabs); RNaseH treatment (New England Biolabs) removed any remaining mRNA.

    Techniques: Expressing

    A. IVT EXO-DEPTs interaction with HER2 + BT474 cells and HChrR6 mRNA delivery. Flow cytometry results of 1.62 × 10 6 BT474 cells incubated for 6-hours (upper panels), or 24-hours (lower panels) with PKH26-labeled (red) or unlabeled (yellow) 5 × 10 10 IVT EXO-DEPTs. At 6-hours, 0.6% cells bounded the EVs (red; upper right panel); at 24 hours this number increases to 80% (lower right panel) (n=3). B. HChrR6 mRNA copy number in BT474 cells after 6-hour incubation with IVT EXO-DEPTs (red bar). No HChrR6 mRNA was detected in BT474 cells incubated for the same duration with directed EVs not containing the IVT mRNA (* p

    Journal: Molecular cancer therapeutics

    Article Title: Extracellular vesicle-mediated in vitro transcribed mRNA delivery for treatment of HER2+ breast cancer xenografts in mice by prodrug CB1954 without general toxicity

    doi: 10.1158/1535-7163.MCT-19-0928

    Figure Lengend Snippet: A. IVT EXO-DEPTs interaction with HER2 + BT474 cells and HChrR6 mRNA delivery. Flow cytometry results of 1.62 × 10 6 BT474 cells incubated for 6-hours (upper panels), or 24-hours (lower panels) with PKH26-labeled (red) or unlabeled (yellow) 5 × 10 10 IVT EXO-DEPTs. At 6-hours, 0.6% cells bounded the EVs (red; upper right panel); at 24 hours this number increases to 80% (lower right panel) (n=3). B. HChrR6 mRNA copy number in BT474 cells after 6-hour incubation with IVT EXO-DEPTs (red bar). No HChrR6 mRNA was detected in BT474 cells incubated for the same duration with directed EVs not containing the IVT mRNA (* p

    Article Snippet: To generate IVT mRNA, the HChrR6 gene was extracted from puC57-HChrR6, using KpnI ( , , ) and was cloned into pcDNA™6/myc-HisA (ThermoFisher); in-frame insertion was confirmed (Stanford University Protein and Nucleic Acid Facility). pcDNA™6/myc-HisA-SHChrR6 was used to transcribe HChrR6 mRNA in vitro (HiScribe™ T7 ARCA mRNA Kit with tailing; New England Biolabs, Ipswich, MA). mRNA was quantified (NanoDrop 1000 Spectrophotometer; Thermo Fisher; Wilmington, DE) and used to synthesize cDNA (M-MuLV reverse transcriptase, New England Biolabs); RNaseH treatment (New England Biolabs) removed any remaining mRNA.

    Techniques: Flow Cytometry, Incubation, Labeling

    In vitro transcribed (IVT) HChrR6 mRNA functionality and its amount in IVT EXO-DEPTs. A. Test of the functionality of IVT HChrR6 mRNA. Its translated product converts CNOB into MCHB as measured from MCHB fluorescence. Increasing amounts of the translated HChrR6 mRNA protein (quantified by Bradford assay) generated increasing fluorescence (n=3). Numbers in the abscissa denote: 1. PBS; 2. CNOB 15µM; 3. NADPH 1mM; 4. full reaction mix (Rx) without HChrR6 protein. (CNOB was 15µM, NADPH, 1mM); 5. Rx + 2.5 ng protein; 6. Rx + 5 ng protein; 7. Rx + 10 ng protein; 8. Rx + 20 ng protein; 9. Rx + 40 ng protein; 10. Rx + 80 ng protein; 11. Rx + 160 ng protein. B. The IVT EXO-DEPTs contain more HChrR6 mRNA compared to P EXO-DEPTs:

    Journal: Molecular cancer therapeutics

    Article Title: Extracellular vesicle-mediated in vitro transcribed mRNA delivery for treatment of HER2+ breast cancer xenografts in mice by prodrug CB1954 without general toxicity

    doi: 10.1158/1535-7163.MCT-19-0928

    Figure Lengend Snippet: In vitro transcribed (IVT) HChrR6 mRNA functionality and its amount in IVT EXO-DEPTs. A. Test of the functionality of IVT HChrR6 mRNA. Its translated product converts CNOB into MCHB as measured from MCHB fluorescence. Increasing amounts of the translated HChrR6 mRNA protein (quantified by Bradford assay) generated increasing fluorescence (n=3). Numbers in the abscissa denote: 1. PBS; 2. CNOB 15µM; 3. NADPH 1mM; 4. full reaction mix (Rx) without HChrR6 protein. (CNOB was 15µM, NADPH, 1mM); 5. Rx + 2.5 ng protein; 6. Rx + 5 ng protein; 7. Rx + 10 ng protein; 8. Rx + 20 ng protein; 9. Rx + 40 ng protein; 10. Rx + 80 ng protein; 11. Rx + 160 ng protein. B. The IVT EXO-DEPTs contain more HChrR6 mRNA compared to P EXO-DEPTs:

    Article Snippet: To generate IVT mRNA, the HChrR6 gene was extracted from puC57-HChrR6, using KpnI ( , , ) and was cloned into pcDNA™6/myc-HisA (ThermoFisher); in-frame insertion was confirmed (Stanford University Protein and Nucleic Acid Facility). pcDNA™6/myc-HisA-SHChrR6 was used to transcribe HChrR6 mRNA in vitro (HiScribe™ T7 ARCA mRNA Kit with tailing; New England Biolabs, Ipswich, MA). mRNA was quantified (NanoDrop 1000 Spectrophotometer; Thermo Fisher; Wilmington, DE) and used to synthesize cDNA (M-MuLV reverse transcriptase, New England Biolabs); RNaseH treatment (New England Biolabs) removed any remaining mRNA.

    Techniques: In Vitro, Fluorescence, Bradford Assay, Generated