polypyrimidine tract binding protein ptb  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs polypyrimidine tract binding protein ptb
    HaloTag based GoldCLIP technology A. Schematic flow chart of GoldCLIP technology. Cells stably expressing Halo-tagged fusion RBPs are crosslinked by UV irradiation. After cell lysis, Halo-RBP complexes are then captured by magnetic beads coated with Halo ligand under native conditions and a specific 3′ linker is ligated to RNAs bound by RBPs. Following denaturing washes, purified RNAs are cloned via an iCLIP protocol for high-throughput sequencing. B. Western blot analysis showing the expression level of <t>Halo-PTB</t> in the HEK 293T Halo-PTB stable cells compared to endogenous PTB using a monoclonal anti-PTB antibody (BB7). Non-transfected HEK 293T cells are used as control. A diagram of Halo-PTB fusion protein is shown below. C. Localization of Halo-PTB fusion proteins in 293T cell line. HaloTag TMR ligand staining of Halo-PTB fusion protein is shown in the top panel, and immunofluorescent staining of endogenous PTB using a monoclonal PTB antibody (BB7) is shown in the bottom panel. RBP, RNA-binding protein; iCLIP, individual-nucleotide resolution CLIP; PTB, <t>polypyrimidine</t> tract-binding protein; TMR, tetramethylrhodamine; TEV, tobacco etch virus.
    Polypyrimidine Tract Binding Protein Ptb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 126 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polypyrimidine tract binding protein ptb/product/New England Biolabs
    Average 92 stars, based on 126 article reviews
    Price from $9.99 to $1999.99
    polypyrimidine tract binding protein ptb - by Bioz Stars, 2020-05
    92/100 stars

    Images

    1) Product Images from "GoldCLIP: Gel-omitted Ligation-dependent CLIP"

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP

    Journal: Genomics, Proteomics & Bioinformatics

    doi: 10.1016/j.gpb.2018.04.003

    HaloTag based GoldCLIP technology A. Schematic flow chart of GoldCLIP technology. Cells stably expressing Halo-tagged fusion RBPs are crosslinked by UV irradiation. After cell lysis, Halo-RBP complexes are then captured by magnetic beads coated with Halo ligand under native conditions and a specific 3′ linker is ligated to RNAs bound by RBPs. Following denaturing washes, purified RNAs are cloned via an iCLIP protocol for high-throughput sequencing. B. Western blot analysis showing the expression level of Halo-PTB in the HEK 293T Halo-PTB stable cells compared to endogenous PTB using a monoclonal anti-PTB antibody (BB7). Non-transfected HEK 293T cells are used as control. A diagram of Halo-PTB fusion protein is shown below. C. Localization of Halo-PTB fusion proteins in 293T cell line. HaloTag TMR ligand staining of Halo-PTB fusion protein is shown in the top panel, and immunofluorescent staining of endogenous PTB using a monoclonal PTB antibody (BB7) is shown in the bottom panel. RBP, RNA-binding protein; iCLIP, individual-nucleotide resolution CLIP; PTB, polypyrimidine tract-binding protein; TMR, tetramethylrhodamine; TEV, tobacco etch virus.
    Figure Legend Snippet: HaloTag based GoldCLIP technology A. Schematic flow chart of GoldCLIP technology. Cells stably expressing Halo-tagged fusion RBPs are crosslinked by UV irradiation. After cell lysis, Halo-RBP complexes are then captured by magnetic beads coated with Halo ligand under native conditions and a specific 3′ linker is ligated to RNAs bound by RBPs. Following denaturing washes, purified RNAs are cloned via an iCLIP protocol for high-throughput sequencing. B. Western blot analysis showing the expression level of Halo-PTB in the HEK 293T Halo-PTB stable cells compared to endogenous PTB using a monoclonal anti-PTB antibody (BB7). Non-transfected HEK 293T cells are used as control. A diagram of Halo-PTB fusion protein is shown below. C. Localization of Halo-PTB fusion proteins in 293T cell line. HaloTag TMR ligand staining of Halo-PTB fusion protein is shown in the top panel, and immunofluorescent staining of endogenous PTB using a monoclonal PTB antibody (BB7) is shown in the bottom panel. RBP, RNA-binding protein; iCLIP, individual-nucleotide resolution CLIP; PTB, polypyrimidine tract-binding protein; TMR, tetramethylrhodamine; TEV, tobacco etch virus.

    Techniques Used: Flow Cytometry, Stable Transfection, Expressing, Irradiation, Lysis, Magnetic Beads, Purification, Clone Assay, Next-Generation Sequencing, Western Blot, Transfection, Staining, RNA Binding Assay, Cross-linking Immunoprecipitation, Binding Assay

    2) Product Images from "miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2"

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-017-0045-0

    siRNAs targeting IGF2BP2 imitate the effects of overexpressed miR-181a-5p on HTR-8/SVneo cell invasion and migration a Transfection of IGF2BP2 siRNA significantly reduced HTR-8/SVneo cell invasion and migration, with effects similar to those of miR-181a-5p overexpression. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after siRNA transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. c Ectopic-expression of IGF2BP2 significantly promoted HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. d The IGF2BP2 mRNA/protein levels were examined after plasmid transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. * P
    Figure Legend Snippet: siRNAs targeting IGF2BP2 imitate the effects of overexpressed miR-181a-5p on HTR-8/SVneo cell invasion and migration a Transfection of IGF2BP2 siRNA significantly reduced HTR-8/SVneo cell invasion and migration, with effects similar to those of miR-181a-5p overexpression. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after siRNA transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. c Ectopic-expression of IGF2BP2 significantly promoted HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. d The IGF2BP2 mRNA/protein levels were examined after plasmid transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. * P

    Techniques Used: Migration, Transfection, Over Expression, Western Blot, Molecular Weight, Expressing, Plasmid Preparation

    miR-181a-5p suppresses HTR-8/SVneo cell invasion and migration via directly inhibiting IGF2BP2 a Restoring IGF2BP2 expression partially reversed the inhibitory effects of miR-181a-5p on HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after IGF2BP2 restoration. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. The values with diverse letters are significantly different ( P
    Figure Legend Snippet: miR-181a-5p suppresses HTR-8/SVneo cell invasion and migration via directly inhibiting IGF2BP2 a Restoring IGF2BP2 expression partially reversed the inhibitory effects of miR-181a-5p on HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after IGF2BP2 restoration. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. The values with diverse letters are significantly different ( P

    Techniques Used: Migration, Expressing, Western Blot, Molecular Weight

    miR-181a-5p expression in human placentas and human trophoblast cells a Differential miR-181a-5p expression in severe pre-eclamptic placentas ( n = 10) and normal placentas ( n = 10) was assessed by qRT-PCR. b miR-181a-5p expression in three trophoblast cell lines, with the highest expression observed in JEG-3 cells and the lowest expression observed in HTR-8/SVneo cells. c Invasion and migration capacities of the three tested trophoblast cell lines. JEG-3 cells had significantly lower invasion/migration capacities than HTR-8/SVneo and JAR cells. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. # The JEG-3 cells applied in invasion/migration assays were two-fold more than HTR-8/SVneo and JAR cells, as its weak invasion/migration capacities. The results are expressed as the mean ± SD based on at least three independent experiments. ** P
    Figure Legend Snippet: miR-181a-5p expression in human placentas and human trophoblast cells a Differential miR-181a-5p expression in severe pre-eclamptic placentas ( n = 10) and normal placentas ( n = 10) was assessed by qRT-PCR. b miR-181a-5p expression in three trophoblast cell lines, with the highest expression observed in JEG-3 cells and the lowest expression observed in HTR-8/SVneo cells. c Invasion and migration capacities of the three tested trophoblast cell lines. JEG-3 cells had significantly lower invasion/migration capacities than HTR-8/SVneo and JAR cells. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. # The JEG-3 cells applied in invasion/migration assays were two-fold more than HTR-8/SVneo and JAR cells, as its weak invasion/migration capacities. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Techniques Used: Expressing, Quantitative RT-PCR, Migration

    miR-181a-5p suppresses HTR-8/SVneo cell invasion and migration a , b HTR-8/SVneo cell invasion and migration were inhibited upon transfection of miR-181a-5p mimic a , and enhanced upon transfection of miR-181a-5p inhibitor b . Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. c , d Transfected cells were subjected to CCK-8 assays in parallel with transwell assays in the presence/absence of Matrigel, and the changes in cell number at 0, 24, 48, and 72 h were measured. e , f Ectopic-expression and inhibition of miR-181a-5p were confirmed by qRT-PCR. The results are expressed as the mean ± SD based on at least three independent experiments. ** P
    Figure Legend Snippet: miR-181a-5p suppresses HTR-8/SVneo cell invasion and migration a , b HTR-8/SVneo cell invasion and migration were inhibited upon transfection of miR-181a-5p mimic a , and enhanced upon transfection of miR-181a-5p inhibitor b . Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. c , d Transfected cells were subjected to CCK-8 assays in parallel with transwell assays in the presence/absence of Matrigel, and the changes in cell number at 0, 24, 48, and 72 h were measured. e , f Ectopic-expression and inhibition of miR-181a-5p were confirmed by qRT-PCR. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Techniques Used: Migration, Transfection, CCK-8 Assay, Expressing, Inhibition, Quantitative RT-PCR

    A miR-181a-5p binding site exists in the 3ʹ-UTR of IGF2BP2 mRNA a Two putative miR-181a-5p binding sites are shown in the 3ʹ-UTR of IGF2BP2 mRNA. b , c The luciferase activities of reporter vectors containing either the WT or the M1/M2 mutant 3ʹ-UTR were measured in the presence of miR-181a-5p mimic or inhibitor. The results are expressed as the mean ± SD based on at least three independent experiments. ** P
    Figure Legend Snippet: A miR-181a-5p binding site exists in the 3ʹ-UTR of IGF2BP2 mRNA a Two putative miR-181a-5p binding sites are shown in the 3ʹ-UTR of IGF2BP2 mRNA. b , c The luciferase activities of reporter vectors containing either the WT or the M1/M2 mutant 3ʹ-UTR were measured in the presence of miR-181a-5p mimic or inhibitor. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Techniques Used: Binding Assay, Luciferase, Mutagenesis

    IGF2BP2 is directly inhibited by miR-181a-5p a Construction of a pGL3-Control luciferase vector containing the full-length IGF2BP2 3ʹ-UTR. b The effects of miR-181a-5p mimic and inhibitor on the luciferase activity of the IGF2BP2 WT 3ʹ-UTR reporter were measured. c The IGF2BP2 mRNA and protein levels were both diminished by miR-181a-5p overexpression in HTR-8/SVneo cells. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. d The IGF2BP2 mRNA and protein levels were both elevated upon treatment of the miR-181a-5p inhibitor in HTR-8/SVneo cells. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. e IGF2BP2 protein level was assessed by western blotting in the 10 paired severe pre-eclamptic placentas and normal placentas mentioned in Fig. 1a . A representative western blotting image of four paired placentas is shown, and the molecular weight markers are depicted on the left in kDa. IGF2BP2 protein level was statistically analyzed by quantitating the intensity of the IGF2BP2 bands relative to that of the corresponding GAPDH ones. N normal pregnancy, sPE severe pre-eclampsia. The results are expressed as the mean ± SD based on at least three independent experiments. * P
    Figure Legend Snippet: IGF2BP2 is directly inhibited by miR-181a-5p a Construction of a pGL3-Control luciferase vector containing the full-length IGF2BP2 3ʹ-UTR. b The effects of miR-181a-5p mimic and inhibitor on the luciferase activity of the IGF2BP2 WT 3ʹ-UTR reporter were measured. c The IGF2BP2 mRNA and protein levels were both diminished by miR-181a-5p overexpression in HTR-8/SVneo cells. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. d The IGF2BP2 mRNA and protein levels were both elevated upon treatment of the miR-181a-5p inhibitor in HTR-8/SVneo cells. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. e IGF2BP2 protein level was assessed by western blotting in the 10 paired severe pre-eclamptic placentas and normal placentas mentioned in Fig. 1a . A representative western blotting image of four paired placentas is shown, and the molecular weight markers are depicted on the left in kDa. IGF2BP2 protein level was statistically analyzed by quantitating the intensity of the IGF2BP2 bands relative to that of the corresponding GAPDH ones. N normal pregnancy, sPE severe pre-eclampsia. The results are expressed as the mean ± SD based on at least three independent experiments. * P

    Techniques Used: Luciferase, Plasmid Preparation, Activity Assay, Over Expression, Western Blot, Molecular Weight

    3) Product Images from "Glycoconjugate vaccine using a genetically modified O antigen induces protective antibodies to Francisella tularensis"

    Article Title: Glycoconjugate vaccine using a genetically modified O antigen induces protective antibodies to Francisella tularensis

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1900144116

    Size of the OAg affects relative affinity to LPS-specific antibodies. ( A ) Anti-OAg IgG ELISA units to the F. tularensis ∆ wzz1/wzz2 Fn LPS coating agent measured at day 49. Dots represent individual animals. Horizontal bars represent mean ± SD values. ( B ) F. tularensis (Ft) OAg competitive ELISA. Recognition of Ft OAg-specific polyclonal antibody by UV-killed Ft-coated ELISA plates in the presence of LMW (orange), HMW (green), or VHMW (red) OAg as a soluble competitor is shown. The inhibition percentage is calculated in relation to the ELISA signal ( A 405 ) with no competition. Data points represent competition percentage values at indicated inhibitor concentrations. Each data point is the mean of duplicate determinations from a representative experiment. Horizontal bars represent mean ± SD values. * P ≤ 0.05.
    Figure Legend Snippet: Size of the OAg affects relative affinity to LPS-specific antibodies. ( A ) Anti-OAg IgG ELISA units to the F. tularensis ∆ wzz1/wzz2 Fn LPS coating agent measured at day 49. Dots represent individual animals. Horizontal bars represent mean ± SD values. ( B ) F. tularensis (Ft) OAg competitive ELISA. Recognition of Ft OAg-specific polyclonal antibody by UV-killed Ft-coated ELISA plates in the presence of LMW (orange), HMW (green), or VHMW (red) OAg as a soluble competitor is shown. The inhibition percentage is calculated in relation to the ELISA signal ( A 405 ) with no competition. Data points represent competition percentage values at indicated inhibitor concentrations. Each data point is the mean of duplicate determinations from a representative experiment. Horizontal bars represent mean ± SD values. * P ≤ 0.05.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Competitive ELISA, Inhibition

    4) Product Images from "Glycoconjugate vaccine using a genetically modified O antigen induces protective antibodies to Francisella tularensis"

    Article Title: Glycoconjugate vaccine using a genetically modified O antigen induces protective antibodies to Francisella tularensis

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1900144116

    F. tularensis OAg is susceptible to acid hydrolysis, but its structural identity is conserved. ( A ) Silver staining and immunoblot analysis of LPS from F. tularensis (Ft) LVS using an OAg-specific mAb (mAb2034). RU, repeating unit. ( B ) SEC profiles of HMW and LMW OAgs extracted from F. tularensis LVS. A profile run on a Superose 6 10/300 GL column at 0.5 mL⋅min −1 with 1× PBS (pH 7.4) is shown. The average molecular weight was calculated with a dextran calibration curve. mAU, milli-absorbance unit. ( C ) 1 H NMR spectrum of HMW and LMW OAgs extracted from F. tularensis LVS.
    Figure Legend Snippet: F. tularensis OAg is susceptible to acid hydrolysis, but its structural identity is conserved. ( A ) Silver staining and immunoblot analysis of LPS from F. tularensis (Ft) LVS using an OAg-specific mAb (mAb2034). RU, repeating unit. ( B ) SEC profiles of HMW and LMW OAgs extracted from F. tularensis LVS. A profile run on a Superose 6 10/300 GL column at 0.5 mL⋅min −1 with 1× PBS (pH 7.4) is shown. The average molecular weight was calculated with a dextran calibration curve. mAU, milli-absorbance unit. ( C ) 1 H NMR spectrum of HMW and LMW OAgs extracted from F. tularensis LVS.

    Techniques Used: Silver Staining, Size-exclusion Chromatography, Molecular Weight, Nuclear Magnetic Resonance

    Heterologous expression of Wzz2 from F. novicida to produce OAg of larger molecular size in F. tularensis . ( A ) Silver staining analysis comparing LPS from F. tularensis (Ft) LVS with LPS from F. novicida U112. ( B ) Generation of an Ft LVS mutant with an increased OAg size by heterologous expression of chain-length regulator gene wzz2 from the related subspecies F. novicida . ( C ) SEC profile of VHMW in comparison to HMW and LMW OAgs. This profile was run on a Superose 6 10/300 GL column at 0.5 mL⋅min −1 with 1× PBS (pH 7.4). The average molecular weight was calculated with a dextran calibration curve.
    Figure Legend Snippet: Heterologous expression of Wzz2 from F. novicida to produce OAg of larger molecular size in F. tularensis . ( A ) Silver staining analysis comparing LPS from F. tularensis (Ft) LVS with LPS from F. novicida U112. ( B ) Generation of an Ft LVS mutant with an increased OAg size by heterologous expression of chain-length regulator gene wzz2 from the related subspecies F. novicida . ( C ) SEC profile of VHMW in comparison to HMW and LMW OAgs. This profile was run on a Superose 6 10/300 GL column at 0.5 mL⋅min −1 with 1× PBS (pH 7.4). The average molecular weight was calculated with a dextran calibration curve.

    Techniques Used: Expressing, Silver Staining, Mutagenesis, Size-exclusion Chromatography, Molecular Weight

    5) Product Images from "Improvement of the CRISPR-Cpf1 system with ribozyme-processed crRNA"

    Article Title: Improvement of the CRISPR-Cpf1 system with ribozyme-processed crRNA

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1551703

    The least active crRNAs benefit the most from the HDV design. We plotted the fold increase by the HDV insertion versus the relative crRNA activity (%) of the original cr construct. The data on gene editing and gene activation was taken from Figures 4 and 5 , respectively. The Pearson’s correlation coefficient ( r ) was calculated.
    Figure Legend Snippet: The least active crRNAs benefit the most from the HDV design. We plotted the fold increase by the HDV insertion versus the relative crRNA activity (%) of the original cr construct. The data on gene editing and gene activation was taken from Figures 4 and 5 , respectively. The Pearson’s correlation coefficient ( r ) was calculated.

    Techniques Used: Activity Assay, Construct, Activation Assay

    Ribozyme-processed crRNA enhances the Luc knockdown activity of CRISPR-Cpf1. (a) The crRNA structures of the As and LbCpf1 systems. Both crRNA molecules consist of a ~ 20-nt scaffold and a 23-nt guide (N 23 ). The variable U 1-6 tail at the 3ʹ-end is generated when a standard Pol III promoter cassette is used. The variable loop nucleotide positions are marked in blue and green boxes. The first crRNA nucleotide is marked as +1A, but the upstream U (in brackets) has also been implicated in the transcription initiation process. (b) Schematic of three crRNA expression constructs. The Pol III human U6 promoter drives crRNA transcription up to the T6 (TTTTTT) termination signal. The HH and HDV ribozymes were introduced to guide crRNA processing exacty at the crRNA border (marked as scissor). The +1A represents the first crRNA nucleotide. (c) Luc knockdown activity of CRISPR-Cpf1. An equimolar amount of crLuc constructs (equivalent to 50 ng cr vector) together with their cognate Cpf1 plasmids (equivalent to 100 ng AsCpf1 vector) were co-transfected into HEK293T cells with 200 ng Luc reporter and 2 ng Renilla luciferase plasmid to control for the transfection efficiency. The empty cr plasmid served as negative control. The relative Luc activity normalized for Renilla expression was determined at two days post-transfection and the control Luc activity was arbitrarily set at 100%. The results are shown as mean values ± standard deviation (SD, n = 3).
    Figure Legend Snippet: Ribozyme-processed crRNA enhances the Luc knockdown activity of CRISPR-Cpf1. (a) The crRNA structures of the As and LbCpf1 systems. Both crRNA molecules consist of a ~ 20-nt scaffold and a 23-nt guide (N 23 ). The variable U 1-6 tail at the 3ʹ-end is generated when a standard Pol III promoter cassette is used. The variable loop nucleotide positions are marked in blue and green boxes. The first crRNA nucleotide is marked as +1A, but the upstream U (in brackets) has also been implicated in the transcription initiation process. (b) Schematic of three crRNA expression constructs. The Pol III human U6 promoter drives crRNA transcription up to the T6 (TTTTTT) termination signal. The HH and HDV ribozymes were introduced to guide crRNA processing exacty at the crRNA border (marked as scissor). The +1A represents the first crRNA nucleotide. (c) Luc knockdown activity of CRISPR-Cpf1. An equimolar amount of crLuc constructs (equivalent to 50 ng cr vector) together with their cognate Cpf1 plasmids (equivalent to 100 ng AsCpf1 vector) were co-transfected into HEK293T cells with 200 ng Luc reporter and 2 ng Renilla luciferase plasmid to control for the transfection efficiency. The empty cr plasmid served as negative control. The relative Luc activity normalized for Renilla expression was determined at two days post-transfection and the control Luc activity was arbitrarily set at 100%. The results are shown as mean values ± standard deviation (SD, n = 3).

    Techniques Used: Activity Assay, CRISPR, Generated, Expressing, Construct, Plasmid Preparation, Transfection, Luciferase, Negative Control, Standard Deviation

    crRNA expression from the crRNA-ribozyme cassettes. HEK293T cells in a 6-well plate were transfected with the same molar amount of indicated crRNA constructs (equivalent to 1 µg cr vector) and a fixed molar amount of their cognate Cpf1 plasmids (equivalent to 2 µg AsCpf1 vector). Total cellular RNA was harvested two days post-transfection and 5 µg was subjected to Northern blotting using the Luc2 probe targeting the crLuc2 guide region (panel A) and the Lb probe targeting Lb crRNA scaffold (panel B). The crRNA and precursor crRNA-HDV transcripts are marked. An RNA size marker (nt) was included. Ethidium bromide staining of 5S RNA is shown at the bottom as loading control. Quantitation of crRNA normalized by 5S RNA is plotted below the blot and the cr signal of crLuc2 (As) was arbitrarily set at 10. The results were produced in two independent experiments that showed similar trends.
    Figure Legend Snippet: crRNA expression from the crRNA-ribozyme cassettes. HEK293T cells in a 6-well plate were transfected with the same molar amount of indicated crRNA constructs (equivalent to 1 µg cr vector) and a fixed molar amount of their cognate Cpf1 plasmids (equivalent to 2 µg AsCpf1 vector). Total cellular RNA was harvested two days post-transfection and 5 µg was subjected to Northern blotting using the Luc2 probe targeting the crLuc2 guide region (panel A) and the Lb probe targeting Lb crRNA scaffold (panel B). The crRNA and precursor crRNA-HDV transcripts are marked. An RNA size marker (nt) was included. Ethidium bromide staining of 5S RNA is shown at the bottom as loading control. Quantitation of crRNA normalized by 5S RNA is plotted below the blot and the cr signal of crLuc2 (As) was arbitrarily set at 10. The results were produced in two independent experiments that showed similar trends.

    Techniques Used: Expressing, Transfection, Construct, Plasmid Preparation, Northern Blot, Marker, Staining, Quantitation Assay, Produced

    The cr-HDV design also increases the CRISPRa activity. (a) Schematic of the dCpf1-VP64 construct. (b) Schematic of Tet-On inducible Luc reporter cassette (7xTRE-CMV minimal -Luc) that is chromosomally integrated in HeLa X1/6 cells. The TRE and the location of the crRNA targets are indicated, crRNA1-4 target the 7× TRE repeat and crRNA5 and 6 the Luc gene leader sequence. (c) Luc induction by the CRISPR-based systems. Dox addition and transfection of a rtTA expressing plasmid was used as positive control. For CRISPR-based Tet-On induction, an equimolar amount of cr/cr-HDV construct (equivalent to 100 ng cr vector) and a fixed amount of the cognate dCpf1-VP64 plasmid (equivalent to 200 ng dAsCpf1-VP64 vector) were transfected into HeLa X1/6 cells with a Renilla plasmid to control for transfection efficiency. The empty crRNA plasmid acted as negative control. The relative Luc expression normalized by Renilla was determined at two days post-transfection. The results are represented as mean value ± SD ( n = 3). *P
    Figure Legend Snippet: The cr-HDV design also increases the CRISPRa activity. (a) Schematic of the dCpf1-VP64 construct. (b) Schematic of Tet-On inducible Luc reporter cassette (7xTRE-CMV minimal -Luc) that is chromosomally integrated in HeLa X1/6 cells. The TRE and the location of the crRNA targets are indicated, crRNA1-4 target the 7× TRE repeat and crRNA5 and 6 the Luc gene leader sequence. (c) Luc induction by the CRISPR-based systems. Dox addition and transfection of a rtTA expressing plasmid was used as positive control. For CRISPR-based Tet-On induction, an equimolar amount of cr/cr-HDV construct (equivalent to 100 ng cr vector) and a fixed amount of the cognate dCpf1-VP64 plasmid (equivalent to 200 ng dAsCpf1-VP64 vector) were transfected into HeLa X1/6 cells with a Renilla plasmid to control for transfection efficiency. The empty crRNA plasmid acted as negative control. The relative Luc expression normalized by Renilla was determined at two days post-transfection. The results are represented as mean value ± SD ( n = 3). *P

    Techniques Used: Activity Assay, Construct, Sequencing, CRISPR, Transfection, Expressing, Plasmid Preparation, Positive Control, Negative Control

    6) Product Images from "Mek1 coordinates meiotic progression with DNA break repair by directly phosphorylating and inhibiting the yeast pachytene exit regulator Ndt80"

    Article Title: Mek1 coordinates meiotic progression with DNA break repair by directly phosphorylating and inhibiting the yeast pachytene exit regulator Ndt80

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007832

    Negatively charged mutations in the Ndt80 DNA binding domain constitutively inactivate Ndt80. (A-C) Endogenous NDT80 . (A) Meiotic progression. Cells expressing NDT80 (NH2426::pEP105 2 ::pHL8 2 ), ndt80-R177A (NH2426::pEP105 2 ::pHL8-R177A 2 ), ndt80-6A (NH2426::pEP105 2 ::pNH400 2 ), and ndt80-6D (NH2426::pEP105 2 ::pNH401 2 ) were transferred to Spo medium to induce sporulation. Meiotic progression was determined as described in Fig 3 using three independent timecourses with error bars indicating the standard deviations. (B) Immunoblot analysis of protein extracts from one of the timecourses used in (A). (C) Quantification of Ndt80 signal in (B). Ndt80 was normalized to Arp7 from the same lane on the same gel. The signal from non-specific bands was eliminated by subtracting the Ndt80/Arp7 from 0 hours from each timepoint of the appropriate strain. (D-F) Inducible NDT80 . (D) Meiotic progression. Cells expressing NDT80-IN (NH2426::pEP105 2 ::pBG4 2 ), ndt80-6A-IN (NH2426::pEP105 2 ::pXC11 2 ), and ndt80-6D-IN (NH2426::pEP105 2 ::pXC12 2 ) were transferred to Spo medium and incubated for five hours. NDT80 expression was induced by addition of estradiol (ED) to a final concentration of 1 μM (indicated by arrowheads). Data represent the average values of two experiments with error bars indicating the ranges. (E) Immunoblot analysis of proteins extracts obtained from one of the timecourses used in (D). (F) Ndt80 quantification from (E).
    Figure Legend Snippet: Negatively charged mutations in the Ndt80 DNA binding domain constitutively inactivate Ndt80. (A-C) Endogenous NDT80 . (A) Meiotic progression. Cells expressing NDT80 (NH2426::pEP105 2 ::pHL8 2 ), ndt80-R177A (NH2426::pEP105 2 ::pHL8-R177A 2 ), ndt80-6A (NH2426::pEP105 2 ::pNH400 2 ), and ndt80-6D (NH2426::pEP105 2 ::pNH401 2 ) were transferred to Spo medium to induce sporulation. Meiotic progression was determined as described in Fig 3 using three independent timecourses with error bars indicating the standard deviations. (B) Immunoblot analysis of protein extracts from one of the timecourses used in (A). (C) Quantification of Ndt80 signal in (B). Ndt80 was normalized to Arp7 from the same lane on the same gel. The signal from non-specific bands was eliminated by subtracting the Ndt80/Arp7 from 0 hours from each timepoint of the appropriate strain. (D-F) Inducible NDT80 . (D) Meiotic progression. Cells expressing NDT80-IN (NH2426::pEP105 2 ::pBG4 2 ), ndt80-6A-IN (NH2426::pEP105 2 ::pXC11 2 ), and ndt80-6D-IN (NH2426::pEP105 2 ::pXC12 2 ) were transferred to Spo medium and incubated for five hours. NDT80 expression was induced by addition of estradiol (ED) to a final concentration of 1 μM (indicated by arrowheads). Data represent the average values of two experiments with error bars indicating the ranges. (E) Immunoblot analysis of proteins extracts obtained from one of the timecourses used in (D). (F) Ndt80 quantification from (E).

    Techniques Used: Binding Assay, Expressing, Incubation, Concentration Assay

    Sporulation analysis of various ndt80 mutants in dmc1Δ and DMC1 diploids. Potential Mek1 phosphorylation sites are indicated in green, purple and gold, corresponding to the protein domain and have the sequence RXXT/S. Asterisks indicate non-consensus sites detected as phosphorylated in global phosphoproteomic analyses of dmc1Δ - arrested cells [ 73 ]. Sporulation was assayed after three days at 30ºC on solid sporulation medium. Each row represents a diploid homozygous for a different allele of NDT80 with mutated residues indicated by either A (alanine), D (aspartic acid) or N (asparagine). “nd” indicates no data. ( NDT80 , pHL8; NDT80-Δbc , pHL8- Δ bc; ndt80-ΔRPSKR , pNH317; ndt80-KR > AA , pHL8-KR > AA; ndt80-KR > DD , pHL8-KR > DD; ndt80-2A , pHL8-2A; ndt80-4AMS , pHL8-4AMS; ndt80-5AMS ; pHL8-5AMS; ndt80-7AMS , pHL8-7AMS; ndt80-9AMS , pHL8-9AMS; ndt80-10AMS , pHL8-10AMS; ndt80-8A , pNH405; ndt80-6A , pNH400; ndt80-10DMS , pHL8-10DMS; ndt80-S24D , pHL8-S24D; ndt80-S343D , pHL8-S343D; ndt80-S205D T211D , pHL8-S205D T211D; ndt80-S327D S329D , pHL8-S327D S329D; ndt80-6D , pNH401; ndt80-6N , pHL8-6N. Sporulation was scored in either a dmc1Δ (NH2402) or DMC1 diploid (NH2081). Values in magenta are significantly higher than dmc1Δ NDT80 with p values
    Figure Legend Snippet: Sporulation analysis of various ndt80 mutants in dmc1Δ and DMC1 diploids. Potential Mek1 phosphorylation sites are indicated in green, purple and gold, corresponding to the protein domain and have the sequence RXXT/S. Asterisks indicate non-consensus sites detected as phosphorylated in global phosphoproteomic analyses of dmc1Δ - arrested cells [ 73 ]. Sporulation was assayed after three days at 30ºC on solid sporulation medium. Each row represents a diploid homozygous for a different allele of NDT80 with mutated residues indicated by either A (alanine), D (aspartic acid) or N (asparagine). “nd” indicates no data. ( NDT80 , pHL8; NDT80-Δbc , pHL8- Δ bc; ndt80-ΔRPSKR , pNH317; ndt80-KR > AA , pHL8-KR > AA; ndt80-KR > DD , pHL8-KR > DD; ndt80-2A , pHL8-2A; ndt80-4AMS , pHL8-4AMS; ndt80-5AMS ; pHL8-5AMS; ndt80-7AMS , pHL8-7AMS; ndt80-9AMS , pHL8-9AMS; ndt80-10AMS , pHL8-10AMS; ndt80-8A , pNH405; ndt80-6A , pNH400; ndt80-10DMS , pHL8-10DMS; ndt80-S24D , pHL8-S24D; ndt80-S343D , pHL8-S343D; ndt80-S205D T211D , pHL8-S205D T211D; ndt80-S327D S329D , pHL8-S327D S329D; ndt80-6D , pNH401; ndt80-6N , pHL8-6N. Sporulation was scored in either a dmc1Δ (NH2402) or DMC1 diploid (NH2081). Values in magenta are significantly higher than dmc1Δ NDT80 with p values

    Techniques Used: Sequencing

    7) Product Images from "Mek1 coordinates meiotic progression with DNA break repair by directly phosphorylating and inhibiting the yeast pachytene exit regulator Ndt80"

    Article Title: Mek1 coordinates meiotic progression with DNA break repair by directly phosphorylating and inhibiting the yeast pachytene exit regulator Ndt80

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007832

    Sporulation analysis of various ndt80 mutants in dmc1Δ and DMC1 diploids. Potential Mek1 phosphorylation sites are indicated in green, purple and gold, corresponding to the protein domain and have the sequence RXXT/S. Asterisks indicate non-consensus sites detected as phosphorylated in global phosphoproteomic analyses of dmc1Δ - arrested cells [ 73 ]. Sporulation was assayed after three days at 30ºC on solid sporulation medium. Each row represents a diploid homozygous for a different allele of NDT80 with mutated residues indicated by either A (alanine), D (aspartic acid) or N (asparagine). “nd” indicates no data. ( NDT80 , pHL8; NDT80-Δbc , pHL8- Δ bc; ndt80-ΔRPSKR , pNH317; ndt80-KR > AA , pHL8-KR > AA; ndt80-KR > DD , pHL8-KR > DD; ndt80-2A , pHL8-2A; ndt80-4AMS , pHL8-4AMS; ndt80-5AMS ; pHL8-5AMS; ndt80-7AMS , pHL8-7AMS; ndt80-9AMS , pHL8-9AMS; ndt80-10AMS , pHL8-10AMS; ndt80-8A , pNH405; ndt80-6A , pNH400; ndt80-10DMS , pHL8-10DMS; ndt80-S24D , pHL8-S24D; ndt80-S343D , pHL8-S343D; ndt80-S205D T211D , pHL8-S205D T211D; ndt80-S327D S329D , pHL8-S327D S329D; ndt80-6D , pNH401; ndt80-6N , pHL8-6N. Sporulation was scored in either a dmc1Δ (NH2402) or DMC1 diploid (NH2081). Values in magenta are significantly higher than dmc1Δ NDT80 with p values
    Figure Legend Snippet: Sporulation analysis of various ndt80 mutants in dmc1Δ and DMC1 diploids. Potential Mek1 phosphorylation sites are indicated in green, purple and gold, corresponding to the protein domain and have the sequence RXXT/S. Asterisks indicate non-consensus sites detected as phosphorylated in global phosphoproteomic analyses of dmc1Δ - arrested cells [ 73 ]. Sporulation was assayed after three days at 30ºC on solid sporulation medium. Each row represents a diploid homozygous for a different allele of NDT80 with mutated residues indicated by either A (alanine), D (aspartic acid) or N (asparagine). “nd” indicates no data. ( NDT80 , pHL8; NDT80-Δbc , pHL8- Δ bc; ndt80-ΔRPSKR , pNH317; ndt80-KR > AA , pHL8-KR > AA; ndt80-KR > DD , pHL8-KR > DD; ndt80-2A , pHL8-2A; ndt80-4AMS , pHL8-4AMS; ndt80-5AMS ; pHL8-5AMS; ndt80-7AMS , pHL8-7AMS; ndt80-9AMS , pHL8-9AMS; ndt80-10AMS , pHL8-10AMS; ndt80-8A , pNH405; ndt80-6A , pNH400; ndt80-10DMS , pHL8-10DMS; ndt80-S24D , pHL8-S24D; ndt80-S343D , pHL8-S343D; ndt80-S205D T211D , pHL8-S205D T211D; ndt80-S327D S329D , pHL8-S327D S329D; ndt80-6D , pNH401; ndt80-6N , pHL8-6N. Sporulation was scored in either a dmc1Δ (NH2402) or DMC1 diploid (NH2081). Values in magenta are significantly higher than dmc1Δ NDT80 with p values

    Techniques Used: Sequencing

    8) Product Images from "Serendipita indica E5′ NT modulates extracellular nucleotide levels in the plant apoplast and affects fungal colonization"

    Article Title: Serendipita indica E5′ NT modulates extracellular nucleotide levels in the plant apoplast and affects fungal colonization

    Journal: EMBO Reports

    doi: 10.15252/embr.201847430

    The ecto‐5′‐nucleotidase activity of Si E5′NT in the apoplast of Arabidopsis leads to enhanced S. indica colonization similar to that of the dorn1‐3 (ATP receptor) mutant line Ecto‐5′‐nucleotidase activity measured in membrane protein preparations of Arabidopsis plants expressing Pro35S ::E5′NT (#303), Pro35S ::SP E5′NT :mCherry:E5′NT woSP (#304), or Pro35S ::mCherry (#305). E5′NT activity was measured after incubation with 100 μM of either ATP, ADP, or AMP. In the membrane protein preparations from Pro35S ::E5′NT (#303) lines, phosphate release was specifically increased upon incubation with purines. Error bars represent the standard error of the mean from three technical repetitions. The Coomassie‐stained SDS–PAGE shows the protein pattern of the membrane fractions for the individual transgenic lines. Equal volumes were loaded. The experiment was repeated two times with similar results. Confocal microscopy images of Arabidopsis roots expressing either cytosolic mCherry (#305) or Pro35S ::SP E5′NT :mCherry:E5′NT woSP (#304) showing secretion of the E5′NT fusion protein. mCherry images show z‐stacks of 14 image planes of 1 μm each. Scale bar = 20 μm. The transgenic Arabidopsis line Pro35S ::E5′NT (#303) expressing untagged full‐length Si E5′NT was better colonized by S. indica . Error bars of the qPCR data represent ± SE of the mean from three independent biological replicates. Asterisks indicate significance (Student's t ‐test, * P
    Figure Legend Snippet: The ecto‐5′‐nucleotidase activity of Si E5′NT in the apoplast of Arabidopsis leads to enhanced S. indica colonization similar to that of the dorn1‐3 (ATP receptor) mutant line Ecto‐5′‐nucleotidase activity measured in membrane protein preparations of Arabidopsis plants expressing Pro35S ::E5′NT (#303), Pro35S ::SP E5′NT :mCherry:E5′NT woSP (#304), or Pro35S ::mCherry (#305). E5′NT activity was measured after incubation with 100 μM of either ATP, ADP, or AMP. In the membrane protein preparations from Pro35S ::E5′NT (#303) lines, phosphate release was specifically increased upon incubation with purines. Error bars represent the standard error of the mean from three technical repetitions. The Coomassie‐stained SDS–PAGE shows the protein pattern of the membrane fractions for the individual transgenic lines. Equal volumes were loaded. The experiment was repeated two times with similar results. Confocal microscopy images of Arabidopsis roots expressing either cytosolic mCherry (#305) or Pro35S ::SP E5′NT :mCherry:E5′NT woSP (#304) showing secretion of the E5′NT fusion protein. mCherry images show z‐stacks of 14 image planes of 1 μm each. Scale bar = 20 μm. The transgenic Arabidopsis line Pro35S ::E5′NT (#303) expressing untagged full‐length Si E5′NT was better colonized by S. indica . Error bars of the qPCR data represent ± SE of the mean from three independent biological replicates. Asterisks indicate significance (Student's t ‐test, * P

    Techniques Used: Activity Assay, Mutagenesis, Expressing, Incubation, Staining, SDS Page, Transgenic Assay, Confocal Microscopy, Real-time Polymerase Chain Reaction

    Schematic model showing the potential interference of Si E5′NT with apoplastic eATP signaling and nucleotide salvage pathway in Arabidopsis The schema was modified from Ref. 5 . ENT = equilibrative nucleoside transporters, PAP = purple acid phosphatases, Apy = ectoapyrases or nucleoside triphosphate diphosphohydrolases (NTPDases), NSH = nucleoside hydrolases, 5NT = hypothetical 5′‐nucleotidases, PUP = hypothetical purine permeases.
    Figure Legend Snippet: Schematic model showing the potential interference of Si E5′NT with apoplastic eATP signaling and nucleotide salvage pathway in Arabidopsis The schema was modified from Ref. 5 . ENT = equilibrative nucleoside transporters, PAP = purple acid phosphatases, Apy = ectoapyrases or nucleoside triphosphate diphosphohydrolases (NTPDases), NSH = nucleoside hydrolases, 5NT = hypothetical 5′‐nucleotidases, PUP = hypothetical purine permeases.

    Techniques Used: Modification

    Serendipita indica PIIN_01005 encodes a secreted ecto‐5′‐nucleotidase ( Si E5′NT) Distribution of Si E5′NT orthologues across higher fungi. End nodes are color‐coded based on the presence (blue) or absence (red) of 5′NT genes in a particular fungal taxon. Numbers in parentheses besides the nodes specify the number of species that have 5′NT genes with respect to the total number of genomes analyzed. Left tree: distribution of 5′NT without signal peptide (SP) and GPI anchor. Right tree: E5′NT with SP and GPI anchor. The distribution shows that E5′NT genes are mostly present in Ascomycota such as Sordariomycetes (107/121), followed by Dothideomycetes (24/37) and Leotiomycetes (6/18). Few species of Eurotiomycetes (6/118) possess an E5′NT orthologue. In Basidiomycota, E5′NT members are only found in the class of Agaromycotina (12/85). Comparison of the Si E5′NT structural homology model (green) with the crystal structure of human E5′NT (PDB id 4H2I, red) with 32% sequence identity. *: position of the loop involved in dimerization of human E5′NT. Comparison of the Si E5′NT structural homology model (green) with the crystal structure of Thermus thermophiles 5′NT (2Z1A, blue) with 36% sequence identity.
    Figure Legend Snippet: Serendipita indica PIIN_01005 encodes a secreted ecto‐5′‐nucleotidase ( Si E5′NT) Distribution of Si E5′NT orthologues across higher fungi. End nodes are color‐coded based on the presence (blue) or absence (red) of 5′NT genes in a particular fungal taxon. Numbers in parentheses besides the nodes specify the number of species that have 5′NT genes with respect to the total number of genomes analyzed. Left tree: distribution of 5′NT without signal peptide (SP) and GPI anchor. Right tree: E5′NT with SP and GPI anchor. The distribution shows that E5′NT genes are mostly present in Ascomycota such as Sordariomycetes (107/121), followed by Dothideomycetes (24/37) and Leotiomycetes (6/18). Few species of Eurotiomycetes (6/118) possess an E5′NT orthologue. In Basidiomycota, E5′NT members are only found in the class of Agaromycotina (12/85). Comparison of the Si E5′NT structural homology model (green) with the crystal structure of human E5′NT (PDB id 4H2I, red) with 32% sequence identity. *: position of the loop involved in dimerization of human E5′NT. Comparison of the Si E5′NT structural homology model (green) with the crystal structure of Thermus thermophiles 5′NT (2Z1A, blue) with 36% sequence identity.

    Techniques Used: Sequencing

    9) Product Images from "A Highly Polymorphic Receptor Governs Many Distinct Self-Recognition Types within the Myxococcales Order"

    Article Title: A Highly Polymorphic Receptor Governs Many Distinct Self-Recognition Types within the Myxococcales Order

    Journal: mBio

    doi: 10.1128/mBio.02751-18

    Self-recognition among a wide range of myxobacteria is governed by the traA locus. (A) Stimulation assays showing specific recognition among 10 traA alleles (names are shown in bold on the left) in an isogenic set of strains. Black borders highlight 10 distinct recognition groups (groups A to J). Additional group members that have been functionally characterized ( 5 , 10 ) are also listed on the left. The asterisk indicates a chimeric allele harboring VD MCy8337 (see Fig. S3 for details). Scale bar, 200 µm. (B) Pairwise plot of (%) identity among VDs of the TraA orthologs tested in panel A (asterisks indicate self-recognition). (C) Same tree as that shown in Fig. 5B , where allele names are given. Shaded areas highlight distinct recognition groups, solid lines indicate characterized recognition groups (letters indicate group names), and dashed lines show predicted recognition groups. Groups are color coded according to the specificity-determining residue at position 205. The scale bar indicates the number of substitutions per amino acid residue.
    Figure Legend Snippet: Self-recognition among a wide range of myxobacteria is governed by the traA locus. (A) Stimulation assays showing specific recognition among 10 traA alleles (names are shown in bold on the left) in an isogenic set of strains. Black borders highlight 10 distinct recognition groups (groups A to J). Additional group members that have been functionally characterized ( 5 , 10 ) are also listed on the left. The asterisk indicates a chimeric allele harboring VD MCy8337 (see Fig. S3 for details). Scale bar, 200 µm. (B) Pairwise plot of (%) identity among VDs of the TraA orthologs tested in panel A (asterisks indicate self-recognition). (C) Same tree as that shown in Fig. 5B , where allele names are given. Shaded areas highlight distinct recognition groups, solid lines indicate characterized recognition groups (letters indicate group names), and dashed lines show predicted recognition groups. Groups are color coded according to the specificity-determining residue at position 205. The scale bar indicates the number of substitutions per amino acid residue.

    Techniques Used:

    10) Product Images from "Molecular analysis of NPAS3 functional domains and variants"

    Article Title: Molecular analysis of NPAS3 functional domains and variants

    Journal: BMC Molecular Biology

    doi: 10.1186/s12867-018-0117-4

    NPAS3 and ARNT interact through their bHLH and PAS domains. a Ideogram of NPAS3 constructs used. Exon numbering relative to NPAS3 transcript variant 1 corresponding to NPAS3 isoform 1 (933 aa). Only coding regions of exons are depicted. Domain constructs and variant numbering are relative to isoform 1. NPAS3 isoform 2 (901 aa) was also characterized. Red bHLH domain, Blue PAS domains, Green TAD (C-terminal transactivation domain). b Western blots of HaloTag pull-downs demonstrating that all tested isoforms of NPAS3 and ARNT are able to robustly interact, which is not observed with the empty HaloTag vector. Bands in the top panel of pull-down lane of ‘prey’ protein, indicating physical association of HA-NPAS3 isoforms with the HaloTag-ARNT construct. Middle and bottom panels are results for the HaloTag-clone and HaloTag-empty constructs. As HaloTag constructs are covalently linked to the resin, they will be depleted in the pull-down sample, demonstrating functionality of the HaloTag. Molecular weight of HaloTag-ARNT, 121 kDa, HaloTag construct with no cDNA: 34 kDa, Full-length NPAS3: 101 kDa. c Reciprocal HaloTag pull down data using HaloTag-NPAS3 constructs and untagged ARNT isoform 1. Molecular weight of HaloTag-NPAS3, 135 kDa. d HaloTag-NPAS3 pull-down of endogenously expressed ARNT. All pull-downs have been performed at least twice
    Figure Legend Snippet: NPAS3 and ARNT interact through their bHLH and PAS domains. a Ideogram of NPAS3 constructs used. Exon numbering relative to NPAS3 transcript variant 1 corresponding to NPAS3 isoform 1 (933 aa). Only coding regions of exons are depicted. Domain constructs and variant numbering are relative to isoform 1. NPAS3 isoform 2 (901 aa) was also characterized. Red bHLH domain, Blue PAS domains, Green TAD (C-terminal transactivation domain). b Western blots of HaloTag pull-downs demonstrating that all tested isoforms of NPAS3 and ARNT are able to robustly interact, which is not observed with the empty HaloTag vector. Bands in the top panel of pull-down lane of ‘prey’ protein, indicating physical association of HA-NPAS3 isoforms with the HaloTag-ARNT construct. Middle and bottom panels are results for the HaloTag-clone and HaloTag-empty constructs. As HaloTag constructs are covalently linked to the resin, they will be depleted in the pull-down sample, demonstrating functionality of the HaloTag. Molecular weight of HaloTag-ARNT, 121 kDa, HaloTag construct with no cDNA: 34 kDa, Full-length NPAS3: 101 kDa. c Reciprocal HaloTag pull down data using HaloTag-NPAS3 constructs and untagged ARNT isoform 1. Molecular weight of HaloTag-NPAS3, 135 kDa. d HaloTag-NPAS3 pull-down of endogenously expressed ARNT. All pull-downs have been performed at least twice

    Techniques Used: Construct, Variant Assay, Western Blot, Plasmid Preparation, Molecular Weight

    11) Product Images from "A Vaccine Based on a Modified Vaccinia Virus Ankara Vector Expressing Zika Virus Structural Proteins Controls Zika Virus Replication in Mice"

    Article Title: A Vaccine Based on a Modified Vaccinia Virus Ankara Vector Expressing Zika Virus Structural Proteins Controls Zika Virus Replication in Mice

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-35724-6

    Generation and in vitro characterization of MVA-ZIKV. (a) Scheme of the MVA-ZIKV genome map. The ZIKV signal peptide (sp) following by the ZIKV prM-E structural genes (isolate Z1106033) are driven by the novel VACV synthetic pLEO160 promoter and are inserted within the VACV TK viral locus (J2R). The deleted VACV C6L , K7R , and A46R genes are indicated. TK-L, TK left; TK-R, TK right. (b) PCR analysis of the VACV TK locus. Viral DNA was extracted from DF-1 cells mock infected or infected at 5 PFU/cell with MVA-ZIKV, MVA-Δ-GFP, or MVA-WT. Primers spanning the TK locus-flanking regions were used for PCR analysis of the ZIKV genes inserted within the TK locus. DNA products are indicated by an arrow on the right. A molecular size marker (1-kb ladder) with the corresponding sizes (base pairs) is indicated on the left. (c) Expression of ZIKV prM and E proteins. DF-1 cells were mock infected or infected at 5 PFU/cell with MVA-ZIKV, MVA-Δ-GFP, or MVA-WT. At 24 hpi, cells were lysed, fractionated by 10% SDS-PAGE, and analyzed by Western blotting. Arrows on the right indicate the positions of the ZIKV prM and E proteins, the VACV E3 protein or β-actin. The sizes of standards (in kDa) are indicated on the left. (d) Viral growth kinetics of MVA-ZIKV. Monolayers of permissive DF-1 or non-permissive HeLa cells were infected at 0.01 PFU/cell with MVA-WT or MVA-ZIKV. At different times postinfection (0, 24, 48, and 72 hpi), virus titers in cell lysates were quantified by a plaque immunostaining assay. The means of results from two independent experiments are shown. (e,f) Stability of MVA-ZIKV. MVA-ZIKV (P2 stock) was continuously grown in DF-1 cells to passage 9 ( e ) and at passage 9, 24 individual plaques were picked ( f ). Virus stocks from each passage and from the 24 individual plaques were used to infect cells and the expression of ZIKV prM and E proteins was determined by Western blotting. Rabbit anti-VACV E3 protein antibody was used as a VACV loading control. Arrows on the right indicate the position of the ZIKV prM and E proteins, and the VACV E3 protein. The sizes of standards (in kDa) are indicated on the left.
    Figure Legend Snippet: Generation and in vitro characterization of MVA-ZIKV. (a) Scheme of the MVA-ZIKV genome map. The ZIKV signal peptide (sp) following by the ZIKV prM-E structural genes (isolate Z1106033) are driven by the novel VACV synthetic pLEO160 promoter and are inserted within the VACV TK viral locus (J2R). The deleted VACV C6L , K7R , and A46R genes are indicated. TK-L, TK left; TK-R, TK right. (b) PCR analysis of the VACV TK locus. Viral DNA was extracted from DF-1 cells mock infected or infected at 5 PFU/cell with MVA-ZIKV, MVA-Δ-GFP, or MVA-WT. Primers spanning the TK locus-flanking regions were used for PCR analysis of the ZIKV genes inserted within the TK locus. DNA products are indicated by an arrow on the right. A molecular size marker (1-kb ladder) with the corresponding sizes (base pairs) is indicated on the left. (c) Expression of ZIKV prM and E proteins. DF-1 cells were mock infected or infected at 5 PFU/cell with MVA-ZIKV, MVA-Δ-GFP, or MVA-WT. At 24 hpi, cells were lysed, fractionated by 10% SDS-PAGE, and analyzed by Western blotting. Arrows on the right indicate the positions of the ZIKV prM and E proteins, the VACV E3 protein or β-actin. The sizes of standards (in kDa) are indicated on the left. (d) Viral growth kinetics of MVA-ZIKV. Monolayers of permissive DF-1 or non-permissive HeLa cells were infected at 0.01 PFU/cell with MVA-WT or MVA-ZIKV. At different times postinfection (0, 24, 48, and 72 hpi), virus titers in cell lysates were quantified by a plaque immunostaining assay. The means of results from two independent experiments are shown. (e,f) Stability of MVA-ZIKV. MVA-ZIKV (P2 stock) was continuously grown in DF-1 cells to passage 9 ( e ) and at passage 9, 24 individual plaques were picked ( f ). Virus stocks from each passage and from the 24 individual plaques were used to infect cells and the expression of ZIKV prM and E proteins was determined by Western blotting. Rabbit anti-VACV E3 protein antibody was used as a VACV loading control. Arrows on the right indicate the position of the ZIKV prM and E proteins, and the VACV E3 protein. The sizes of standards (in kDa) are indicated on the left.

    Techniques Used: In Vitro, Polymerase Chain Reaction, Infection, Marker, Expressing, SDS Page, Western Blot, Immunostaining

    12) Product Images from "XMAP215 is a microtubule nucleation factor that functions synergistically with the gamma-tubulin ring complex"

    Article Title: XMAP215 is a microtubule nucleation factor that functions synergistically with the gamma-tubulin ring complex

    Journal: Nature cell biology

    doi: 10.1038/s41556-018-0091-6

    Microtubule nucleation by XMAP215 protein constructs in Xenopus egg extract Branching MT nucleation activity of XMAP215 constructs. All proteins were added back to XMAP215-depleted extract at final concentration of 120 nM in the presence of 5.5 μM RanQ69L and 1 μM GST-TPX2 α3-7. All experiments and analyses were repeated with at least three independent extract preparations. (A) Representative images are displayed for N-terminal deletion constructs at 560 seconds of the reaction. Scale bar, 10 μm. See Supplementary Fig. 5A–B and Supplementary Video 6 . (B) Representative images are displayed for C-terminal deletion constructs at 480 seconds of the reaction. Scale bar, 10 μm. See Supplementary Video 7 . (C) Number of EB1 comets were detected, counted and plotted with time for protein constructs displayed in (B). (D) Branching MT nucleation activity of tubulin-binding mutant constructs of TOG1-5 protein. Representative images are displayed at 650 seconds of the reaction. Scale bar, 10 μm. See Supplementary Video 8 . (E) Number of EB1 comets were detected, counted and plotted with time for protein constructs displayed in (D). See Supplementary Figure 5 .
    Figure Legend Snippet: Microtubule nucleation by XMAP215 protein constructs in Xenopus egg extract Branching MT nucleation activity of XMAP215 constructs. All proteins were added back to XMAP215-depleted extract at final concentration of 120 nM in the presence of 5.5 μM RanQ69L and 1 μM GST-TPX2 α3-7. All experiments and analyses were repeated with at least three independent extract preparations. (A) Representative images are displayed for N-terminal deletion constructs at 560 seconds of the reaction. Scale bar, 10 μm. See Supplementary Fig. 5A–B and Supplementary Video 6 . (B) Representative images are displayed for C-terminal deletion constructs at 480 seconds of the reaction. Scale bar, 10 μm. See Supplementary Video 7 . (C) Number of EB1 comets were detected, counted and plotted with time for protein constructs displayed in (B). (D) Branching MT nucleation activity of tubulin-binding mutant constructs of TOG1-5 protein. Representative images are displayed at 650 seconds of the reaction. Scale bar, 10 μm. See Supplementary Video 8 . (E) Number of EB1 comets were detected, counted and plotted with time for protein constructs displayed in (D). See Supplementary Figure 5 .

    Techniques Used: Construct, Activity Assay, Concentration Assay, Binding Assay, Mutagenesis

    N-terminus of XMAP215 interacts with αβ-tubulin, and model for how XMAP215 and γ-TuRC promote microtubule nucleation (A) XMAP215 N-terminal TOG1-4 construct or C-terminal TOG5-CT construct (5–6 μM) and bovine αβ-tubulin (6.2 μM) were mixed and applied to size exclusion chromatography. 100 μl sample volume was injected into the column. Each chromatography run was performed once at the specified concentration. More than three additional supporting experiments were performed either with slightly different protein concentrations or using alternative protein constructs. Void volume of the column was measured as 8.7–8.8 ml. See Supplementary Fig. 8D . See also Supplementary Fig. 9 for unprocessed scans. (B) Schematic representation for how XMAP215 and γ-TuRC could together promote MT nucleation. While γ-TuRC independently induces low MT nucleation (left), its cooperation with XMAP215 promotes efficient nucleation of MTs. Synergistic microtubule nucleation model (right): XMAP215 binds to γ-TuRC with its C-terminus and promotes the assembly of αβ-tubulin dimers onto γ-TuRC via its N-terminus.
    Figure Legend Snippet: N-terminus of XMAP215 interacts with αβ-tubulin, and model for how XMAP215 and γ-TuRC promote microtubule nucleation (A) XMAP215 N-terminal TOG1-4 construct or C-terminal TOG5-CT construct (5–6 μM) and bovine αβ-tubulin (6.2 μM) were mixed and applied to size exclusion chromatography. 100 μl sample volume was injected into the column. Each chromatography run was performed once at the specified concentration. More than three additional supporting experiments were performed either with slightly different protein concentrations or using alternative protein constructs. Void volume of the column was measured as 8.7–8.8 ml. See Supplementary Fig. 8D . See also Supplementary Fig. 9 for unprocessed scans. (B) Schematic representation for how XMAP215 and γ-TuRC could together promote MT nucleation. While γ-TuRC independently induces low MT nucleation (left), its cooperation with XMAP215 promotes efficient nucleation of MTs. Synergistic microtubule nucleation model (right): XMAP215 binds to γ-TuRC with its C-terminus and promotes the assembly of αβ-tubulin dimers onto γ-TuRC via its N-terminus.

    Techniques Used: Construct, Size-exclusion Chromatography, Injection, Chromatography, Concentration Assay

    XMAP215 interacts with γ-tubulin via its C-terminal domains (A) Size exclusion chromatography was performed with 140 nM of human γ-tubulin alone and with 1–1.4 μM XMAP215 protein constructs. 500 μl sample volume was injected into the column, 300 μl fractions were collected and alternate fractions eluted between 8.5 ml to 16.6 ml were analyzed via SDS-PAGE followed by immunoblot with γ-tubulin antibodies and GFP antibodies to detect the elution profile of γ-tubulin and GFP labeled XMAP215 proteins, respectively. Shift in γ-tubulin signal was observed to assess the region of XMAP215 that γ-tubulin interacts with. Stoke’s radii of reference proteins are marked at their peak elution: Thyroglobulin (8.6 nm), Aldolase (4.6 nm) and Ovalbumin (2.8 nm). The contrast of each image was adjusted to display the entire elution profile clearly. Each chromatography run was repeated at least twice on different days at the specified concentration, and at least one additional supporting experiment for each displayed run (more than nine supporting runs in total) was performed at slightly different protein concentrations. Void volume of the column was measured as 8.7–8.8 ml. See Supplementary Fig. 8A–C . See also Supplementary Fig. 9 for unprocessed scans.
    Figure Legend Snippet: XMAP215 interacts with γ-tubulin via its C-terminal domains (A) Size exclusion chromatography was performed with 140 nM of human γ-tubulin alone and with 1–1.4 μM XMAP215 protein constructs. 500 μl sample volume was injected into the column, 300 μl fractions were collected and alternate fractions eluted between 8.5 ml to 16.6 ml were analyzed via SDS-PAGE followed by immunoblot with γ-tubulin antibodies and GFP antibodies to detect the elution profile of γ-tubulin and GFP labeled XMAP215 proteins, respectively. Shift in γ-tubulin signal was observed to assess the region of XMAP215 that γ-tubulin interacts with. Stoke’s radii of reference proteins are marked at their peak elution: Thyroglobulin (8.6 nm), Aldolase (4.6 nm) and Ovalbumin (2.8 nm). The contrast of each image was adjusted to display the entire elution profile clearly. Each chromatography run was repeated at least twice on different days at the specified concentration, and at least one additional supporting experiment for each displayed run (more than nine supporting runs in total) was performed at slightly different protein concentrations. Void volume of the column was measured as 8.7–8.8 ml. See Supplementary Fig. 8A–C . See also Supplementary Fig. 9 for unprocessed scans.

    Techniques Used: Size-exclusion Chromatography, Construct, Injection, SDS Page, Labeling, Chromatography, Concentration Assay

    XMAP215 is required for all microtubule nucleation events (A) De novo (or MT-independent) nucleation events were observed with increasing XMAP215 concentration added back to XMAP215-depleted extract without RanQ69L. Images displayed at 700 seconds of the reaction. Scale bar, 10 μm. See Supplementary Fig. 2A–B , Supplementary Video 3 . The experiment was repeated twice with independent extract preparations, along with more than three additional experiments were performed where fewer concentration points were evaluated. (B) Total number of MT-independent ( de novo ) and MT-dependent nucleation events that occurred until 600 seconds of the reaction were counted and plotted against XMAP215 concentration. Data for MT-independent nucleation events versus XMAP215 concentration was fitted to a linear curve (solid green). XMAP215 concentration is plotted on log scale. Few MT-dependent nucleation events were also observed (red circles). The analysis was repeated twice with independent extract preparations. See Supplementary Table 2 for source data. (C) Immunoblot for TPX2 and augmin depletion corresponding to (D–E). Augmin was immunodepleted using anti-HAUS1 antibodies, and depletion was assessed by western blotting for two subunits - HAUS1 and HAUS6. The experiments in (C–E) were repeated twice with independent extract preparations, along with two supporting experiments performed. See Supplementary Fig. 9 for unprocessed blot. (D) XMAP215-GFP was added to TPX2 and augmin immunodepletion at 360 nM in addition to endogenous protein in the presence of 5.5 μM RanQ69L. Equal volume of buffer was added for control reactions. Representative images at 20 minutes at displayed. Scale bar, 10 μm. See Supplementary Video 4 . (E) EB1 comets in the entire field of view were tracked using the analysis procedure described in Methods. Number of EB1 tracks were counted and plotted over time.
    Figure Legend Snippet: XMAP215 is required for all microtubule nucleation events (A) De novo (or MT-independent) nucleation events were observed with increasing XMAP215 concentration added back to XMAP215-depleted extract without RanQ69L. Images displayed at 700 seconds of the reaction. Scale bar, 10 μm. See Supplementary Fig. 2A–B , Supplementary Video 3 . The experiment was repeated twice with independent extract preparations, along with more than three additional experiments were performed where fewer concentration points were evaluated. (B) Total number of MT-independent ( de novo ) and MT-dependent nucleation events that occurred until 600 seconds of the reaction were counted and plotted against XMAP215 concentration. Data for MT-independent nucleation events versus XMAP215 concentration was fitted to a linear curve (solid green). XMAP215 concentration is plotted on log scale. Few MT-dependent nucleation events were also observed (red circles). The analysis was repeated twice with independent extract preparations. See Supplementary Table 2 for source data. (C) Immunoblot for TPX2 and augmin depletion corresponding to (D–E). Augmin was immunodepleted using anti-HAUS1 antibodies, and depletion was assessed by western blotting for two subunits - HAUS1 and HAUS6. The experiments in (C–E) were repeated twice with independent extract preparations, along with two supporting experiments performed. See Supplementary Fig. 9 for unprocessed blot. (D) XMAP215-GFP was added to TPX2 and augmin immunodepletion at 360 nM in addition to endogenous protein in the presence of 5.5 μM RanQ69L. Equal volume of buffer was added for control reactions. Representative images at 20 minutes at displayed. Scale bar, 10 μm. See Supplementary Video 4 . (E) EB1 comets in the entire field of view were tracked using the analysis procedure described in Methods. Number of EB1 tracks were counted and plotted over time.

    Techniques Used: Concentration Assay, Western Blot

    γ-TuRC is required for microtubule nucleation by XMAP215 (A) Branching MT nucleation was induced in control and γ-tubulin depleted extract with 5.5 μM RanQ69L. XMAP215-GFP was added at 120 nM and 240 nM concentration in excess of the endogenous protein. Representative images are displayed at 1100 seconds of the reaction. Scale bar, 10 μm. See Supplementary Video 5 . The experiment was repeated with three independent extract preparations, including verification with XenC antibody for γ-TuRC immunodepletion 5 , 11 . (B) Number of MT-independent and MT-dependent nucleation events observed was tabulated with excess XMAP215 concentration. Nucleation events were counted until 800 seconds for each reaction. The few MTs that emerged in γ-tubulin depleted extracts were counted manually (both MT-independent and MT-dependent nucleation events). For IgG depletion, total number of MTs (EB1 comets) in the field of view was counted using image analysis, while de novo nucleation events were counted manually. The number of MT-dependent nucleation events was calculated by subtracting MT-independent nucleation events from the total number of MTs. See Supplementary Fig. 3 . The analyses were repeated twice with experiments performed on independent extract preparations, with one additional supporting set of results with anti-XenC immunodepletion.
    Figure Legend Snippet: γ-TuRC is required for microtubule nucleation by XMAP215 (A) Branching MT nucleation was induced in control and γ-tubulin depleted extract with 5.5 μM RanQ69L. XMAP215-GFP was added at 120 nM and 240 nM concentration in excess of the endogenous protein. Representative images are displayed at 1100 seconds of the reaction. Scale bar, 10 μm. See Supplementary Video 5 . The experiment was repeated with three independent extract preparations, including verification with XenC antibody for γ-TuRC immunodepletion 5 , 11 . (B) Number of MT-independent and MT-dependent nucleation events observed was tabulated with excess XMAP215 concentration. Nucleation events were counted until 800 seconds for each reaction. The few MTs that emerged in γ-tubulin depleted extracts were counted manually (both MT-independent and MT-dependent nucleation events). For IgG depletion, total number of MTs (EB1 comets) in the field of view was counted using image analysis, while de novo nucleation events were counted manually. The number of MT-dependent nucleation events was calculated by subtracting MT-independent nucleation events from the total number of MTs. See Supplementary Fig. 3 . The analyses were repeated twice with experiments performed on independent extract preparations, with one additional supporting set of results with anti-XenC immunodepletion.

    Techniques Used: Concentration Assay

    XMAP215 stimulates microtubule nucleation by γ-TuRC (A) Negative stain electron microscopy shows 25 nm diameter ring structures characteristic of the γ-tubulin ring complex. Scale bar, 100 nm. The experiment was repeated thrice, with at least three supporting experiments with sucrose-gradient fractionated γ-TuRC, all showing distinct γ-TuRC ring structures. (B) The peptide-eluted γ-TuRC was fractionated by sucrose gradient centrifugation. Fractions were analyzed by Silver-stained SDS-PAGE (top) and immunoblot (bottom) with antibodies against γ-tubulin, GCP5 and GCP4. These components were observed to peak in fractions 5 and 6, at the expected size for intact γ-TuRC. The bands for GCP6, 5, 4, 3, 2, γ-tubulin, NEDD1 and Mzt2 can clearly be seen in fractions 5 and 6 using silver staining. Representative image is displayed, and the experiment was repeated more than three times. See Supplementary Fig. 9 for unprocessed scans. (C) Combination of purified γ-TuRC and XMAP215 promotes MT nucleation in vitro . Purified γ-TuRC at 250–400 pM added to αβ-tubulin with GTP promotes MT nucleation as compared to control (elution from IgG beads, upper left panel). Addition of recombinant XMAP215, at concentrations from 5 nM to 130 nM, promotes low levels of MT nucleation, with bundling and increased MT length seen at high concentrations. Addition of both XMAP215 and γ-TuRC together causes a significant increase in the number of MTs nucleated, greater than simply adding the MTs generated by each component independently. Representative fields of MTs are shown, nucleation assays were repeated with at least 3 independent γ-TuRC purifications. Scale bar, 10 μm. (D) Fluorescent intensity was quantified as the readout of amount of polymerized tubulin for 10 fields of view for each reaction condition. Data from three independent γ-TuRC preparations was pooled and displayed as mean±s.d. n=30 fields of view analyzed per reaction. The XMAP215+γ-TuRC reactions had greater fluorescent intensity as compared to control. A significant increase between microtubule mass can be seen starting from 35nM XMAP215 when combined with γ-TuRC. See Supplementary Fig. 4 .
    Figure Legend Snippet: XMAP215 stimulates microtubule nucleation by γ-TuRC (A) Negative stain electron microscopy shows 25 nm diameter ring structures characteristic of the γ-tubulin ring complex. Scale bar, 100 nm. The experiment was repeated thrice, with at least three supporting experiments with sucrose-gradient fractionated γ-TuRC, all showing distinct γ-TuRC ring structures. (B) The peptide-eluted γ-TuRC was fractionated by sucrose gradient centrifugation. Fractions were analyzed by Silver-stained SDS-PAGE (top) and immunoblot (bottom) with antibodies against γ-tubulin, GCP5 and GCP4. These components were observed to peak in fractions 5 and 6, at the expected size for intact γ-TuRC. The bands for GCP6, 5, 4, 3, 2, γ-tubulin, NEDD1 and Mzt2 can clearly be seen in fractions 5 and 6 using silver staining. Representative image is displayed, and the experiment was repeated more than three times. See Supplementary Fig. 9 for unprocessed scans. (C) Combination of purified γ-TuRC and XMAP215 promotes MT nucleation in vitro . Purified γ-TuRC at 250–400 pM added to αβ-tubulin with GTP promotes MT nucleation as compared to control (elution from IgG beads, upper left panel). Addition of recombinant XMAP215, at concentrations from 5 nM to 130 nM, promotes low levels of MT nucleation, with bundling and increased MT length seen at high concentrations. Addition of both XMAP215 and γ-TuRC together causes a significant increase in the number of MTs nucleated, greater than simply adding the MTs generated by each component independently. Representative fields of MTs are shown, nucleation assays were repeated with at least 3 independent γ-TuRC purifications. Scale bar, 10 μm. (D) Fluorescent intensity was quantified as the readout of amount of polymerized tubulin for 10 fields of view for each reaction condition. Data from three independent γ-TuRC preparations was pooled and displayed as mean±s.d. n=30 fields of view analyzed per reaction. The XMAP215+γ-TuRC reactions had greater fluorescent intensity as compared to control. A significant increase between microtubule mass can be seen starting from 35nM XMAP215 when combined with γ-TuRC. See Supplementary Fig. 4 .

    Techniques Used: Staining, Electron Microscopy, Gradient Centrifugation, SDS Page, Silver Staining, Purification, In Vitro, Recombinant, Generated

    C-terminus of XMAP215 is required for microtubule nucleation with γ-TuRC (A) Polymerization from stabilized seeds was performed with several XMAP215 constructs: wild-type XMAP215, TOG1-5, TOG12-Kloop, TOG5-CT. Growth speed was measured from kymographs and plotted against protein concentration. Number of kymographs analysed (n): Buffer (n=21); XMAP215-WT: 75nM (n=43), 120nM (n=62), 150nM (n=141), 300nM (n=131), 590nM (n=53); TOG1-5: 35nM (n=12), 70nM (n=24), 140nM (n=57), 280nM (n=84), 560nM (n=49), 1000nM (n=59); TOG12-Kloop: 55nM (n=21), 110nM (n=51), 220nM (n=44), 460nM (n=70), 1000nM (n=32); TOG5-CT: 120nM (n-53), 480nM (n=74), 1000nM (n=46). Shaded region represents s.d. at individual concentrations. Michaelis-Menten fit to all measurements versus concentration is displayed (solid curves). (B) Branching MT nucleation activity of XMAP215 constructs in (A) was observed in Xenopus egg extracts. Proteins were added to XMAP215-depleted extract at specified final concentration along with 5.5μM RanQ69L and 1μM GST-TPX2 α3-7. Rate of MT nucleation was measured from linear region of nucleation curves (representative plot for TOG1-5 shown in Supplementary Fig. 6B ). Rate of nucleation by 120nM wild-type XMAP215 was normalized to 1 in each experimental set with Xenopus extracts. Where more than one reaction at 120nM wild-type XMAP215 was performed, their average was set to 1. Data was pooled from the following independent extract preparations: wild-type XMAP215(8), TOG1-5 protein(4), TOG12-Kloop(3), and TOG5-CT(2). Normalized rate of nucleation versus protein concentration was fit to straight line, with shaded region representing 95% confidence interval. See Supplementary Video 9 . (C–D) Purified γ-TuRC was incubated with wild-type XMAP215 or TOG1-5 to promote MT nucleation in vitro . Addition of 30–120nM wild-type XMAP215 promotes synergistic MT nucleation with γ-TuRC, while TOG1-5 shows minimal synergy with γ-TuRC. Representative fields of MTs are displayed. Experiments were repeated with two independent γ-TuRC purifications. Scale bar, 10μm. (D) Quantification of total fluorescent intensity. All data from two independent γ-TuRC preparations was pooled and plotted as mean±s.d., except 30nM TOG1-5 condition, which was performed with one γ-TuRC preparation. γ-TuRC (n=44); XMAP215: 30nM (n=20), 60nM (n=50), 120nM (n=43); TOG1-5: 30nM (n=20), 60nM (n=39), 120nM (n=44); γ-TuRC+XMAP215 30nM (n=20), 60nM (n=45), 120nM (n=39); γ-TuRC+TOG1-5: 30nM (n=20), 60nM (n=41), 120nM (n=41). n represents the number of fields of view analyzed. See Supplementary Table 1 for source data of Figs. 6B–D, and Supplementary Fig. 6 .
    Figure Legend Snippet: C-terminus of XMAP215 is required for microtubule nucleation with γ-TuRC (A) Polymerization from stabilized seeds was performed with several XMAP215 constructs: wild-type XMAP215, TOG1-5, TOG12-Kloop, TOG5-CT. Growth speed was measured from kymographs and plotted against protein concentration. Number of kymographs analysed (n): Buffer (n=21); XMAP215-WT: 75nM (n=43), 120nM (n=62), 150nM (n=141), 300nM (n=131), 590nM (n=53); TOG1-5: 35nM (n=12), 70nM (n=24), 140nM (n=57), 280nM (n=84), 560nM (n=49), 1000nM (n=59); TOG12-Kloop: 55nM (n=21), 110nM (n=51), 220nM (n=44), 460nM (n=70), 1000nM (n=32); TOG5-CT: 120nM (n-53), 480nM (n=74), 1000nM (n=46). Shaded region represents s.d. at individual concentrations. Michaelis-Menten fit to all measurements versus concentration is displayed (solid curves). (B) Branching MT nucleation activity of XMAP215 constructs in (A) was observed in Xenopus egg extracts. Proteins were added to XMAP215-depleted extract at specified final concentration along with 5.5μM RanQ69L and 1μM GST-TPX2 α3-7. Rate of MT nucleation was measured from linear region of nucleation curves (representative plot for TOG1-5 shown in Supplementary Fig. 6B ). Rate of nucleation by 120nM wild-type XMAP215 was normalized to 1 in each experimental set with Xenopus extracts. Where more than one reaction at 120nM wild-type XMAP215 was performed, their average was set to 1. Data was pooled from the following independent extract preparations: wild-type XMAP215(8), TOG1-5 protein(4), TOG12-Kloop(3), and TOG5-CT(2). Normalized rate of nucleation versus protein concentration was fit to straight line, with shaded region representing 95% confidence interval. See Supplementary Video 9 . (C–D) Purified γ-TuRC was incubated with wild-type XMAP215 or TOG1-5 to promote MT nucleation in vitro . Addition of 30–120nM wild-type XMAP215 promotes synergistic MT nucleation with γ-TuRC, while TOG1-5 shows minimal synergy with γ-TuRC. Representative fields of MTs are displayed. Experiments were repeated with two independent γ-TuRC purifications. Scale bar, 10μm. (D) Quantification of total fluorescent intensity. All data from two independent γ-TuRC preparations was pooled and plotted as mean±s.d., except 30nM TOG1-5 condition, which was performed with one γ-TuRC preparation. γ-TuRC (n=44); XMAP215: 30nM (n=20), 60nM (n=50), 120nM (n=43); TOG1-5: 30nM (n=20), 60nM (n=39), 120nM (n=44); γ-TuRC+XMAP215 30nM (n=20), 60nM (n=45), 120nM (n=39); γ-TuRC+TOG1-5: 30nM (n=20), 60nM (n=41), 120nM (n=41). n represents the number of fields of view analyzed. See Supplementary Table 1 for source data of Figs. 6B–D, and Supplementary Fig. 6 .

    Techniques Used: Construct, Protein Concentration, Concentration Assay, Activity Assay, Purification, Incubation, In Vitro

    XMAP215 stimulates microtubule nucleation in Xenopus egg extract (A–B) Western blot analysis of XMAP215 or IgG immunodepletion from Xenopus extracts and add-back of wild-type XMAP215-GFP, probed using antibody against TOG12 domain. Branching MT nucleation in Xenopus extracts in the presence of 5.5μM RanQ69L. EB1-mCherry (pseudo-colored as green) and Cy5-labeled tubulin (red) was added. XMAP215-GFP was added back at 85nM (equivalent to 120nM in IgG-depleted extract). Representative images are displayed at 20 minutes of the reaction. Scale bar, 10μm. The experiments were repeated at least three times with independent extract preparations. (C) Increasing concentration of XMAP215-GFP added back to immunodepleted extract with 5.5μM RanQ69L. Representative images are displayed at 480 seconds. Scale bar, 10μm. See Supplementary Video 2 . The experiment was repeated four times with independent extract preparations. (D) EB1 comets in the entire field of view were detected, counted and plotted with time. The analyses in (D–F) were repeated at least thrice with independent extract preparations. (E) Growth speed of MTs was obtained by tracking all EB1 comets observed over during the experiment. No MTs nucleated below 30nM XMAP215, and growth speed was not measured. At 30nM, growth speed was measured manually as 2.3±0.8 μm/min (mean ± s.d.; n=25). For 60nM and above, growth speed was computed via image analysis: 60nM–8.0±1.9 (n=1470), 85nM–8.5±1.8 (n=18190), 120nM–9.3±2.0 (n=45090), 240nM–9.6±2.2 (n=59297), 480nM–10.5±2.4 (n=79381) and 720nM–11.1±2.7 μm/min (n=147008). n represents the number of growth speed measurements obtained from consecutive frames of all tracks. Mean speed (red squares) versus concentration was fit to Michaelis-Menten kinetics (dashed red). Rate of nucleation (blue diamonds) was measured as the slope of linear region of nucleation kinetics. Rate of nucleation versus concentration was regressed to straight line (dashed blue). 95% confidence intervals of the fits are shaded. (F) De novo nucleation events and branched networks that emerged were counted manually for each reaction (magenta triangles and green circles respectively). Linear fit to each is plotted as solid and dashed curves. x-axis displayed in log scale, where 0nM concentration cannot be shown (green circles). See Supplementary Figs. 1 and 9 , Supplementary Video 1 , and Supplementary Table 2 for source data.
    Figure Legend Snippet: XMAP215 stimulates microtubule nucleation in Xenopus egg extract (A–B) Western blot analysis of XMAP215 or IgG immunodepletion from Xenopus extracts and add-back of wild-type XMAP215-GFP, probed using antibody against TOG12 domain. Branching MT nucleation in Xenopus extracts in the presence of 5.5μM RanQ69L. EB1-mCherry (pseudo-colored as green) and Cy5-labeled tubulin (red) was added. XMAP215-GFP was added back at 85nM (equivalent to 120nM in IgG-depleted extract). Representative images are displayed at 20 minutes of the reaction. Scale bar, 10μm. The experiments were repeated at least three times with independent extract preparations. (C) Increasing concentration of XMAP215-GFP added back to immunodepleted extract with 5.5μM RanQ69L. Representative images are displayed at 480 seconds. Scale bar, 10μm. See Supplementary Video 2 . The experiment was repeated four times with independent extract preparations. (D) EB1 comets in the entire field of view were detected, counted and plotted with time. The analyses in (D–F) were repeated at least thrice with independent extract preparations. (E) Growth speed of MTs was obtained by tracking all EB1 comets observed over during the experiment. No MTs nucleated below 30nM XMAP215, and growth speed was not measured. At 30nM, growth speed was measured manually as 2.3±0.8 μm/min (mean ± s.d.; n=25). For 60nM and above, growth speed was computed via image analysis: 60nM–8.0±1.9 (n=1470), 85nM–8.5±1.8 (n=18190), 120nM–9.3±2.0 (n=45090), 240nM–9.6±2.2 (n=59297), 480nM–10.5±2.4 (n=79381) and 720nM–11.1±2.7 μm/min (n=147008). n represents the number of growth speed measurements obtained from consecutive frames of all tracks. Mean speed (red squares) versus concentration was fit to Michaelis-Menten kinetics (dashed red). Rate of nucleation (blue diamonds) was measured as the slope of linear region of nucleation kinetics. Rate of nucleation versus concentration was regressed to straight line (dashed blue). 95% confidence intervals of the fits are shaded. (F) De novo nucleation events and branched networks that emerged were counted manually for each reaction (magenta triangles and green circles respectively). Linear fit to each is plotted as solid and dashed curves. x-axis displayed in log scale, where 0nM concentration cannot be shown (green circles). See Supplementary Figs. 1 and 9 , Supplementary Video 1 , and Supplementary Table 2 for source data.

    Techniques Used: Western Blot, Labeling, Concentration Assay

    13) Product Images from "A PAX5-OCT4-PRDM1 Developmental Switch Specifies Human Primordial Germ Cells"

    Article Title: A PAX5-OCT4-PRDM1 Developmental Switch Specifies Human Primordial Germ Cells

    Journal: Nature cell biology

    doi: 10.1038/s41556-018-0094-3

    Role of PAX5 and PRDM1 in hPGC specification in vitro ( a–c ) RT-qPCR analysis of gene expression in all three germ layers in H1 hESCs, PAX5 OE cells ( a ) and H1 hESCs, PAX5 KO cells ( b ) and H1 hESCs, PRDM1 KO cells ( c ) after BMP induced differentiation. Data are represented as mean ± SD of n=3 independent replicates. P-values were calculated by two-tailed Student’s t-test. ( d ) Proposed molecular model for transcriptional network centered by PAX5 , OCT4 and PRDM1 in hPGCs. Upon induced germ cell differentiation with BMPs, OCT4 expression is reduced to moderate levels and maintained in partnership with PAX5. To efficiently induce germline programs, OCT4 represses ectodermal genes and at the same time, together with PAX5 , activates PRDM1 to repress mesodermal and endodermal genes. In PAX5 KO cells, OCT4 expression has decreased to levels so low that the expression of ectodermal genes has not been suppressed effectively. Thus, the efficiency of induction of germ cells is low in PAX5 KO cells and lower in PRDM1 KO cells: due to low expression of OCT4 and loss of PRDM1 function, genes in all somatic lineages are upregulated and germ cell programs fail to be activated. ( e ) Summary of data establishing roles of PAX5 and PRDM1 in hPGC specification in vitro and in vivo. The identity of hESCs is maintained by core transcriptional network centered by OCT4, SOX2 and NANOG. Induced by BMP signals in vitro or in vivo by xenotransplantation, hESCs start to differentiate to early hPGCs, which express early germ cell markers, such as OCT4 , SOX17 , PRDM1 and NANOS3 (Grey line with arrowhead); Overexpression of PAX5 is able to enhance the efficiency to early hPGCs and promote early hPGCs to the later stage, which express mature germ cell markers, such as DDX4 , DAZL and DAZ1 (Black line with arrowhead). Loss of PAX5 significantly reduces germ cell potential of hESCs (Grey dotted line with arrowhead), while loss of PRDM1 leads to failure of hPGC specification (red line with an end bar). Source data for a – c are in Supplementary Table 2 .
    Figure Legend Snippet: Role of PAX5 and PRDM1 in hPGC specification in vitro ( a–c ) RT-qPCR analysis of gene expression in all three germ layers in H1 hESCs, PAX5 OE cells ( a ) and H1 hESCs, PAX5 KO cells ( b ) and H1 hESCs, PRDM1 KO cells ( c ) after BMP induced differentiation. Data are represented as mean ± SD of n=3 independent replicates. P-values were calculated by two-tailed Student’s t-test. ( d ) Proposed molecular model for transcriptional network centered by PAX5 , OCT4 and PRDM1 in hPGCs. Upon induced germ cell differentiation with BMPs, OCT4 expression is reduced to moderate levels and maintained in partnership with PAX5. To efficiently induce germline programs, OCT4 represses ectodermal genes and at the same time, together with PAX5 , activates PRDM1 to repress mesodermal and endodermal genes. In PAX5 KO cells, OCT4 expression has decreased to levels so low that the expression of ectodermal genes has not been suppressed effectively. Thus, the efficiency of induction of germ cells is low in PAX5 KO cells and lower in PRDM1 KO cells: due to low expression of OCT4 and loss of PRDM1 function, genes in all somatic lineages are upregulated and germ cell programs fail to be activated. ( e ) Summary of data establishing roles of PAX5 and PRDM1 in hPGC specification in vitro and in vivo. The identity of hESCs is maintained by core transcriptional network centered by OCT4, SOX2 and NANOG. Induced by BMP signals in vitro or in vivo by xenotransplantation, hESCs start to differentiate to early hPGCs, which express early germ cell markers, such as OCT4 , SOX17 , PRDM1 and NANOS3 (Grey line with arrowhead); Overexpression of PAX5 is able to enhance the efficiency to early hPGCs and promote early hPGCs to the later stage, which express mature germ cell markers, such as DDX4 , DAZL and DAZ1 (Black line with arrowhead). Loss of PAX5 significantly reduces germ cell potential of hESCs (Grey dotted line with arrowhead), while loss of PRDM1 leads to failure of hPGC specification (red line with an end bar). Source data for a – c are in Supplementary Table 2 .

    Techniques Used: In Vitro, Quantitative RT-PCR, Expressing, Two Tailed Test, Cell Differentiation, In Vivo, Over Expression

    Overexpression PAX5 and PRDM1 enhance germ cell potential of ESCs ( a ) Heatmap of FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values for genes associated with germline (top) and pluripotency (bottom). _BMPs: differentiated by BMPs; OE: overexpression. ( b ) Immunostaining of differentiated cells from hESCs and PAX5 OE cells for DDX4 and DAPI. Scale bars represent 50 μm. Immunostaining experiments were independently repeated a minimum of three times with similar results. ( c ) Gating strategy to sort mOrange+ cells from the H1 hESC line after differentiation by BMPs. ( d ) Schematic experimental design of xenotransplantion. Transplantations were performed by independently injecting GFP tagged human cells directly into seminiferous tubules of busulfan-treated mouse testes that were depleted of endogenous germ cells. Testis xenografts were analyzed by immunohistochemistry 2 months after injection. ( e ) Immunohistochemical analysis of testis xenografts derived from PAX5 OE, PRDM1 OE and control H1 hESCs. In all panels, dashed white lines indicate the outer edges of spermatogonial tubules and enlarged view are shown on the right. White asterisks represent GFP+/DDX4+ donor cells near the basement membrane. Scale bars represent 50 μm. Immunostaining experiments were independently repeated a minimum of three times with similar results. ( f ) Immunostaining of testis xenografts derived from PAX5 OE H1 hESCs for later stage PGC markers DAZL and DAZ1. Enlarged panel on the right represents the region enclosed within the white rectangles of the left panel. Scale bars represent 50 μm. Immunostaining experiments were independently repeated a minimum of three times with similar results. ( g ) Percentage of tubules positive for GFP+/DDX4+ cells were calculated across multiple cross-sections (relative to total number of tubules). Data are represented as mean ± SD of n= 4 independent replicates. P-values were calculated by two-tailed Student’s t-test. ( h ) For each positive tubule, the ratio of GFP+/DDX4+ cells per tubule was determined. Data are represented as mean ± SD of n=5 independent replicates. P-values were calculated by two-tailed Student’s t-test. Source data for g and h are in Supplementary Table 2 .
    Figure Legend Snippet: Overexpression PAX5 and PRDM1 enhance germ cell potential of ESCs ( a ) Heatmap of FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values for genes associated with germline (top) and pluripotency (bottom). _BMPs: differentiated by BMPs; OE: overexpression. ( b ) Immunostaining of differentiated cells from hESCs and PAX5 OE cells for DDX4 and DAPI. Scale bars represent 50 μm. Immunostaining experiments were independently repeated a minimum of three times with similar results. ( c ) Gating strategy to sort mOrange+ cells from the H1 hESC line after differentiation by BMPs. ( d ) Schematic experimental design of xenotransplantion. Transplantations were performed by independently injecting GFP tagged human cells directly into seminiferous tubules of busulfan-treated mouse testes that were depleted of endogenous germ cells. Testis xenografts were analyzed by immunohistochemistry 2 months after injection. ( e ) Immunohistochemical analysis of testis xenografts derived from PAX5 OE, PRDM1 OE and control H1 hESCs. In all panels, dashed white lines indicate the outer edges of spermatogonial tubules and enlarged view are shown on the right. White asterisks represent GFP+/DDX4+ donor cells near the basement membrane. Scale bars represent 50 μm. Immunostaining experiments were independently repeated a minimum of three times with similar results. ( f ) Immunostaining of testis xenografts derived from PAX5 OE H1 hESCs for later stage PGC markers DAZL and DAZ1. Enlarged panel on the right represents the region enclosed within the white rectangles of the left panel. Scale bars represent 50 μm. Immunostaining experiments were independently repeated a minimum of three times with similar results. ( g ) Percentage of tubules positive for GFP+/DDX4+ cells were calculated across multiple cross-sections (relative to total number of tubules). Data are represented as mean ± SD of n= 4 independent replicates. P-values were calculated by two-tailed Student’s t-test. ( h ) For each positive tubule, the ratio of GFP+/DDX4+ cells per tubule was determined. Data are represented as mean ± SD of n=5 independent replicates. P-values were calculated by two-tailed Student’s t-test. Source data for g and h are in Supplementary Table 2 .

    Techniques Used: Over Expression, Immunostaining, Immunohistochemistry, Injection, Derivative Assay, Pyrolysis Gas Chromatography, Two Tailed Test

    14) Product Images from "Membrane fluidity is regulated by the C. elegans transmembrane protein FLD-1 and its human homologs TLCD1/2"

    Article Title: Membrane fluidity is regulated by the C. elegans transmembrane protein FLD-1 and its human homologs TLCD1/2

    Journal: eLife

    doi: 10.7554/eLife.40686

    fld-1 single mutant worms have no obvious phenotype. The single mutants fld-1(et48) and fld-1(et49) had no obvious phenotype though they often suppressed the paqr-2 mutant defects for the following traits: ( A ) brood size, ( B ) pharyngeal pumping rate, ( C ) speed of locomotion, ( D ) defecation rate, ( E ) survival at 37°C, ( F ) survival at 30°C, ( G ) body length 3 days after placing L1s NGM plates containing various concentration of NP-40 detergent (from left to right for each genotype: 0%, 0.01%, 0.05%, 0.1% and 0.2%) and ( H ) expression of the UPR er reporter hsp-4::GFP (expressed in arbitrary fluorescence units) and ( I ) lifespan (done only for control N2 and fld-1(et48) . Unless otherwise stated, assays were performed on 1 day old adults. ( J ) expression of the oxidative stress reporter gst-4::GFP (expressed in fluorescence units normalized to the control) of transgenic worms cultivated with E. coli pre-loaded with/without 40 mM linoleic acid. ( K–L ) Representative images of worms from the experiment described in ( J ).
    Figure Legend Snippet: fld-1 single mutant worms have no obvious phenotype. The single mutants fld-1(et48) and fld-1(et49) had no obvious phenotype though they often suppressed the paqr-2 mutant defects for the following traits: ( A ) brood size, ( B ) pharyngeal pumping rate, ( C ) speed of locomotion, ( D ) defecation rate, ( E ) survival at 37°C, ( F ) survival at 30°C, ( G ) body length 3 days after placing L1s NGM plates containing various concentration of NP-40 detergent (from left to right for each genotype: 0%, 0.01%, 0.05%, 0.1% and 0.2%) and ( H ) expression of the UPR er reporter hsp-4::GFP (expressed in arbitrary fluorescence units) and ( I ) lifespan (done only for control N2 and fld-1(et48) . Unless otherwise stated, assays were performed on 1 day old adults. ( J ) expression of the oxidative stress reporter gst-4::GFP (expressed in fluorescence units normalized to the control) of transgenic worms cultivated with E. coli pre-loaded with/without 40 mM linoleic acid. ( K–L ) Representative images of worms from the experiment described in ( J ).

    Techniques Used: Mutagenesis, Concentration Assay, Expressing, Fluorescence, Transgenic Assay

    Tissue-specific expression of FLD-1::GFP. ( A ) Structure of FLD-1::GFP expression constructs driven by different promoters whereby the fld-1 promoter is ubiquitously expressed, the elt-3 promoter is hypodermis-specific and the ges-1 promoter is intestine-specific. ( B ) The FLD-1::GFP fusion protein is functional since it restores the glucose sensitivity in paqr-2;fld-1(et49) double mutant worms; note that this construct has no adverse effects in wild-type N2 worms. ( C ) Expression of FLD-1::GFP in either hypodermis or intestine also restores glucose sensitivity to paqr-2;fld-1(et49) double mutant worms. The dashed lines indicate the approximate length of the L1s at the start of the experiment (~250 μm).
    Figure Legend Snippet: Tissue-specific expression of FLD-1::GFP. ( A ) Structure of FLD-1::GFP expression constructs driven by different promoters whereby the fld-1 promoter is ubiquitously expressed, the elt-3 promoter is hypodermis-specific and the ges-1 promoter is intestine-specific. ( B ) The FLD-1::GFP fusion protein is functional since it restores the glucose sensitivity in paqr-2;fld-1(et49) double mutant worms; note that this construct has no adverse effects in wild-type N2 worms. ( C ) Expression of FLD-1::GFP in either hypodermis or intestine also restores glucose sensitivity to paqr-2;fld-1(et49) double mutant worms. The dashed lines indicate the approximate length of the L1s at the start of the experiment (~250 μm).

    Techniques Used: Expressing, Construct, Functional Assay, Mutagenesis

    15) Product Images from "Membrane fluidity is regulated by the C. elegans transmembrane protein FLD-1 and its human homologs TLCD1/2"

    Article Title: Membrane fluidity is regulated by the C. elegans transmembrane protein FLD-1 and its human homologs TLCD1/2

    Journal: eLife

    doi: 10.7554/eLife.40686

    fld-1 single mutant worms have no obvious phenotype. The single mutants fld-1(et48) and fld-1(et49) had no obvious phenotype though they often suppressed the paqr-2 mutant defects for the following traits: ( A ) brood size, ( B ) pharyngeal pumping rate, ( C ) speed of locomotion, ( D ) defecation rate, ( E ) survival at 37°C, ( F ) survival at 30°C, ( G ) body length 3 days after placing L1s NGM plates containing various concentration of NP-40 detergent (from left to right for each genotype: 0%, 0.01%, 0.05%, 0.1% and 0.2%) and ( H ) expression of the UPR er reporter hsp-4::GFP (expressed in arbitrary fluorescence units) and ( I ) lifespan (done only for control N2 and fld-1(et48) . Unless otherwise stated, assays were performed on 1 day old adults. ( J ) expression of the oxidative stress reporter gst-4::GFP (expressed in fluorescence units normalized to the control) of transgenic worms cultivated with E. coli pre-loaded with/without 40 mM linoleic acid. ( K–L ) Representative images of worms from the experiment described in ( J ).
    Figure Legend Snippet: fld-1 single mutant worms have no obvious phenotype. The single mutants fld-1(et48) and fld-1(et49) had no obvious phenotype though they often suppressed the paqr-2 mutant defects for the following traits: ( A ) brood size, ( B ) pharyngeal pumping rate, ( C ) speed of locomotion, ( D ) defecation rate, ( E ) survival at 37°C, ( F ) survival at 30°C, ( G ) body length 3 days after placing L1s NGM plates containing various concentration of NP-40 detergent (from left to right for each genotype: 0%, 0.01%, 0.05%, 0.1% and 0.2%) and ( H ) expression of the UPR er reporter hsp-4::GFP (expressed in arbitrary fluorescence units) and ( I ) lifespan (done only for control N2 and fld-1(et48) . Unless otherwise stated, assays were performed on 1 day old adults. ( J ) expression of the oxidative stress reporter gst-4::GFP (expressed in fluorescence units normalized to the control) of transgenic worms cultivated with E. coli pre-loaded with/without 40 mM linoleic acid. ( K–L ) Representative images of worms from the experiment described in ( J ).

    Techniques Used: Mutagenesis, Concentration Assay, Expressing, Fluorescence, Transgenic Assay

    Tissue-specific expression of FLD-1::GFP. ( A ) Structure of FLD-1::GFP expression constructs driven by different promoters whereby the fld-1 promoter is ubiquitously expressed, the elt-3 promoter is hypodermis-specific and the ges-1 promoter is intestine-specific. ( B ) The FLD-1::GFP fusion protein is functional since it restores the glucose sensitivity in paqr-2;fld-1(et49) double mutant worms; note that this construct has no adverse effects in wild-type N2 worms. ( C ) Expression of FLD-1::GFP in either hypodermis or intestine also restores glucose sensitivity to paqr-2;fld-1(et49) double mutant worms. The dashed lines indicate the approximate length of the L1s at the start of the experiment (~250 μm).
    Figure Legend Snippet: Tissue-specific expression of FLD-1::GFP. ( A ) Structure of FLD-1::GFP expression constructs driven by different promoters whereby the fld-1 promoter is ubiquitously expressed, the elt-3 promoter is hypodermis-specific and the ges-1 promoter is intestine-specific. ( B ) The FLD-1::GFP fusion protein is functional since it restores the glucose sensitivity in paqr-2;fld-1(et49) double mutant worms; note that this construct has no adverse effects in wild-type N2 worms. ( C ) Expression of FLD-1::GFP in either hypodermis or intestine also restores glucose sensitivity to paqr-2;fld-1(et49) double mutant worms. The dashed lines indicate the approximate length of the L1s at the start of the experiment (~250 μm).

    Techniques Used: Expressing, Construct, Functional Assay, Mutagenesis

    16) Product Images from "Zebrafish Connexin 79.8 (Gja8a): a lens connexin used as an electrical synapse in some neurons"

    Article Title: Zebrafish Connexin 79.8 (Gja8a): a lens connexin used as an electrical synapse in some neurons

    Journal: Developmental neurobiology

    doi: 10.1002/dneu.22418

    Tests of anti-Cx79.8 antibodies. (A, D) Immunofluorescence labeling of Cx79.8-EGFP (green; intrinsic fluorescence) transiently transfected in HeLa cells using Cx79.8-345 antibody (red, A) or Cx79.8-645 antibody (red, D). Control labeling of EGFP empty vector transfected HeLa cells using the same labeling and imaging conditions is shown for Cx79.8-345 antibody in B and for Cx79.8-645 antibody in E. (C, F) Labeling of 5 dpf wild type zebrafish fry lens with Cx79.8-345 antibody (green, C) or Cx79.8-645 antibody (green, F). Both antibodies specifically label Cx79.8-EGFP and both label abundant gap junctions in the lens. Scale bars in A, B, D and E are of the same dimensions; scale bars in C and F are of the same dimensions.
    Figure Legend Snippet: Tests of anti-Cx79.8 antibodies. (A, D) Immunofluorescence labeling of Cx79.8-EGFP (green; intrinsic fluorescence) transiently transfected in HeLa cells using Cx79.8-345 antibody (red, A) or Cx79.8-645 antibody (red, D). Control labeling of EGFP empty vector transfected HeLa cells using the same labeling and imaging conditions is shown for Cx79.8-345 antibody in B and for Cx79.8-645 antibody in E. (C, F) Labeling of 5 dpf wild type zebrafish fry lens with Cx79.8-345 antibody (green, C) or Cx79.8-645 antibody (green, F). Both antibodies specifically label Cx79.8-EGFP and both label abundant gap junctions in the lens. Scale bars in A, B, D and E are of the same dimensions; scale bars in C and F are of the same dimensions.

    Techniques Used: Immunofluorescence, Labeling, Fluorescence, Transfection, Plasmid Preparation, Imaging

    Tracer coupling supported by Cx79.8 in HeLa cells. Drug treatments in all panels include no treatment (Con), 10 μM PKA antagonist Rp-8-cpt-cAMPS (Rp), 10 μM PKA agonist Sp-8-cpt-cAMPS (Sp), and 0.5 nM PP2A antagonist Microcystin LR (Mic). (A) Transfection with EGFP empty vector alone; (B) transfection with Cx79.8-EGFP; (C) transfection with untagged Cx79.8. Data shown are mean diffusion coefficients for Neurobiotin transfer for 3 to 6 experiments; ** p
    Figure Legend Snippet: Tracer coupling supported by Cx79.8 in HeLa cells. Drug treatments in all panels include no treatment (Con), 10 μM PKA antagonist Rp-8-cpt-cAMPS (Rp), 10 μM PKA agonist Sp-8-cpt-cAMPS (Sp), and 0.5 nM PP2A antagonist Microcystin LR (Mic). (A) Transfection with EGFP empty vector alone; (B) transfection with Cx79.8-EGFP; (C) transfection with untagged Cx79.8. Data shown are mean diffusion coefficients for Neurobiotin transfer for 3 to 6 experiments; ** p

    Techniques Used: Cycling Probe Technology, Transfection, Plasmid Preparation, Diffusion-based Assay

    Alignment of predicted amino acid sequences of the zebrafish Cx50 homologues Cx79.8 and Cx44.1 with mouse Cx50 and chicken Cx45.6. Alignment symbols below the sequences indicate complete identity among all four sequences (*), high conservation of amino acid character (:), and modest conservation (.). Predicted transmembrane domains are highlighted with gray boxes and labeled M1 – M4. The end point of the cx50.5 cDNA sequence is designated by the dashed line through the alignment. Epitopes used to generate anti-Cx79.8 antibodies are outlined and labeled. Note the high degree of sequence conservation at the tip of the C-terminus.
    Figure Legend Snippet: Alignment of predicted amino acid sequences of the zebrafish Cx50 homologues Cx79.8 and Cx44.1 with mouse Cx50 and chicken Cx45.6. Alignment symbols below the sequences indicate complete identity among all four sequences (*), high conservation of amino acid character (:), and modest conservation (.). Predicted transmembrane domains are highlighted with gray boxes and labeled M1 – M4. The end point of the cx50.5 cDNA sequence is designated by the dashed line through the alignment. Epitopes used to generate anti-Cx79.8 antibodies are outlined and labeled. Note the high degree of sequence conservation at the tip of the C-terminus.

    Techniques Used: Labeling, Sequencing

    Marker gene expression driven by the cx79.8 promoter. (A, B) Conventional epifluorescence images of EGFP fluorescence in 3 dpf zebrafish fry with a high level of expression from stably-integrated −5.4 cx79.8 ::EGFP transgene constructs. Expression was prominent in the lens and a faint patch of fluorescence was also present at the midbrain-hindbrain boundary (arrowheads). (C-H) Light sheet images of 4 dpf zebrafish fry from the same line. (C) Ventral view showing expression in the lens. EGFP fluorescence is shown in green; the red channel shows autofluorescence detected in the Cy3 channel (shown in C and E-G). Autofluorescence is detected in both channels and appears orange to yellow, while EGFP fluorescence appears pure green. (D) Axial view of lens EGFP fluorescence at reduced gain to show detail of lens fiber cells. (E-H) Dorsal views at three planes of focus showing the web of EGFP-labeled neurons and processes at the midbrain-hindbrain boundary. The granular eminence (ge) of the cerebellum is labeled; see text for discussion of labeled cells (E) 21 μm thick projection at most dorsal level; (F) 25 μm thick projection centered 44 μm ventrally from E; (G) 84 μm thick projection centered 59 μm ventrally from F. (H) Higher magnification view of the projection neurons shown in G. (I) z-axis projection of labeled brain neurons. Some projections to the optic tectum and within the cerebellum/midbrain are marked with arrowheads. Scale bar dimensions in A are the same in B,C and E-G; other scale bars as noted.
    Figure Legend Snippet: Marker gene expression driven by the cx79.8 promoter. (A, B) Conventional epifluorescence images of EGFP fluorescence in 3 dpf zebrafish fry with a high level of expression from stably-integrated −5.4 cx79.8 ::EGFP transgene constructs. Expression was prominent in the lens and a faint patch of fluorescence was also present at the midbrain-hindbrain boundary (arrowheads). (C-H) Light sheet images of 4 dpf zebrafish fry from the same line. (C) Ventral view showing expression in the lens. EGFP fluorescence is shown in green; the red channel shows autofluorescence detected in the Cy3 channel (shown in C and E-G). Autofluorescence is detected in both channels and appears orange to yellow, while EGFP fluorescence appears pure green. (D) Axial view of lens EGFP fluorescence at reduced gain to show detail of lens fiber cells. (E-H) Dorsal views at three planes of focus showing the web of EGFP-labeled neurons and processes at the midbrain-hindbrain boundary. The granular eminence (ge) of the cerebellum is labeled; see text for discussion of labeled cells (E) 21 μm thick projection at most dorsal level; (F) 25 μm thick projection centered 44 μm ventrally from E; (G) 84 μm thick projection centered 59 μm ventrally from F. (H) Higher magnification view of the projection neurons shown in G. (I) z-axis projection of labeled brain neurons. Some projections to the optic tectum and within the cerebellum/midbrain are marked with arrowheads. Scale bar dimensions in A are the same in B,C and E-G; other scale bars as noted.

    Techniques Used: Marker, Expressing, Fluorescence, Stable Transfection, Construct, Labeling

    cx79.8 expression in the retina. (A) Transient EGFP expression (green) driven by the −5.4 cx79.8 ::EGFP construct in 5 dpf zebrafish fry. Nuclei are labeled with DAPI in blue. (B-D) Stable expression of EGFP in adult retina driven by the −5.4 cx79.8 ::EGFP transgene in line 1 (B), line 2 (C), and line 3 (D). Nuclei are labeled with DAPI in blue in (B) and (C), and a subset of cones is labeled with an antibody to cone arrestin in red in (D). (E, F) In situ hybridization of cx79.8 mRNA in wild type adult retina. Antisense strand probe labeling is shown in red in (E) and sense strand probe labeling is shown in (F); nuclei are labeled blue with DAPI. PR – photoreceptors; INL – inner nuclear layer; GCL – ganglion cell layer. Scale bars in C-F are the same dimensions as in B.
    Figure Legend Snippet: cx79.8 expression in the retina. (A) Transient EGFP expression (green) driven by the −5.4 cx79.8 ::EGFP construct in 5 dpf zebrafish fry. Nuclei are labeled with DAPI in blue. (B-D) Stable expression of EGFP in adult retina driven by the −5.4 cx79.8 ::EGFP transgene in line 1 (B), line 2 (C), and line 3 (D). Nuclei are labeled with DAPI in blue in (B) and (C), and a subset of cones is labeled with an antibody to cone arrestin in red in (D). (E, F) In situ hybridization of cx79.8 mRNA in wild type adult retina. Antisense strand probe labeling is shown in red in (E) and sense strand probe labeling is shown in (F); nuclei are labeled blue with DAPI. PR – photoreceptors; INL – inner nuclear layer; GCL – ganglion cell layer. Scale bars in C-F are the same dimensions as in B.

    Techniques Used: Expressing, Construct, Labeling, In Situ Hybridization

    Cx79.8 antibody labeling in adult retina. (A) Lableing with crude anti-Cx79.8 antiserum containing both antibodies (green) in retina of an opsin-GFP (red) transgenic zebrafish in which rod photoreceptors are labeled. Nuclei are labeled with DAPI in blue. Antibody labeling includes prominent clumps in the photoreceptor layer, but not in rods, as well as widespread punctate labeling. (B) Labeling with affinity-purified Cx79.8-345 antibody (green) in retina double-labeled with an antibody to cone arrestin (red). Note prominent clumps in some cone inner segments, fine punctate labeling along the surface of cone somata and terminals, and sparse punctate labeling in the IPL. (C) Labeling with affinity-purified Cx79.8-645 antibody (green) in retina double-labeled with an antibody to cone arrestin (red). Note fine punctate labeling along the surface of cone somata and abundant punctate labeling in the IPL. PR – photoreceptors; OPL – outer plexiform layer; IPL – inner plexiform layer. Scale bars are of the same dimensions in all panels.
    Figure Legend Snippet: Cx79.8 antibody labeling in adult retina. (A) Lableing with crude anti-Cx79.8 antiserum containing both antibodies (green) in retina of an opsin-GFP (red) transgenic zebrafish in which rod photoreceptors are labeled. Nuclei are labeled with DAPI in blue. Antibody labeling includes prominent clumps in the photoreceptor layer, but not in rods, as well as widespread punctate labeling. (B) Labeling with affinity-purified Cx79.8-345 antibody (green) in retina double-labeled with an antibody to cone arrestin (red). Note prominent clumps in some cone inner segments, fine punctate labeling along the surface of cone somata and terminals, and sparse punctate labeling in the IPL. (C) Labeling with affinity-purified Cx79.8-645 antibody (green) in retina double-labeled with an antibody to cone arrestin (red). Note fine punctate labeling along the surface of cone somata and abundant punctate labeling in the IPL. PR – photoreceptors; OPL – outer plexiform layer; IPL – inner plexiform layer. Scale bars are of the same dimensions in all panels.

    Techniques Used: Antibody Labeling, Transgenic Assay, Labeling, Affinity Purification

    17) Product Images from "Zebrafish Connexin 79.8 (Gja8a): a lens connexin used as an electrical synapse in some neurons"

    Article Title: Zebrafish Connexin 79.8 (Gja8a): a lens connexin used as an electrical synapse in some neurons

    Journal: Developmental neurobiology

    doi: 10.1002/dneu.22418

    Tests of anti-Cx79.8 antibodies. (A, D) Immunofluorescence labeling of Cx79.8-EGFP (green; intrinsic fluorescence) transiently transfected in HeLa cells using Cx79.8-345 antibody (red, A) or Cx79.8-645 antibody (red, D). Control labeling of EGFP empty vector transfected HeLa cells using the same labeling and imaging conditions is shown for Cx79.8-345 antibody in B and for Cx79.8-645 antibody in E. (C, F) Labeling of 5 dpf wild type zebrafish fry lens with Cx79.8-345 antibody (green, C) or Cx79.8-645 antibody (green, F). Both antibodies specifically label Cx79.8-EGFP and both label abundant gap junctions in the lens. Scale bars in A, B, D and E are of the same dimensions; scale bars in C and F are of the same dimensions.
    Figure Legend Snippet: Tests of anti-Cx79.8 antibodies. (A, D) Immunofluorescence labeling of Cx79.8-EGFP (green; intrinsic fluorescence) transiently transfected in HeLa cells using Cx79.8-345 antibody (red, A) or Cx79.8-645 antibody (red, D). Control labeling of EGFP empty vector transfected HeLa cells using the same labeling and imaging conditions is shown for Cx79.8-345 antibody in B and for Cx79.8-645 antibody in E. (C, F) Labeling of 5 dpf wild type zebrafish fry lens with Cx79.8-345 antibody (green, C) or Cx79.8-645 antibody (green, F). Both antibodies specifically label Cx79.8-EGFP and both label abundant gap junctions in the lens. Scale bars in A, B, D and E are of the same dimensions; scale bars in C and F are of the same dimensions.

    Techniques Used: Immunofluorescence, Labeling, Fluorescence, Transfection, Plasmid Preparation, Imaging

    Tracer coupling supported by Cx79.8 in HeLa cells. Drug treatments in all panels include no treatment (Con), 10 μM PKA antagonist Rp-8-cpt-cAMPS (Rp), 10 μM PKA agonist Sp-8-cpt-cAMPS (Sp), and 0.5 nM PP2A antagonist Microcystin LR (Mic). (A) Transfection with EGFP empty vector alone; (B) transfection with Cx79.8-EGFP; (C) transfection with untagged Cx79.8. Data shown are mean diffusion coefficients for Neurobiotin transfer for 3 to 6 experiments; ** p
    Figure Legend Snippet: Tracer coupling supported by Cx79.8 in HeLa cells. Drug treatments in all panels include no treatment (Con), 10 μM PKA antagonist Rp-8-cpt-cAMPS (Rp), 10 μM PKA agonist Sp-8-cpt-cAMPS (Sp), and 0.5 nM PP2A antagonist Microcystin LR (Mic). (A) Transfection with EGFP empty vector alone; (B) transfection with Cx79.8-EGFP; (C) transfection with untagged Cx79.8. Data shown are mean diffusion coefficients for Neurobiotin transfer for 3 to 6 experiments; ** p

    Techniques Used: Cycling Probe Technology, Transfection, Plasmid Preparation, Diffusion-based Assay

    Alignment of predicted amino acid sequences of the zebrafish Cx50 homologues Cx79.8 and Cx44.1 with mouse Cx50 and chicken Cx45.6. Alignment symbols below the sequences indicate complete identity among all four sequences (*), high conservation of amino acid character (:), and modest conservation (.). Predicted transmembrane domains are highlighted with gray boxes and labeled M1 – M4. The end point of the cx50.5 cDNA sequence is designated by the dashed line through the alignment. Epitopes used to generate anti-Cx79.8 antibodies are outlined and labeled. Note the high degree of sequence conservation at the tip of the C-terminus.
    Figure Legend Snippet: Alignment of predicted amino acid sequences of the zebrafish Cx50 homologues Cx79.8 and Cx44.1 with mouse Cx50 and chicken Cx45.6. Alignment symbols below the sequences indicate complete identity among all four sequences (*), high conservation of amino acid character (:), and modest conservation (.). Predicted transmembrane domains are highlighted with gray boxes and labeled M1 – M4. The end point of the cx50.5 cDNA sequence is designated by the dashed line through the alignment. Epitopes used to generate anti-Cx79.8 antibodies are outlined and labeled. Note the high degree of sequence conservation at the tip of the C-terminus.

    Techniques Used: Labeling, Sequencing

    Marker gene expression driven by the cx79.8 promoter. (A, B) Conventional epifluorescence images of EGFP fluorescence in 3 dpf zebrafish fry with a high level of expression from stably-integrated −5.4 cx79.8 ::EGFP transgene constructs. Expression was prominent in the lens and a faint patch of fluorescence was also present at the midbrain-hindbrain boundary (arrowheads). (C-H) Light sheet images of 4 dpf zebrafish fry from the same line. (C) Ventral view showing expression in the lens. EGFP fluorescence is shown in green; the red channel shows autofluorescence detected in the Cy3 channel (shown in C and E-G). Autofluorescence is detected in both channels and appears orange to yellow, while EGFP fluorescence appears pure green. (D) Axial view of lens EGFP fluorescence at reduced gain to show detail of lens fiber cells. (E-H) Dorsal views at three planes of focus showing the web of EGFP-labeled neurons and processes at the midbrain-hindbrain boundary. The granular eminence (ge) of the cerebellum is labeled; see text for discussion of labeled cells (E) 21 μm thick projection at most dorsal level; (F) 25 μm thick projection centered 44 μm ventrally from E; (G) 84 μm thick projection centered 59 μm ventrally from F. (H) Higher magnification view of the projection neurons shown in G. (I) z-axis projection of labeled brain neurons. Some projections to the optic tectum and within the cerebellum/midbrain are marked with arrowheads. Scale bar dimensions in A are the same in B,C and E-G; other scale bars as noted.
    Figure Legend Snippet: Marker gene expression driven by the cx79.8 promoter. (A, B) Conventional epifluorescence images of EGFP fluorescence in 3 dpf zebrafish fry with a high level of expression from stably-integrated −5.4 cx79.8 ::EGFP transgene constructs. Expression was prominent in the lens and a faint patch of fluorescence was also present at the midbrain-hindbrain boundary (arrowheads). (C-H) Light sheet images of 4 dpf zebrafish fry from the same line. (C) Ventral view showing expression in the lens. EGFP fluorescence is shown in green; the red channel shows autofluorescence detected in the Cy3 channel (shown in C and E-G). Autofluorescence is detected in both channels and appears orange to yellow, while EGFP fluorescence appears pure green. (D) Axial view of lens EGFP fluorescence at reduced gain to show detail of lens fiber cells. (E-H) Dorsal views at three planes of focus showing the web of EGFP-labeled neurons and processes at the midbrain-hindbrain boundary. The granular eminence (ge) of the cerebellum is labeled; see text for discussion of labeled cells (E) 21 μm thick projection at most dorsal level; (F) 25 μm thick projection centered 44 μm ventrally from E; (G) 84 μm thick projection centered 59 μm ventrally from F. (H) Higher magnification view of the projection neurons shown in G. (I) z-axis projection of labeled brain neurons. Some projections to the optic tectum and within the cerebellum/midbrain are marked with arrowheads. Scale bar dimensions in A are the same in B,C and E-G; other scale bars as noted.

    Techniques Used: Marker, Expressing, Fluorescence, Stable Transfection, Construct, Labeling

    cx79.8 expression in the retina. (A) Transient EGFP expression (green) driven by the −5.4 cx79.8 ::EGFP construct in 5 dpf zebrafish fry. Nuclei are labeled with DAPI in blue. (B-D) Stable expression of EGFP in adult retina driven by the −5.4 cx79.8 ::EGFP transgene in line 1 (B), line 2 (C), and line 3 (D). Nuclei are labeled with DAPI in blue in (B) and (C), and a subset of cones is labeled with an antibody to cone arrestin in red in (D). (E, F) In situ hybridization of cx79.8 mRNA in wild type adult retina. Antisense strand probe labeling is shown in red in (E) and sense strand probe labeling is shown in (F); nuclei are labeled blue with DAPI. PR – photoreceptors; INL – inner nuclear layer; GCL – ganglion cell layer. Scale bars in C-F are the same dimensions as in B.
    Figure Legend Snippet: cx79.8 expression in the retina. (A) Transient EGFP expression (green) driven by the −5.4 cx79.8 ::EGFP construct in 5 dpf zebrafish fry. Nuclei are labeled with DAPI in blue. (B-D) Stable expression of EGFP in adult retina driven by the −5.4 cx79.8 ::EGFP transgene in line 1 (B), line 2 (C), and line 3 (D). Nuclei are labeled with DAPI in blue in (B) and (C), and a subset of cones is labeled with an antibody to cone arrestin in red in (D). (E, F) In situ hybridization of cx79.8 mRNA in wild type adult retina. Antisense strand probe labeling is shown in red in (E) and sense strand probe labeling is shown in (F); nuclei are labeled blue with DAPI. PR – photoreceptors; INL – inner nuclear layer; GCL – ganglion cell layer. Scale bars in C-F are the same dimensions as in B.

    Techniques Used: Expressing, Construct, Labeling, In Situ Hybridization

    Cx79.8 antibody labeling in adult retina. (A) Lableing with crude anti-Cx79.8 antiserum containing both antibodies (green) in retina of an opsin-GFP (red) transgenic zebrafish in which rod photoreceptors are labeled. Nuclei are labeled with DAPI in blue. Antibody labeling includes prominent clumps in the photoreceptor layer, but not in rods, as well as widespread punctate labeling. (B) Labeling with affinity-purified Cx79.8-345 antibody (green) in retina double-labeled with an antibody to cone arrestin (red). Note prominent clumps in some cone inner segments, fine punctate labeling along the surface of cone somata and terminals, and sparse punctate labeling in the IPL. (C) Labeling with affinity-purified Cx79.8-645 antibody (green) in retina double-labeled with an antibody to cone arrestin (red). Note fine punctate labeling along the surface of cone somata and abundant punctate labeling in the IPL. PR – photoreceptors; OPL – outer plexiform layer; IPL – inner plexiform layer. Scale bars are of the same dimensions in all panels.
    Figure Legend Snippet: Cx79.8 antibody labeling in adult retina. (A) Lableing with crude anti-Cx79.8 antiserum containing both antibodies (green) in retina of an opsin-GFP (red) transgenic zebrafish in which rod photoreceptors are labeled. Nuclei are labeled with DAPI in blue. Antibody labeling includes prominent clumps in the photoreceptor layer, but not in rods, as well as widespread punctate labeling. (B) Labeling with affinity-purified Cx79.8-345 antibody (green) in retina double-labeled with an antibody to cone arrestin (red). Note prominent clumps in some cone inner segments, fine punctate labeling along the surface of cone somata and terminals, and sparse punctate labeling in the IPL. (C) Labeling with affinity-purified Cx79.8-645 antibody (green) in retina double-labeled with an antibody to cone arrestin (red). Note fine punctate labeling along the surface of cone somata and abundant punctate labeling in the IPL. PR – photoreceptors; OPL – outer plexiform layer; IPL – inner plexiform layer. Scale bars are of the same dimensions in all panels.

    Techniques Used: Antibody Labeling, Transgenic Assay, Labeling, Affinity Purification

    18) Product Images from "The primate-specific noncoding RNA HPAT5 regulates pluripotency during human preimplantation development and nuclear reprogramming"

    Article Title: The primate-specific noncoding RNA HPAT5 regulates pluripotency during human preimplantation development and nuclear reprogramming

    Journal: Nature genetics

    doi: 10.1038/ng.3449

    Single-cell expression analysis of HPAT transcripts during nuclear reprogramming. ( a ) Dynamics in single-cell expression of HPAT transcripts during nuclear reprogramming shown as box plots. HPATs are grouped according to activation pattern (with two examples representing each group). ( b ) Bicluster analysis identifies five biclusters, P1–P5, and correlates HPAT2 , HPAT3 and HPAT5 ). ( c for additional details). ( d ) Bayesian network analysis predicts a central role for HPAT2, HPAT3 and HPAT5 (orange circles) within the core regulatory network (yellow circles). The hierarchical view predicts that SALL4 (red circle) triggers a cascade of key pluripotency gene activation. Arrow thickness and circle size increase with the confidence level of interactions in the calculated network. Only pluripotency genes and lincRNAs were included. Data in a – d represent n = 578 single cells.
    Figure Legend Snippet: Single-cell expression analysis of HPAT transcripts during nuclear reprogramming. ( a ) Dynamics in single-cell expression of HPAT transcripts during nuclear reprogramming shown as box plots. HPATs are grouped according to activation pattern (with two examples representing each group). ( b ) Bicluster analysis identifies five biclusters, P1–P5, and correlates HPAT2 , HPAT3 and HPAT5 ). ( c for additional details). ( d ) Bayesian network analysis predicts a central role for HPAT2, HPAT3 and HPAT5 (orange circles) within the core regulatory network (yellow circles). The hierarchical view predicts that SALL4 (red circle) triggers a cascade of key pluripotency gene activation. Arrow thickness and circle size increase with the confidence level of interactions in the calculated network. Only pluripotency genes and lincRNAs were included. Data in a – d represent n = 578 single cells.

    Techniques Used: Expressing, Activation Assay

    Molecular single-cell gene expression and functional analyses of HPAT2, HPAT3 and HPAT5 during human embryo development. ( a ) Overview of single-cell gene expression analysis for human blastocysts. A total of 24 blastocysts were pooled and run on four C1 chips. ( b – d ) Single-cell gene expression analyses. RT, reverse transcribe. ( b ) Three HPATs had significantly higher expressed in ICM than in trophectoderm (TROPH). ( c , d ) ICM ( c ) and trophectoderm ( d ) markers are also shown. Box plots are shown for each group. The whiskers are the minimum and maximum data points. The bottom and top of each box are the first and third quartiles, respectively. n = 46 single trophoectoderm cells and n = 67 single ICM cells. ( e ) Immunohistochemistry and RNA FISH for OCT4 (green) and lincRNAs (red), respectively, in human blastocysts. Sections are counterstained with DAPI (blue). ICMs are circled by dotted white lines. Entire human or mouse blastocysts are circled by dotted yellow lines in the merged images. lincRNA signal was specific to the ICM. Speckles (red) are nonspecific and are observed in all human blastocysts. Mouse blastocysts initiated hatching when fixed. Images are representative ( n = 9 human blastocysts for HPAT3, n = 11 human blastocysts for HPAT5 and n = 3 mouse blastocysts; n = 2 independent experiments). Scale bar, 100 μm. ( f ) Blastomeres with reduced expression of HPAT2, HPAT3 and HPAT5 during human embryo development did not contribute to ICM. The presence of ICM was validated with OCT4 and SOX2 staining. ICMs are circled by yellow dashed lines ( n = 3 blastocysts). RRX, Rhodamine Red-X; siHPAT2/3/5, combination of siRNAs targeting HPAT2, HPAT3 and HPAT5. Scale bar, 100 μm.
    Figure Legend Snippet: Molecular single-cell gene expression and functional analyses of HPAT2, HPAT3 and HPAT5 during human embryo development. ( a ) Overview of single-cell gene expression analysis for human blastocysts. A total of 24 blastocysts were pooled and run on four C1 chips. ( b – d ) Single-cell gene expression analyses. RT, reverse transcribe. ( b ) Three HPATs had significantly higher expressed in ICM than in trophectoderm (TROPH). ( c , d ) ICM ( c ) and trophectoderm ( d ) markers are also shown. Box plots are shown for each group. The whiskers are the minimum and maximum data points. The bottom and top of each box are the first and third quartiles, respectively. n = 46 single trophoectoderm cells and n = 67 single ICM cells. ( e ) Immunohistochemistry and RNA FISH for OCT4 (green) and lincRNAs (red), respectively, in human blastocysts. Sections are counterstained with DAPI (blue). ICMs are circled by dotted white lines. Entire human or mouse blastocysts are circled by dotted yellow lines in the merged images. lincRNA signal was specific to the ICM. Speckles (red) are nonspecific and are observed in all human blastocysts. Mouse blastocysts initiated hatching when fixed. Images are representative ( n = 9 human blastocysts for HPAT3, n = 11 human blastocysts for HPAT5 and n = 3 mouse blastocysts; n = 2 independent experiments). Scale bar, 100 μm. ( f ) Blastomeres with reduced expression of HPAT2, HPAT3 and HPAT5 during human embryo development did not contribute to ICM. The presence of ICM was validated with OCT4 and SOX2 staining. ICMs are circled by yellow dashed lines ( n = 3 blastocysts). RRX, Rhodamine Red-X; siHPAT2/3/5, combination of siRNAs targeting HPAT2, HPAT3 and HPAT5. Scale bar, 100 μm.

    Techniques Used: Expressing, Functional Assay, Immunohistochemistry, Fluorescence In Situ Hybridization, Staining

    Functional analyses of HPAT2, HPAT3 and HPAT5 during nuclear reprogramming. ( a ) Experimental scheme of functional analysis of HPAT2, HPAT3 and HPAT5 (HPAT2/3/5) during iPSC reprogramming. AP, alkaline phosphatase. ( b ) Immunostaining of TRA-1-60 during reprogramming with HPAT2, HPAT3 and HPAT5 in combination. Representative images are shown ( n = 8). KD, knockdown. Scale bar, 100 μm. ( c ) Calculated percentage of TRA-1-60–positive cells at different points during reprogramming ( n = 8). Data are represented as means + s.e.m. ( d ) Representative images of colony size appearance at day 12 during reprogramming ( n = 8). Scale bar, 100 μm. ( e ) Alkaline phosphatase staining at day 12. Shown are the wells of a six-well plate from one experiment ( n = 2 independent experiments). ( f ) iPSC colony number counted on the basis of alkaline phosphatase staining ( n = 3). Data are represented as means + s.e.m. ( g ) Cell number relative to control cells during reprogramming ( n = 3). Data are represented as means + s.e.m. NS, not significant. ( h ) Alkaline phosphatase staining at day 12 during reprogramming ( n = 2 for each condition). ( i ) Percentage of TRA-1-60–positive cells at day 12 of single knockdown of HPAT2, HPAT3 or HPAT5. siGlo was used as a control. Data are represented as means + s.e.m. ( j ) Reprogramming with POU5F1 and HPAT2, HPAT3 and HPAT5. POU5F1 only is used as a control. ( k ) Epigenetic and gene expression analysis of HPAT2 , HPAT3 and HPAT5. NANOG mRNA was transfected into BJ fibroblasts treated or not with 5-Aza-2′-deoxycytidine (5-Aza) with gene expression measurement at 48 h ( n = 6). Data are represented as means + s.e.m.
    Figure Legend Snippet: Functional analyses of HPAT2, HPAT3 and HPAT5 during nuclear reprogramming. ( a ) Experimental scheme of functional analysis of HPAT2, HPAT3 and HPAT5 (HPAT2/3/5) during iPSC reprogramming. AP, alkaline phosphatase. ( b ) Immunostaining of TRA-1-60 during reprogramming with HPAT2, HPAT3 and HPAT5 in combination. Representative images are shown ( n = 8). KD, knockdown. Scale bar, 100 μm. ( c ) Calculated percentage of TRA-1-60–positive cells at different points during reprogramming ( n = 8). Data are represented as means + s.e.m. ( d ) Representative images of colony size appearance at day 12 during reprogramming ( n = 8). Scale bar, 100 μm. ( e ) Alkaline phosphatase staining at day 12. Shown are the wells of a six-well plate from one experiment ( n = 2 independent experiments). ( f ) iPSC colony number counted on the basis of alkaline phosphatase staining ( n = 3). Data are represented as means + s.e.m. ( g ) Cell number relative to control cells during reprogramming ( n = 3). Data are represented as means + s.e.m. NS, not significant. ( h ) Alkaline phosphatase staining at day 12 during reprogramming ( n = 2 for each condition). ( i ) Percentage of TRA-1-60–positive cells at day 12 of single knockdown of HPAT2, HPAT3 or HPAT5. siGlo was used as a control. Data are represented as means + s.e.m. ( j ) Reprogramming with POU5F1 and HPAT2, HPAT3 and HPAT5. POU5F1 only is used as a control. ( k ) Epigenetic and gene expression analysis of HPAT2 , HPAT3 and HPAT5. NANOG mRNA was transfected into BJ fibroblasts treated or not with 5-Aza-2′-deoxycytidine (5-Aza) with gene expression measurement at 48 h ( n = 6). Data are represented as means + s.e.m.

    Techniques Used: Functional Assay, Immunostaining, Staining, Expressing, Transfection

    19) Product Images from "The primate-specific noncoding RNA HPAT5 regulates pluripotency during human preimplantation development and nuclear reprogramming"

    Article Title: The primate-specific noncoding RNA HPAT5 regulates pluripotency during human preimplantation development and nuclear reprogramming

    Journal: Nature genetics

    doi: 10.1038/ng.3449

    Single-cell expression analysis of HPAT transcripts during nuclear reprogramming. ( a ) Dynamics in single-cell expression of HPAT transcripts during nuclear reprogramming shown as box plots. HPATs are grouped according to activation pattern (with two examples representing each group). ( b ) Bicluster analysis identifies five biclusters, P1–P5, and correlates HPAT2 , HPAT3 and HPAT5 ). ( c for additional details). ( d ) Bayesian network analysis predicts a central role for HPAT2, HPAT3 and HPAT5 (orange circles) within the core regulatory network (yellow circles). The hierarchical view predicts that SALL4 (red circle) triggers a cascade of key pluripotency gene activation. Arrow thickness and circle size increase with the confidence level of interactions in the calculated network. Only pluripotency genes and lincRNAs were included. Data in a – d represent n = 578 single cells.
    Figure Legend Snippet: Single-cell expression analysis of HPAT transcripts during nuclear reprogramming. ( a ) Dynamics in single-cell expression of HPAT transcripts during nuclear reprogramming shown as box plots. HPATs are grouped according to activation pattern (with two examples representing each group). ( b ) Bicluster analysis identifies five biclusters, P1–P5, and correlates HPAT2 , HPAT3 and HPAT5 ). ( c for additional details). ( d ) Bayesian network analysis predicts a central role for HPAT2, HPAT3 and HPAT5 (orange circles) within the core regulatory network (yellow circles). The hierarchical view predicts that SALL4 (red circle) triggers a cascade of key pluripotency gene activation. Arrow thickness and circle size increase with the confidence level of interactions in the calculated network. Only pluripotency genes and lincRNAs were included. Data in a – d represent n = 578 single cells.

    Techniques Used: Expressing, Activation Assay

    Molecular single-cell gene expression and functional analyses of HPAT2, HPAT3 and HPAT5 during human embryo development. ( a ) Overview of single-cell gene expression analysis for human blastocysts. A total of 24 blastocysts were pooled and run on four C1 chips. ( b – d ) Single-cell gene expression analyses. RT, reverse transcribe. ( b ) Three HPATs had significantly higher expressed in ICM than in trophectoderm (TROPH). ( c , d ) ICM ( c ) and trophectoderm ( d ) markers are also shown. Box plots are shown for each group. The whiskers are the minimum and maximum data points. The bottom and top of each box are the first and third quartiles, respectively. n = 46 single trophoectoderm cells and n = 67 single ICM cells. ( e ) Immunohistochemistry and RNA FISH for OCT4 (green) and lincRNAs (red), respectively, in human blastocysts. Sections are counterstained with DAPI (blue). ICMs are circled by dotted white lines. Entire human or mouse blastocysts are circled by dotted yellow lines in the merged images. lincRNA signal was specific to the ICM. Speckles (red) are nonspecific and are observed in all human blastocysts. Mouse blastocysts initiated hatching when fixed. Images are representative ( n = 9 human blastocysts for HPAT3, n = 11 human blastocysts for HPAT5 and n = 3 mouse blastocysts; n = 2 independent experiments). Scale bar, 100 μm. ( f ) Blastomeres with reduced expression of HPAT2, HPAT3 and HPAT5 during human embryo development did not contribute to ICM. The presence of ICM was validated with OCT4 and SOX2 staining. ICMs are circled by yellow dashed lines ( n = 3 blastocysts). RRX, Rhodamine Red-X; siHPAT2/3/5, combination of siRNAs targeting HPAT2, HPAT3 and HPAT5. Scale bar, 100 μm.
    Figure Legend Snippet: Molecular single-cell gene expression and functional analyses of HPAT2, HPAT3 and HPAT5 during human embryo development. ( a ) Overview of single-cell gene expression analysis for human blastocysts. A total of 24 blastocysts were pooled and run on four C1 chips. ( b – d ) Single-cell gene expression analyses. RT, reverse transcribe. ( b ) Three HPATs had significantly higher expressed in ICM than in trophectoderm (TROPH). ( c , d ) ICM ( c ) and trophectoderm ( d ) markers are also shown. Box plots are shown for each group. The whiskers are the minimum and maximum data points. The bottom and top of each box are the first and third quartiles, respectively. n = 46 single trophoectoderm cells and n = 67 single ICM cells. ( e ) Immunohistochemistry and RNA FISH for OCT4 (green) and lincRNAs (red), respectively, in human blastocysts. Sections are counterstained with DAPI (blue). ICMs are circled by dotted white lines. Entire human or mouse blastocysts are circled by dotted yellow lines in the merged images. lincRNA signal was specific to the ICM. Speckles (red) are nonspecific and are observed in all human blastocysts. Mouse blastocysts initiated hatching when fixed. Images are representative ( n = 9 human blastocysts for HPAT3, n = 11 human blastocysts for HPAT5 and n = 3 mouse blastocysts; n = 2 independent experiments). Scale bar, 100 μm. ( f ) Blastomeres with reduced expression of HPAT2, HPAT3 and HPAT5 during human embryo development did not contribute to ICM. The presence of ICM was validated with OCT4 and SOX2 staining. ICMs are circled by yellow dashed lines ( n = 3 blastocysts). RRX, Rhodamine Red-X; siHPAT2/3/5, combination of siRNAs targeting HPAT2, HPAT3 and HPAT5. Scale bar, 100 μm.

    Techniques Used: Expressing, Functional Assay, Immunohistochemistry, Fluorescence In Situ Hybridization, Staining

    Functional analyses of HPAT2, HPAT3 and HPAT5 during nuclear reprogramming. ( a ) Experimental scheme of functional analysis of HPAT2, HPAT3 and HPAT5 (HPAT2/3/5) during iPSC reprogramming. AP, alkaline phosphatase. ( b ) Immunostaining of TRA-1-60 during reprogramming with HPAT2, HPAT3 and HPAT5 in combination. Representative images are shown ( n = 8). KD, knockdown. Scale bar, 100 μm. ( c ) Calculated percentage of TRA-1-60–positive cells at different points during reprogramming ( n = 8). Data are represented as means + s.e.m. ( d ) Representative images of colony size appearance at day 12 during reprogramming ( n = 8). Scale bar, 100 μm. ( e ) Alkaline phosphatase staining at day 12. Shown are the wells of a six-well plate from one experiment ( n = 2 independent experiments). ( f ) iPSC colony number counted on the basis of alkaline phosphatase staining ( n = 3). Data are represented as means + s.e.m. ( g ) Cell number relative to control cells during reprogramming ( n = 3). Data are represented as means + s.e.m. NS, not significant. ( h ) Alkaline phosphatase staining at day 12 during reprogramming ( n = 2 for each condition). ( i ) Percentage of TRA-1-60–positive cells at day 12 of single knockdown of HPAT2, HPAT3 or HPAT5. siGlo was used as a control. Data are represented as means + s.e.m. ( j ) Reprogramming with POU5F1 and HPAT2, HPAT3 and HPAT5. POU5F1 only is used as a control. ( k ) Epigenetic and gene expression analysis of HPAT2 , HPAT3 and HPAT5. NANOG mRNA was transfected into BJ fibroblasts treated or not with 5-Aza-2′-deoxycytidine (5-Aza) with gene expression measurement at 48 h ( n = 6). Data are represented as means + s.e.m.
    Figure Legend Snippet: Functional analyses of HPAT2, HPAT3 and HPAT5 during nuclear reprogramming. ( a ) Experimental scheme of functional analysis of HPAT2, HPAT3 and HPAT5 (HPAT2/3/5) during iPSC reprogramming. AP, alkaline phosphatase. ( b ) Immunostaining of TRA-1-60 during reprogramming with HPAT2, HPAT3 and HPAT5 in combination. Representative images are shown ( n = 8). KD, knockdown. Scale bar, 100 μm. ( c ) Calculated percentage of TRA-1-60–positive cells at different points during reprogramming ( n = 8). Data are represented as means + s.e.m. ( d ) Representative images of colony size appearance at day 12 during reprogramming ( n = 8). Scale bar, 100 μm. ( e ) Alkaline phosphatase staining at day 12. Shown are the wells of a six-well plate from one experiment ( n = 2 independent experiments). ( f ) iPSC colony number counted on the basis of alkaline phosphatase staining ( n = 3). Data are represented as means + s.e.m. ( g ) Cell number relative to control cells during reprogramming ( n = 3). Data are represented as means + s.e.m. NS, not significant. ( h ) Alkaline phosphatase staining at day 12 during reprogramming ( n = 2 for each condition). ( i ) Percentage of TRA-1-60–positive cells at day 12 of single knockdown of HPAT2, HPAT3 or HPAT5. siGlo was used as a control. Data are represented as means + s.e.m. ( j ) Reprogramming with POU5F1 and HPAT2, HPAT3 and HPAT5. POU5F1 only is used as a control. ( k ) Epigenetic and gene expression analysis of HPAT2 , HPAT3 and HPAT5. NANOG mRNA was transfected into BJ fibroblasts treated or not with 5-Aza-2′-deoxycytidine (5-Aza) with gene expression measurement at 48 h ( n = 6). Data are represented as means + s.e.m.

    Techniques Used: Functional Assay, Immunostaining, Staining, Expressing, Transfection

    20) Product Images from "Insights into the Initiation of JC Virus DNA Replication Derived from the Crystal Structure of the T-Antigen Origin Binding Domain"

    Article Title: Insights into the Initiation of JC Virus DNA Replication Derived from the Crystal Structure of the T-Antigen Origin Binding Domain

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1003966

    The higher order structures present in the JCV T-ag OBD crystals. A . Two views of the right handed tetrameric crystallographic spiral formed by the JCV T-ag OBD. B . Superimposition of crystal forms 2 and 3 and their relevant symmetry mates on crystallographic spiral of form 1. The JCV T-ag OBDs in crystal form 1 are colored, while those in crystal forms 2 and 3 are in gray. C . Contrasting the structures formed by the JCV and SV40 T-ag OBDs. The JCV OBDs interact at an approximately 90 degree angle, while the SV40 OBDs interact at a 60 degree angle [63] . Regarding the translational component, for the SV40 hexameric spiral the rise is ∼6 Å per OBD pair. In contrast, for the tetrameric JCV OBD structures the rise is ∼9 Å per OBD pair (thus both spirals have an overall rise of 36 Å). Consequences of the greater rise seen in the JCV OBD structure include the smaller central channel and the “tighter” spiral observed in the current structures ( Fig. 8A ).
    Figure Legend Snippet: The higher order structures present in the JCV T-ag OBD crystals. A . Two views of the right handed tetrameric crystallographic spiral formed by the JCV T-ag OBD. B . Superimposition of crystal forms 2 and 3 and their relevant symmetry mates on crystallographic spiral of form 1. The JCV T-ag OBDs in crystal form 1 are colored, while those in crystal forms 2 and 3 are in gray. C . Contrasting the structures formed by the JCV and SV40 T-ag OBDs. The JCV OBDs interact at an approximately 90 degree angle, while the SV40 OBDs interact at a 60 degree angle [63] . Regarding the translational component, for the SV40 hexameric spiral the rise is ∼6 Å per OBD pair. In contrast, for the tetrameric JCV OBD structures the rise is ∼9 Å per OBD pair (thus both spirals have an overall rise of 36 Å). Consequences of the greater rise seen in the JCV OBD structure include the smaller central channel and the “tighter” spiral observed in the current structures ( Fig. 8A ).

    Techniques Used:

    Determining the affinity of the JCV OBD for oligonucleotides containing the Site II and Site I regions of the viral origin. A . Results from ITC studies conducted with the JCV T-ag OBD and a 33 bp Site II based oligonucleotide. (The protein concentration in the syringe was ∼80 uM, the Site II containing oligonucleotide was used at a concentration of 1.5 uM). The Site II based oligonucleotide used in this experiment was 5′ TACAGGAGGCCGAGGCCGCCTCCGCCTCCAAGC 3′ and its complement. The calorimetric trace is shown in the top panel; the Kd and stoichiometry (N) values are indicated. The X- axis is time in minutes, while the Y axis of the isotherm is power in ucal/s. These values were determined following curve fitting of the integrated calorimetric trace presented in the bottom panel. B . Results from ITC studies conducted with the JCV OBD and a 28 bp Site I oligonucleotide. (The protein concentration in the syringe was 40 uM, the Site II containing oligonucleotide was used at a concentration of 1.0 uM). The Site I based oligonucleotide used in this experiment was 5′ GCGTGGAGGCTTTTTAGGAGGCCAGGGA 3′ and its complement. As in panel A, the calorimetric trace is shown in the top panel; the Kd and stoichiometry (N) values are indicated.
    Figure Legend Snippet: Determining the affinity of the JCV OBD for oligonucleotides containing the Site II and Site I regions of the viral origin. A . Results from ITC studies conducted with the JCV T-ag OBD and a 33 bp Site II based oligonucleotide. (The protein concentration in the syringe was ∼80 uM, the Site II containing oligonucleotide was used at a concentration of 1.5 uM). The Site II based oligonucleotide used in this experiment was 5′ TACAGGAGGCCGAGGCCGCCTCCGCCTCCAAGC 3′ and its complement. The calorimetric trace is shown in the top panel; the Kd and stoichiometry (N) values are indicated. The X- axis is time in minutes, while the Y axis of the isotherm is power in ucal/s. These values were determined following curve fitting of the integrated calorimetric trace presented in the bottom panel. B . Results from ITC studies conducted with the JCV OBD and a 28 bp Site I oligonucleotide. (The protein concentration in the syringe was 40 uM, the Site II containing oligonucleotide was used at a concentration of 1.0 uM). The Site I based oligonucleotide used in this experiment was 5′ GCGTGGAGGCTTTTTAGGAGGCCAGGGA 3′ and its complement. As in panel A, the calorimetric trace is shown in the top panel; the Kd and stoichiometry (N) values are indicated.

    Techniques Used: Protein Concentration, Concentration Assay

    Modeling the interaction of the JCV OBD with Site I. A . Presented in panel A is the actual co-structure of the SV40 T-ag OBD on Site I [76] . A translucent surface representation of the SV40 T-ag OBDs is shown, indicating that no protein/protein interactions were observed in this crystal structure. The positions of pentanucleotides P5 and P6 are indicated. Note, in contrast to Site II, the pentanucleotides in Site I are arranged in a head-to-tail orientation [76] . Steric clashes between the OBDs were not detected. The yellow balls indicate the positions of SV40 T-ag OBD residue F151. B . A superposition of the JCV OBDs (cyan) onto the SV40 T-ag OBDs (yellow) while bound to Site I (PDB code 4FGN). A translucent surface representation of the JCV T-ag OBDs is presented. Steric clashes occur, an indication that structural rearrangements are likely to take place. Residues that are predicted to clash are shown in the insert.
    Figure Legend Snippet: Modeling the interaction of the JCV OBD with Site I. A . Presented in panel A is the actual co-structure of the SV40 T-ag OBD on Site I [76] . A translucent surface representation of the SV40 T-ag OBDs is shown, indicating that no protein/protein interactions were observed in this crystal structure. The positions of pentanucleotides P5 and P6 are indicated. Note, in contrast to Site II, the pentanucleotides in Site I are arranged in a head-to-tail orientation [76] . Steric clashes between the OBDs were not detected. The yellow balls indicate the positions of SV40 T-ag OBD residue F151. B . A superposition of the JCV OBDs (cyan) onto the SV40 T-ag OBDs (yellow) while bound to Site I (PDB code 4FGN). A translucent surface representation of the JCV T-ag OBDs is presented. Steric clashes occur, an indication that structural rearrangements are likely to take place. Residues that are predicted to clash are shown in the insert.

    Techniques Used:

    The results of DNA replication studies conducted with full-length JCV T-ag's containing mutations at selected locations. A . Relative replication levels of reactions conducted with wild type (wt) JCV T-ag and the Q240A and F258L mutants. The assays ( materials and methods ) were conducted 72 hrs. post-transfection. B . The results of Western Blots used to monitor the levels of the different forms of JCV T-ag in C33A cells at 72 hrs post-transfection. Vinculin levels were determined as a loading control.
    Figure Legend Snippet: The results of DNA replication studies conducted with full-length JCV T-ag's containing mutations at selected locations. A . Relative replication levels of reactions conducted with wild type (wt) JCV T-ag and the Q240A and F258L mutants. The assays ( materials and methods ) were conducted 72 hrs. post-transfection. B . The results of Western Blots used to monitor the levels of the different forms of JCV T-ag in C33A cells at 72 hrs post-transfection. Vinculin levels were determined as a loading control.

    Techniques Used: Transfection, Western Blot

    The structure of the JCV T-ag OBD viewed in terms of residues that are identical conserved, or not conserved, with the SV40 T-ag OBD. A . A comparison of the amino acid residues found in the OBDs from JCV (top) and SV40 (bottom). Identical residues are shown in blue, conserved residues in light pink and non-conserved residues in magenta. The locations of the DNA binding A1 and B2 loops are indicated as is the B3 motif; a region involved in T-ag oligomerization. The residue numbers for the JCV OBD are indicated above the amino acid sequence. B . Distribution of the identical, conserved and non-conserved residues on the two hemispheres of the JCV OBD. A surface representation of the JCV OBD is shown, it uses the coloring scheme described in A. The region containing the A1 and B2 motifs is circled. In addition, to establish the orientation of the domain, certain residues are labeled.
    Figure Legend Snippet: The structure of the JCV T-ag OBD viewed in terms of residues that are identical conserved, or not conserved, with the SV40 T-ag OBD. A . A comparison of the amino acid residues found in the OBDs from JCV (top) and SV40 (bottom). Identical residues are shown in blue, conserved residues in light pink and non-conserved residues in magenta. The locations of the DNA binding A1 and B2 loops are indicated as is the B3 motif; a region involved in T-ag oligomerization. The residue numbers for the JCV OBD are indicated above the amino acid sequence. B . Distribution of the identical, conserved and non-conserved residues on the two hemispheres of the JCV OBD. A surface representation of the JCV OBD is shown, it uses the coloring scheme described in A. The region containing the A1 and B2 motifs is circled. In addition, to establish the orientation of the domain, certain residues are labeled.

    Techniques Used: Binding Assay, Sequencing, Labeling

    The structure of the JCV OBD. A . The amino acid sequence of the JCV T-ag origin binding domain (OBD). The associated secondary structures are presented above the primary sequence. The positions of the A1, B2 and B3 motifs are indicated. B . A ribbon diagram of the JCV OBD crystal structure. The individual beta strands and alpha helices are indicated, as are the N and C termini. The individual secondary elements were named as previously described for the SV40 OBD [48] . C . Superposition of all four structures of the JCV OBD (forms 1, 2 and 3), indicating where the DNA binding A1 and B2 loops are located along with the B3 motifs (in brown, blue and orange, respectively). Structurally, the most variable region in the OBD is the B3 motif.
    Figure Legend Snippet: The structure of the JCV OBD. A . The amino acid sequence of the JCV T-ag origin binding domain (OBD). The associated secondary structures are presented above the primary sequence. The positions of the A1, B2 and B3 motifs are indicated. B . A ribbon diagram of the JCV OBD crystal structure. The individual beta strands and alpha helices are indicated, as are the N and C termini. The individual secondary elements were named as previously described for the SV40 OBD [48] . C . Superposition of all four structures of the JCV OBD (forms 1, 2 and 3), indicating where the DNA binding A1 and B2 loops are located along with the B3 motifs (in brown, blue and orange, respectively). Structurally, the most variable region in the OBD is the B3 motif.

    Techniques Used: Sequencing, Binding Assay

    21) Product Images from "Generation of human iPSCs from cells of fibroblastic and epithelial origin by means of the oriP/EBNA-1 episomal reprogramming system"

    Article Title: Generation of human iPSCs from cells of fibroblastic and epithelial origin by means of the oriP/EBNA-1 episomal reprogramming system

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-015-0112-3

    The impact of miR 302/367 overexpression and Mbd3 depletion on induced pluripotent stem cell (iPSC) colony-forming efficiencies. ( a ) Exemplary alkaline phosphatase stainings of iPSCs generated from foreskin neonatal fibroblasts and urinary epithelial cells. Plates labelled as control show cells reprogrammed with episomes carrying OCT3/4, SOX2, KLF4, L-MYC, LIN28, and p53 dominant negative mutant. Cells labelled as + miR 302/367 were additionally transfected with episomal construct comprising mCherry-miR 302/367 cassette driven by cytomegalovirus promoter, whereas + Mbd3 shRNA indicates the cells additionally transfected with episomal vector carrying shRNA against Mbd3 mRNA under control of U6 promoter. ( b ) Summary of the reprogramming experiments with use of vectors carrying miR 302/367 and Mbd3 shRNA constructs. Graphed data show results of triplicate experiments presented as a mean ± standard error of the mean. Asterisks indicate statistically relevant difference between compared samples.  Ctrl  control,  Mbd3  methyl-CpG-binding domain protein 3,  shRNA  short hairpin RNA
    Figure Legend Snippet: The impact of miR 302/367 overexpression and Mbd3 depletion on induced pluripotent stem cell (iPSC) colony-forming efficiencies. ( a ) Exemplary alkaline phosphatase stainings of iPSCs generated from foreskin neonatal fibroblasts and urinary epithelial cells. Plates labelled as control show cells reprogrammed with episomes carrying OCT3/4, SOX2, KLF4, L-MYC, LIN28, and p53 dominant negative mutant. Cells labelled as + miR 302/367 were additionally transfected with episomal construct comprising mCherry-miR 302/367 cassette driven by cytomegalovirus promoter, whereas + Mbd3 shRNA indicates the cells additionally transfected with episomal vector carrying shRNA against Mbd3 mRNA under control of U6 promoter. ( b ) Summary of the reprogramming experiments with use of vectors carrying miR 302/367 and Mbd3 shRNA constructs. Graphed data show results of triplicate experiments presented as a mean ± standard error of the mean. Asterisks indicate statistically relevant difference between compared samples. Ctrl control, Mbd3 methyl-CpG-binding domain protein 3, shRNA short hairpin RNA

    Techniques Used: Over Expression, Generated, Dominant Negative Mutation, Transfection, Construct, shRNA, Plasmid Preparation, Binding Assay

    22) Product Images from "SLO BK Potassium Channels Couple Gap Junctions to Inhibition of Calcium Signaling in Olfactory Neuron Diversification"

    Article Title: SLO BK Potassium Channels Couple Gap Junctions to Inhibition of Calcium Signaling in Olfactory Neuron Diversification

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1005654

    slo-1 and slo-2 act cell autonomously in promoting the AWC ON fate. ( A , C ) AWC phenotypes in wild type, slo-1(eg142lf); slo-2(ok2214lf) , and slo-1(eg142lf); slo-2(ok2214lf) expressing extrachromosomal transgenes odr-3p :: slo-1(OE); odr-1p :: DsRed ( A ) or odr-3p :: slo-2(OE); odr-1p :: DsRed ( C ). ( B ) AWC phenotypes of slo-1(eg142lf); slo-2(ok2214lf) mosaic animals containing the extrachromosomal transgene odr-3p :: slo-1(OE) in only one AWC cell, inferred by the presence of the coinjection marker odr-1p :: DsRed (normally expressed in both AWC). The data was derived from a subset of data in ( A ). ( D ) AWC phenotypes of slo-1(eg142lf); slo-2(ok2214lf) mosaic animals containing the extrachromosomal transgene odr-3p :: slo-2(OE); odr-1p :: DsRed in only one AWC cell. The data was derived from a subset of data in ( C ). ( E ) AWC phenotypes in wild-type animals expressing the extrachromosomal transgene nsy-5p :: slo-1(T1001Igf); odr-1p :: DsRed . slo-1(T1001Igf) contains the ky389gf mutation. ( F ) AWC phenotypes of mosaic animals containing the extrachromosomal transgene nsy-5p :: slo-1(T1001Igf); odr-1p :: DsRed in only one AWC cell. The data was derived from a subset of data in ( E ). AWC ON was scored as str-2 -expressing cell; AWC OFF was scored as non- str-2 -expressing cell. Statistical analysis was performed with a Z -test. Error bars represent the standard error of proportion.
    Figure Legend Snippet: slo-1 and slo-2 act cell autonomously in promoting the AWC ON fate. ( A , C ) AWC phenotypes in wild type, slo-1(eg142lf); slo-2(ok2214lf) , and slo-1(eg142lf); slo-2(ok2214lf) expressing extrachromosomal transgenes odr-3p :: slo-1(OE); odr-1p :: DsRed ( A ) or odr-3p :: slo-2(OE); odr-1p :: DsRed ( C ). ( B ) AWC phenotypes of slo-1(eg142lf); slo-2(ok2214lf) mosaic animals containing the extrachromosomal transgene odr-3p :: slo-1(OE) in only one AWC cell, inferred by the presence of the coinjection marker odr-1p :: DsRed (normally expressed in both AWC). The data was derived from a subset of data in ( A ). ( D ) AWC phenotypes of slo-1(eg142lf); slo-2(ok2214lf) mosaic animals containing the extrachromosomal transgene odr-3p :: slo-2(OE); odr-1p :: DsRed in only one AWC cell. The data was derived from a subset of data in ( C ). ( E ) AWC phenotypes in wild-type animals expressing the extrachromosomal transgene nsy-5p :: slo-1(T1001Igf); odr-1p :: DsRed . slo-1(T1001Igf) contains the ky389gf mutation. ( F ) AWC phenotypes of mosaic animals containing the extrachromosomal transgene nsy-5p :: slo-1(T1001Igf); odr-1p :: DsRed in only one AWC cell. The data was derived from a subset of data in ( E ). AWC ON was scored as str-2 -expressing cell; AWC OFF was scored as non- str-2 -expressing cell. Statistical analysis was performed with a Z -test. Error bars represent the standard error of proportion.

    Techniques Used: Activated Clotting Time Assay, Expressing, Marker, Derivative Assay, Mutagenesis

    slo-1 and slo-2 regulate the subcellular localization of synaptic markers in AWC neurons. (A ) Left panels: Images of wild type, slo-1(ky399gf) , and slo-1(eg142lf); slo-1(ok2214lf) mutants expressing the single copy insertion transgene odr-3p :: GFP :: unc-2 (the same transgene as shown in Fig 5A and 5B ) in AWC cell bodies (arrows) and axons (arrowheads) in L1. Right panel: Quantification of GFP::UNC-2 fluorescence intensity in AWC axons and cell bodies. slo-1(eg142lf); slo-1(ok2214lf) mutants displayed a significant decrease in GFP::UNC-2 intensity in AWC axons and cell bodies. ( B ) Left panels: Images of wild-type, slo-1(ky399gf) , and slo-1(eg142lf); slo-1(ok2214lf) mutants expressing the single copy insertion transgene odr-3p :: YFP :: rab-3 in AWC cell bodies (arrows) and axons (arrowheads) in L1. Right panel: Quantification of YFP::RAB-3 fluorescence intensity in AWC axons and cell bodies. slo-1(eg142lf); slo-1(ok2214lf) mutants had a significant decrease in YFP::RAB-3 intensity in AWC axons and cell bodies. ( A , B ) Anterior is at left and ventral is at bottom. Scale bar, 5 μm. Student’s t- test was used for statistical analysis. ns, not significant. Error bars, standard error of the mean. AU, arbitrary unit.
    Figure Legend Snippet: slo-1 and slo-2 regulate the subcellular localization of synaptic markers in AWC neurons. (A ) Left panels: Images of wild type, slo-1(ky399gf) , and slo-1(eg142lf); slo-1(ok2214lf) mutants expressing the single copy insertion transgene odr-3p :: GFP :: unc-2 (the same transgene as shown in Fig 5A and 5B ) in AWC cell bodies (arrows) and axons (arrowheads) in L1. Right panel: Quantification of GFP::UNC-2 fluorescence intensity in AWC axons and cell bodies. slo-1(eg142lf); slo-1(ok2214lf) mutants displayed a significant decrease in GFP::UNC-2 intensity in AWC axons and cell bodies. ( B ) Left panels: Images of wild-type, slo-1(ky399gf) , and slo-1(eg142lf); slo-1(ok2214lf) mutants expressing the single copy insertion transgene odr-3p :: YFP :: rab-3 in AWC cell bodies (arrows) and axons (arrowheads) in L1. Right panel: Quantification of YFP::RAB-3 fluorescence intensity in AWC axons and cell bodies. slo-1(eg142lf); slo-1(ok2214lf) mutants had a significant decrease in YFP::RAB-3 intensity in AWC axons and cell bodies. ( A , B ) Anterior is at left and ventral is at bottom. Scale bar, 5 μm. Student’s t- test was used for statistical analysis. ns, not significant. Error bars, standard error of the mean. AU, arbitrary unit.

    Techniques Used: Expressing, Fluorescence

    bkip-1 modulates slo-1 and slo-2 activity in AWC neurons. ( A ) Genetic analysis of known modulators of SLO-1 in AWC asymmetry. ( B ) Images of wild type and bkip-1(zw2) L1 animals expressing odr-3p :: slo-1 :: GFP in AWC axons and cell bodies. Scale bar, 5 μm. ( C, D ) Quantification of SLO-1::GFP fluorescence intensity in AWC axons (C) and AWC cell body (D). In bkip-1(zw2) mutants, SLO-1::GFP intensity is significantly decreased in AWC axons, but is not significantly affected in AWC cell body. Anterior is at left and ventral is at bottom. Student’s t- test was used for statistical analysis. ns, not significant. Error bars, standard error of the mean. AU, arbitrary unit.
    Figure Legend Snippet: bkip-1 modulates slo-1 and slo-2 activity in AWC neurons. ( A ) Genetic analysis of known modulators of SLO-1 in AWC asymmetry. ( B ) Images of wild type and bkip-1(zw2) L1 animals expressing odr-3p :: slo-1 :: GFP in AWC axons and cell bodies. Scale bar, 5 μm. ( C, D ) Quantification of SLO-1::GFP fluorescence intensity in AWC axons (C) and AWC cell body (D). In bkip-1(zw2) mutants, SLO-1::GFP intensity is significantly decreased in AWC axons, but is not significantly affected in AWC cell body. Anterior is at left and ventral is at bottom. Student’s t- test was used for statistical analysis. ns, not significant. Error bars, standard error of the mean. AU, arbitrary unit.

    Techniques Used: Activity Assay, Expressing, Fluorescence

    SLO-1 and SLO-2 BK potassium channels are localized in the vicinity of UNC-2 voltage-gated calcium channels in AWC axons. ( A-C ) Images of wild-type L1 animals expressing single copy insertion transgenes odr-3p :: slo-1 :: TagRFP and odr-3p :: GFP :: unc-2 (A), odr-3p :: slo-2 :: TagRFP and odr-3p :: GFP :: unc-2 (B), as well as odr-3p :: slo-2 :: TagRFP and odr-3p :: slo-1 :: GFP (C) in AWC neurons. SLO-1::TagRFP (A), SLO-1::GFP (C), SLO-2::TagRFP (B, C), and GFP::UNC-2 (A, B) were localized in AWC cell bodies (arrows) and in a punctate pattern along AWC axons (arrowheads). In AWC axons, SLO-1::TagRFP was localized next to GFP::UNC-2 (A); SLO-2::TagRFP was adjacent to GFP::UNC-2 (B); and SLO-2::TagRFP was localized near SLO-1::GFP (C). Insets show higher magnification of the outlined areas that exemplify localization of two translational reporters in close proximity. Scale bar, 5 μm. Anterior is at left and ventral is at bottom. (D) Quantification of mean correlation coefficient between SLO-1 and UNC-2, SLO-2 and UNC-2, as well as SLO-1 and SLO-2 using three algorithms of the Coloc 2 plugin in Fiji: Pearson’s correlation coefficient, Spearman’s rank correlation coefficient, and Li’s ICQ. For each colocalization class, images of three animals were used for quantification. Positive values of each coefficient indicate positive correlation, values close to zero indicate no correlation, and negative values indicate anti-correlation. Pearson's correlation coefficient ranges from -1 to +1; Spearman’s rank correlation coefficient ranges from -1 to +1; Li's ICQ value ranges from -0.5 to +0.5. A schematic diagram of the AWC cell body, axon, dendrite, and cilia that represents the approximate region of images in A-C is shown in S2D Fig .
    Figure Legend Snippet: SLO-1 and SLO-2 BK potassium channels are localized in the vicinity of UNC-2 voltage-gated calcium channels in AWC axons. ( A-C ) Images of wild-type L1 animals expressing single copy insertion transgenes odr-3p :: slo-1 :: TagRFP and odr-3p :: GFP :: unc-2 (A), odr-3p :: slo-2 :: TagRFP and odr-3p :: GFP :: unc-2 (B), as well as odr-3p :: slo-2 :: TagRFP and odr-3p :: slo-1 :: GFP (C) in AWC neurons. SLO-1::TagRFP (A), SLO-1::GFP (C), SLO-2::TagRFP (B, C), and GFP::UNC-2 (A, B) were localized in AWC cell bodies (arrows) and in a punctate pattern along AWC axons (arrowheads). In AWC axons, SLO-1::TagRFP was localized next to GFP::UNC-2 (A); SLO-2::TagRFP was adjacent to GFP::UNC-2 (B); and SLO-2::TagRFP was localized near SLO-1::GFP (C). Insets show higher magnification of the outlined areas that exemplify localization of two translational reporters in close proximity. Scale bar, 5 μm. Anterior is at left and ventral is at bottom. (D) Quantification of mean correlation coefficient between SLO-1 and UNC-2, SLO-2 and UNC-2, as well as SLO-1 and SLO-2 using three algorithms of the Coloc 2 plugin in Fiji: Pearson’s correlation coefficient, Spearman’s rank correlation coefficient, and Li’s ICQ. For each colocalization class, images of three animals were used for quantification. Positive values of each coefficient indicate positive correlation, values close to zero indicate no correlation, and negative values indicate anti-correlation. Pearson's correlation coefficient ranges from -1 to +1; Spearman’s rank correlation coefficient ranges from -1 to +1; Li's ICQ value ranges from -0.5 to +0.5. A schematic diagram of the AWC cell body, axon, dendrite, and cilia that represents the approximate region of images in A-C is shown in S2D Fig .

    Techniques Used: Expressing

    23) Product Images from "An Epstein-Barr Virus-Encoded Protein Complex Requires an Origin of Lytic Replication In Cis to Mediate Late Gene Transcription"

    Article Title: An Epstein-Barr Virus-Encoded Protein Complex Requires an Origin of Lytic Replication In Cis to Mediate Late Gene Transcription

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1005718

    EBV Ori Lyt is required in cis for late gene expression in the context of the intact viral genome. A) Schematic of the experiment shown in Fig 7B, in which 293 cells infected with either a wildtype EBV genome (EBV WT) or an EBV genome lacking an Ori Lyt (EBV Δ Ori Lyt) are transfected with either a plasmid that expresses a GFP-VCAp18 fusion protein under the control of the native VCAp18 promoter (i.e., BFRF3 p) or an identical plasmid that also contains the EBV Ori Lyt. B) Immunoblots showing expression of the early gene product BMRF1 (bottom panels) and the late gene products GFP-VCAp18 (from plasmid) and VCAp18 (from EBV genome) (top panels) in presence or absence of EBV Ori Lyt on either the plasmid or the intact EBV genome. pTATT-GFP-VCAp18 or pTATT-GFP-VCAp18- Ori Lyt were transfected into cells stably infected with either EBV Δ Ori Lyt (left panels) or EBV WT (right panels) genomes. For each condition, cells were either uninduced or induced by transfection of R and Z expression plasmids. Immunoblots were performed at 60 hours post-transfection.
    Figure Legend Snippet: EBV Ori Lyt is required in cis for late gene expression in the context of the intact viral genome. A) Schematic of the experiment shown in Fig 7B, in which 293 cells infected with either a wildtype EBV genome (EBV WT) or an EBV genome lacking an Ori Lyt (EBV Δ Ori Lyt) are transfected with either a plasmid that expresses a GFP-VCAp18 fusion protein under the control of the native VCAp18 promoter (i.e., BFRF3 p) or an identical plasmid that also contains the EBV Ori Lyt. B) Immunoblots showing expression of the early gene product BMRF1 (bottom panels) and the late gene products GFP-VCAp18 (from plasmid) and VCAp18 (from EBV genome) (top panels) in presence or absence of EBV Ori Lyt on either the plasmid or the intact EBV genome. pTATT-GFP-VCAp18 or pTATT-GFP-VCAp18- Ori Lyt were transfected into cells stably infected with either EBV Δ Ori Lyt (left panels) or EBV WT (right panels) genomes. For each condition, cells were either uninduced or induced by transfection of R and Z expression plasmids. Immunoblots were performed at 60 hours post-transfection.

    Techniques Used: Expressing, Infection, Transfection, Plasmid Preparation, Western Blot, Stable Transfection

    Loss of the TATT motif or Ori Lyt disrupts βγ gene dependent transcription. Images of 293 cells infected with the indicated EBV βγ gene deletion mutant and transfected with either pTATT-GFP-VCAp18- Ori Lyt (top rows), pTATT-GFP-VCAp18 (middle rows) or pTATA-GFP-VCAp18- Ori Lyt (bottom rows) either induced (I) by transfection of R and Z (second, forth, and sixth columns) or induced and trans- complemented (I + t ) by transfection of R, Z, and the relevant βγ expression plasmid (first, third, and fifth columns). Cells were scored for GFP at 60 hours post transfection.
    Figure Legend Snippet: Loss of the TATT motif or Ori Lyt disrupts βγ gene dependent transcription. Images of 293 cells infected with the indicated EBV βγ gene deletion mutant and transfected with either pTATT-GFP-VCAp18- Ori Lyt (top rows), pTATT-GFP-VCAp18 (middle rows) or pTATA-GFP-VCAp18- Ori Lyt (bottom rows) either induced (I) by transfection of R and Z (second, forth, and sixth columns) or induced and trans- complemented (I + t ) by transfection of R, Z, and the relevant βγ expression plasmid (first, third, and fifth columns). Cells were scored for GFP at 60 hours post transfection.

    Techniques Used: Infection, Mutagenesis, Transfection, Expressing, Plasmid Preparation

    An EBV Ori Lyt in cis is required for activation of a TATT-containing reporter. A) Luciferase assays showing relative fold activation of the TATT-containing EBV BcLF1 promoter (black bars) and its corresponding control reporter where a point mutation changes T at the fourth position to A, making a conventional TATA box (gray bars). For each condition, 293 R-stop cells were either uninduced, induced for lytic replication by transfection of R or induced for lytic replication by transfection of an R expression plasmid and also treated with the herpesvirus DNA polymerase inhibitor, acyclovir. Fold activation relative to uninduced value is reported, after normalization to renilla internal control. B) Luciferase assays showing relative fold activation of the TATT-containing EBV BcLF1 promoter in presence or absence of EBV minimal Ori Lyt in cis in each EBV Δβγ 293 cell line. For each condition, cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans -complemented by transfection of R, Z, and the relevant βγ expression plasmid (I + t ). Relative fold activation is reported after normalization to renilla internal control and to the uninduced (U) values. C) Image of 293 EBV cells transfected with either pTATT-GFP-VCAp18 (left column) or pTATT-GFP-VCAp18- Ori Lyt (right column) either without induction of EBV replication (top row, U) or induced by transfection of R and Z (bottom row, I). Cells were scored for GFP at 60 hours post transfection.
    Figure Legend Snippet: An EBV Ori Lyt in cis is required for activation of a TATT-containing reporter. A) Luciferase assays showing relative fold activation of the TATT-containing EBV BcLF1 promoter (black bars) and its corresponding control reporter where a point mutation changes T at the fourth position to A, making a conventional TATA box (gray bars). For each condition, 293 R-stop cells were either uninduced, induced for lytic replication by transfection of R or induced for lytic replication by transfection of an R expression plasmid and also treated with the herpesvirus DNA polymerase inhibitor, acyclovir. Fold activation relative to uninduced value is reported, after normalization to renilla internal control. B) Luciferase assays showing relative fold activation of the TATT-containing EBV BcLF1 promoter in presence or absence of EBV minimal Ori Lyt in cis in each EBV Δβγ 293 cell line. For each condition, cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans -complemented by transfection of R, Z, and the relevant βγ expression plasmid (I + t ). Relative fold activation is reported after normalization to renilla internal control and to the uninduced (U) values. C) Image of 293 EBV cells transfected with either pTATT-GFP-VCAp18 (left column) or pTATT-GFP-VCAp18- Ori Lyt (right column) either without induction of EBV replication (top row, U) or induced by transfection of R and Z (bottom row, I). Cells were scored for GFP at 60 hours post transfection.

    Techniques Used: Activation Assay, Luciferase, Mutagenesis, Transfection, Expressing, Plasmid Preparation

    EBV lytic DNA replication is necessary for TATT reporter activation. A) Luciferase assay showing relative fold activation of the TATT-containing EBV BcLF1 promoter in presence or absence of EBV minimal Ori Lyt in cis in the replication defective EBV ΔBALF2/HA-BcRF1 293 cells. For each condition, cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans -complemented by transfection of R, Z, and BALF2 (I + t ). Relative fold activation is reported after normalization to renilla internal control and to the uninduced (U) values. B) pTATT-GFP-VCAp18- Ori Lyt, expressing the fusion protein GFP-VCAp18 under control of the late VCAp18 promoter (i.e. BFRF3p) and containing EBV Ori Lyt was transfected in 293 cells containing EBV ΔBALF2/HA-BcRF1 genome. Cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans -complemented by transfection of R, Z and BALF2 (I + t ). Cell were scored for GFP at 60 hours post transfection.
    Figure Legend Snippet: EBV lytic DNA replication is necessary for TATT reporter activation. A) Luciferase assay showing relative fold activation of the TATT-containing EBV BcLF1 promoter in presence or absence of EBV minimal Ori Lyt in cis in the replication defective EBV ΔBALF2/HA-BcRF1 293 cells. For each condition, cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans -complemented by transfection of R, Z, and BALF2 (I + t ). Relative fold activation is reported after normalization to renilla internal control and to the uninduced (U) values. B) pTATT-GFP-VCAp18- Ori Lyt, expressing the fusion protein GFP-VCAp18 under control of the late VCAp18 promoter (i.e. BFRF3p) and containing EBV Ori Lyt was transfected in 293 cells containing EBV ΔBALF2/HA-BcRF1 genome. Cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans -complemented by transfection of R, Z and BALF2 (I + t ). Cell were scored for GFP at 60 hours post transfection.

    Techniques Used: Activation Assay, Luciferase, Transfection, Expressing

    24) Product Images from "Shigella flexneri suppresses NF-kB activation by inhibiting linear ubiquitin chain ligation"

    Article Title: Shigella flexneri suppresses NF-kB activation by inhibiting linear ubiquitin chain ligation

    Journal: Nature microbiology

    doi: 10.1038/nmicrobiol.2016.84

    IpaH1.4 is the major E3 ligase regulator of cytokine RSCs a, Degradation assay in HEK293T cells expressing GFP-tagged Shigella IpaH proteins in combination with TNF-R and IL-1R signaling components. Shown are representative Western blots from three independent experiments. S. flexneri IpaH6 and IpaH7 are nearly identical to IpaH1 and IpaH4, respectively 30 . IpaH1 is encoded by S. fexneri M90T ORF SF5M90T_2545, IpaH2 by SF5M90T_1825, IpaH3 by SF5M90T_1355, IpaH4 by SF5M90T_1966, IpaH5 by SF5M90T_2665, IpaH6 by SF5M90T_744 and IpaH7 by SF5M90T_2130. b, Western blotting shows that compared to non-infected control cells (NI), endogenous HOIP protein levels are reduced in CaCo-2 cells infected for 5h with S. flexneri M90T (WT) at MOI 150. No reduction in stability (in same samples) of endogenous TRAF2, NEMO, p65, HOIL-1L, TRADD, TAK1 or IKKα was detected. Western blots from three independent experiments were quantified and presented as the mean +/− s.d. *P
    Figure Legend Snippet: IpaH1.4 is the major E3 ligase regulator of cytokine RSCs a, Degradation assay in HEK293T cells expressing GFP-tagged Shigella IpaH proteins in combination with TNF-R and IL-1R signaling components. Shown are representative Western blots from three independent experiments. S. flexneri IpaH6 and IpaH7 are nearly identical to IpaH1 and IpaH4, respectively 30 . IpaH1 is encoded by S. fexneri M90T ORF SF5M90T_2545, IpaH2 by SF5M90T_1825, IpaH3 by SF5M90T_1355, IpaH4 by SF5M90T_1966, IpaH5 by SF5M90T_2665, IpaH6 by SF5M90T_744 and IpaH7 by SF5M90T_2130. b, Western blotting shows that compared to non-infected control cells (NI), endogenous HOIP protein levels are reduced in CaCo-2 cells infected for 5h with S. flexneri M90T (WT) at MOI 150. No reduction in stability (in same samples) of endogenous TRAF2, NEMO, p65, HOIL-1L, TRADD, TAK1 or IKKα was detected. Western blots from three independent experiments were quantified and presented as the mean +/− s.d. *P

    Techniques Used: Degradation Assay, Expressing, Western Blot, Infection

    25) Product Images from "Structural analysis of the role of TPX2 in branching microtubule nucleation"

    Article Title: Structural analysis of the role of TPX2 in branching microtubule nucleation

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201607060

    Branching MT nucleation activity of multiple TPX2 single-site mutants. (A) Domain organization of TPX2 α5–α7 showing the location of single-site mutations. (B–L) Branching MT nucleation in Xenopus egg meiotic extracts and in the presence of 2 µM TPX2 α5–α7 with and without various single-site mutations. The same results were obtained with a lower TPX2 concentration of 1 µM. Images for F492AzF, F629AzF, and F714AzF mutants, which show a high level of activity, as well as the image for the positive control TPX2 α5–α7, were collected using one extract. Images for the rest of the mutants and the negative control were collected with a different extract. This was necessary because the lifetime of one extract was incompatible with the high number of samples; however, both controls are representative and consistent among all extracts tested. EB1-mCherry (green) and Cy5-labeled porcine brain tubulin (red) were added to the extract to follow MT plus ends and MTs, respectively. Vanadate was added to prevent dynein-mediated MT gliding. All images were acquired after 15 min. Brightness and contrast were adjusted for each image individually to optimize visual comparison of MT structures. Bar, 10 µm. See Video 3. (M) The number of EB1 particles was counted for three different fields of view and the mean was plotted against time. The data are displayed for the addition of TPX2 α5–α7 and all the inactive mutants. Data collection for the positive control, TPX2 α5–α7, was interrupted in the region denoted by the dashed line. Error bars represent standard deviation. (N) Same as M, but the data are depicted for the addition of TPX2 α5–α7 and mutants that have full or intermediate activity. Measurements also represent the mean of three different fields of view, and the error bars denote standard deviation. All extract experiments were performed at least three different times.
    Figure Legend Snippet: Branching MT nucleation activity of multiple TPX2 single-site mutants. (A) Domain organization of TPX2 α5–α7 showing the location of single-site mutations. (B–L) Branching MT nucleation in Xenopus egg meiotic extracts and in the presence of 2 µM TPX2 α5–α7 with and without various single-site mutations. The same results were obtained with a lower TPX2 concentration of 1 µM. Images for F492AzF, F629AzF, and F714AzF mutants, which show a high level of activity, as well as the image for the positive control TPX2 α5–α7, were collected using one extract. Images for the rest of the mutants and the negative control were collected with a different extract. This was necessary because the lifetime of one extract was incompatible with the high number of samples; however, both controls are representative and consistent among all extracts tested. EB1-mCherry (green) and Cy5-labeled porcine brain tubulin (red) were added to the extract to follow MT plus ends and MTs, respectively. Vanadate was added to prevent dynein-mediated MT gliding. All images were acquired after 15 min. Brightness and contrast were adjusted for each image individually to optimize visual comparison of MT structures. Bar, 10 µm. See Video 3. (M) The number of EB1 particles was counted for three different fields of view and the mean was plotted against time. The data are displayed for the addition of TPX2 α5–α7 and all the inactive mutants. Data collection for the positive control, TPX2 α5–α7, was interrupted in the region denoted by the dashed line. Error bars represent standard deviation. (N) Same as M, but the data are depicted for the addition of TPX2 α5–α7 and mutants that have full or intermediate activity. Measurements also represent the mean of three different fields of view, and the error bars denote standard deviation. All extract experiments were performed at least three different times.

    Techniques Used: Activity Assay, Concentration Assay, Positive Control, Negative Control, Labeling, Standard Deviation

    26) Product Images from "Rapid movement and transcriptional re‐localization of human cohesin on DNA"

    Article Title: Rapid movement and transcriptional re‐localization of human cohesin on DNA

    Journal: The EMBO Journal

    doi: 10.15252/embj.201695402

    Recombinant human tetrameric cohesin complexes bind to DNA , translocate rapidly in high‐salt buffer, and are released following DNA or cohesin cleavage Instant Blue stained SDS–polyacrylamide gel of Scc1 wt ‐cohesin tetramers used in (B). Cohesin loading assay. Scc1 wt ‐cohesin tetramer was incubated with nicked circular (C) or 1×, 2×, or 4× concentration of linearized (L) plasmid DNA, immunoprecipitated with anti‐Scc1 antibodies, washed with high‐salt buffer, and then eluted with Scc1 peptide. Recovered DNA was separated by agarose gel electrophoresis and stained with GelRed DNA stain. Input DNA = 7%. Mean ± SEM is shown. Silver stained SDS–polyacrylamide gel of non‐cleaved and cleaved Scc1 Halo‐TEV ‐cohesin tetramers used in (D). Non‐cleaved and cleaved Scc1 Halo‐TEV ‐cohesin tetramer were incubated with nicked circular plasmid DNA and processed as in (B). Input DNA = 4%. Mean ± SEM is shown. Kymograph of Scc1 GFP‐TEV ‐cohesin bound to doubly tethered λ‐DNA in cohesin binding buffer and washed with 750 mM NaCl buffer + Sytox Orange. XhoI flow in induced DNA cleavage and cohesin release. Kymographs of Scc1 GFP‐TEV ‐cohesin and Scc1 GFP ‐cohesin bound to doubly tethered λ‐DNA and washed with 750 mM NaCl buffer. TEV protease flow in released Scc1 GFP‐TEV but not Scc1 GFP from DNA. Data information: Flow in from top and scale bar = 5 μm in all kymographs. Source data are available online for this figure.
    Figure Legend Snippet: Recombinant human tetrameric cohesin complexes bind to DNA , translocate rapidly in high‐salt buffer, and are released following DNA or cohesin cleavage Instant Blue stained SDS–polyacrylamide gel of Scc1 wt ‐cohesin tetramers used in (B). Cohesin loading assay. Scc1 wt ‐cohesin tetramer was incubated with nicked circular (C) or 1×, 2×, or 4× concentration of linearized (L) plasmid DNA, immunoprecipitated with anti‐Scc1 antibodies, washed with high‐salt buffer, and then eluted with Scc1 peptide. Recovered DNA was separated by agarose gel electrophoresis and stained with GelRed DNA stain. Input DNA = 7%. Mean ± SEM is shown. Silver stained SDS–polyacrylamide gel of non‐cleaved and cleaved Scc1 Halo‐TEV ‐cohesin tetramers used in (D). Non‐cleaved and cleaved Scc1 Halo‐TEV ‐cohesin tetramer were incubated with nicked circular plasmid DNA and processed as in (B). Input DNA = 4%. Mean ± SEM is shown. Kymograph of Scc1 GFP‐TEV ‐cohesin bound to doubly tethered λ‐DNA in cohesin binding buffer and washed with 750 mM NaCl buffer + Sytox Orange. XhoI flow in induced DNA cleavage and cohesin release. Kymographs of Scc1 GFP‐TEV ‐cohesin and Scc1 GFP ‐cohesin bound to doubly tethered λ‐DNA and washed with 750 mM NaCl buffer. TEV protease flow in released Scc1 GFP‐TEV but not Scc1 GFP from DNA. Data information: Flow in from top and scale bar = 5 μm in all kymographs. Source data are available online for this figure.

    Techniques Used: Recombinant, Staining, Incubation, Concentration Assay, Plasmid Preparation, Immunoprecipitation, Agarose Gel Electrophoresis, Binding Assay, Flow Cytometry

    Characterization of recombinant human tetrameric cohesin complexes Cohesin loading assay. Scc1 Halo‐TMR‐TEV ‐cohesin tetramer was incubated with nicked circular plasmid DNA, immunoprecipitated with anti‐Scc1 antibodies, and washed with high‐salt buffer. DNA was eluted using proteinase K, separated by agarose gel electrophoresis, and stained with GelRed DNA stain. Input DNA = 10%. Mean ± SEM are shown. Silver staining of purified recombinant human Scc1 GFP , Scc1 GFP‐TEV and Scc1 Halo‐TMR‐TEV ‐cohesin tetramers after SDS–polyacrylamide gel electrophoresis (PAGE). TMR was visualized by UV excitation. Xenopus sperm chromatin, purified human cohesin, and interphase Xenopus egg extract were incubated for 75 min. TEV protease was then added for 15 min to cleave Scc1 TEV . Chromatin‐bound material was analyzed by immunoblotting. Human and Xenopus Scc1 can be distinguished by the GFP/Halo‐induced mobility shift. Kymographs of Scc1 GFP‐TEV ‐cohesin binding to singly or doubly tethered bacteriophage λ genomic DNA in cohesin binding buffer + Sytox Orange. Doubly tethered DNA molecules were extended in the presence and absence of buffer flow, whereas singly tethered DNA molecules were only stretched under flow. The diffusion of Scc1 GFP‐TEV ‐cohesin on doubly tethered DNA was minimal in low‐salt buffer. Scc1 GFP‐TEV ‐cohesin rapidly compacted singly tethered DNA. Kymograph of Scc1 GFP‐TEV ‐cohesin bound to λ‐DNA during buffer exchange from cohesin binding buffer to 750 mM NaCl buffer. Kymograph of Scc1 Halo‐TMR‐TEV ‐cohesin bound to doubly tethered λ‐DNA in cohesin binding buffer and washed with 750 mM NaCl buffer + Sytox Green. Note the existence of bright and dim cohesin complexes on DNA. The DNA broke spontaneously at 188 s, releasing translocating cohesin complexes. Representative field of view showing Scc1 Halo‐TMR‐TEV ‐cohesin bound to λ‐DNA in cohesin binding buffer. Representative field of view showing Scc1 Halo‐TMR‐TEV ‐cohesin bound to λ‐DNA after 750 mM NaCl wash. Upper panels: flow off; lower panels: flow on. Scc1 Halo‐TMR‐TEV ‐cohesin was pushed to the ends of doubly tethered DNA molecules by buffer flow. Data information: Flow in from top and scale bar = 5 μm in all kymographs. Source data are available online for this figure.
    Figure Legend Snippet: Characterization of recombinant human tetrameric cohesin complexes Cohesin loading assay. Scc1 Halo‐TMR‐TEV ‐cohesin tetramer was incubated with nicked circular plasmid DNA, immunoprecipitated with anti‐Scc1 antibodies, and washed with high‐salt buffer. DNA was eluted using proteinase K, separated by agarose gel electrophoresis, and stained with GelRed DNA stain. Input DNA = 10%. Mean ± SEM are shown. Silver staining of purified recombinant human Scc1 GFP , Scc1 GFP‐TEV and Scc1 Halo‐TMR‐TEV ‐cohesin tetramers after SDS–polyacrylamide gel electrophoresis (PAGE). TMR was visualized by UV excitation. Xenopus sperm chromatin, purified human cohesin, and interphase Xenopus egg extract were incubated for 75 min. TEV protease was then added for 15 min to cleave Scc1 TEV . Chromatin‐bound material was analyzed by immunoblotting. Human and Xenopus Scc1 can be distinguished by the GFP/Halo‐induced mobility shift. Kymographs of Scc1 GFP‐TEV ‐cohesin binding to singly or doubly tethered bacteriophage λ genomic DNA in cohesin binding buffer + Sytox Orange. Doubly tethered DNA molecules were extended in the presence and absence of buffer flow, whereas singly tethered DNA molecules were only stretched under flow. The diffusion of Scc1 GFP‐TEV ‐cohesin on doubly tethered DNA was minimal in low‐salt buffer. Scc1 GFP‐TEV ‐cohesin rapidly compacted singly tethered DNA. Kymograph of Scc1 GFP‐TEV ‐cohesin bound to λ‐DNA during buffer exchange from cohesin binding buffer to 750 mM NaCl buffer. Kymograph of Scc1 Halo‐TMR‐TEV ‐cohesin bound to doubly tethered λ‐DNA in cohesin binding buffer and washed with 750 mM NaCl buffer + Sytox Green. Note the existence of bright and dim cohesin complexes on DNA. The DNA broke spontaneously at 188 s, releasing translocating cohesin complexes. Representative field of view showing Scc1 Halo‐TMR‐TEV ‐cohesin bound to λ‐DNA in cohesin binding buffer. Representative field of view showing Scc1 Halo‐TMR‐TEV ‐cohesin bound to λ‐DNA after 750 mM NaCl wash. Upper panels: flow off; lower panels: flow on. Scc1 Halo‐TMR‐TEV ‐cohesin was pushed to the ends of doubly tethered DNA molecules by buffer flow. Data information: Flow in from top and scale bar = 5 μm in all kymographs. Source data are available online for this figure.

    Techniques Used: Recombinant, Incubation, Plasmid Preparation, Immunoprecipitation, Agarose Gel Electrophoresis, Staining, Silver Staining, Purification, Polyacrylamide Gel Electrophoresis, Mobility Shift, Binding Assay, Flow Cytometry, Diffusion-based Assay, Buffer Exchange

    Cohesin dimers or cleaved tetramers are deficient in DNA binding Silver staining and Western blotting of non‐cleaved and cleaved Scc1 Halo‐TMR‐TEV ‐cohesin tetramers complexes used in (B, C). TMR was visualized by UV excitation. Representative fields of view of λ‐DNA flow chambers incubated with non‐cleaved (upper panels) or cleaved (lower panels) cohesin and washed with 25 mM NaCl, 25 mM KCl buffer plus Sytox Green. Quantification of non‐cleaved or cleaved cohesin bound to DNA; 226 DNA molecules were analyzed for non‐cleaved, 245 for cleaved. Silver stained SDS–polyacrylamide gel of cohesin dimers and tetramers used in (E, F). Representative fields of view of λ‐DNA flow chambers incubated with cohesin dimers (upper panels) or tetramers (lower panels) and washed with 25 mM NaCl, 25 mM KCl buffer plus Sytox Green. Quantification of cohesin dimers or tetramers bound to DNA; 205 DNA molecules were analyzed for dimer, 173 for tetramer. Data information: Scale bar = 5 μm. Source data are available online for this figure.
    Figure Legend Snippet: Cohesin dimers or cleaved tetramers are deficient in DNA binding Silver staining and Western blotting of non‐cleaved and cleaved Scc1 Halo‐TMR‐TEV ‐cohesin tetramers complexes used in (B, C). TMR was visualized by UV excitation. Representative fields of view of λ‐DNA flow chambers incubated with non‐cleaved (upper panels) or cleaved (lower panels) cohesin and washed with 25 mM NaCl, 25 mM KCl buffer plus Sytox Green. Quantification of non‐cleaved or cleaved cohesin bound to DNA; 226 DNA molecules were analyzed for non‐cleaved, 245 for cleaved. Silver stained SDS–polyacrylamide gel of cohesin dimers and tetramers used in (E, F). Representative fields of view of λ‐DNA flow chambers incubated with cohesin dimers (upper panels) or tetramers (lower panels) and washed with 25 mM NaCl, 25 mM KCl buffer plus Sytox Green. Quantification of cohesin dimers or tetramers bound to DNA; 205 DNA molecules were analyzed for dimer, 173 for tetramer. Data information: Scale bar = 5 μm. Source data are available online for this figure.

    Techniques Used: Binding Assay, Silver Staining, Western Blot, Flow Cytometry, Incubation, Staining

    ATP is not required for the salt‐resistant binding of cohesin to DNA and does not affect the diffusion coefficient of cohesin on DNA Silver stained SDS–polyacrylamide gel of cohesin complexes used in (B–F). Thin‐layer chromatography of [γ‐ 32 P]‐ATP hydrolysis following incubation with cohesin. Smc1/3 wild‐type or K38A ATP binding‐deficient “KA” Scc1 Halo‐TMR‐TEV ‐cohesin was incubated with nicked circular plasmid DNA in the presence or absence of nucleotide analogues and immunoprecipitated with anti‐Scc1 antibodies. Eluted DNA was separated by agarose gel electrophoresis. Input DNA = 5%. Mean ± SEM are shown. High temporal resolution kymographs of single Smc1/3 wild‐type or KA Scc1 Halo‐TMR‐TEV ‐cohesin complexes bound to doubly tethered λ‐DNA in the presence or absence of ATP and washed with 750 mM NaCl buffer. Scale bar = 5 μm. Source data are available online for this figure.
    Figure Legend Snippet: ATP is not required for the salt‐resistant binding of cohesin to DNA and does not affect the diffusion coefficient of cohesin on DNA Silver stained SDS–polyacrylamide gel of cohesin complexes used in (B–F). Thin‐layer chromatography of [γ‐ 32 P]‐ATP hydrolysis following incubation with cohesin. Smc1/3 wild‐type or K38A ATP binding‐deficient “KA” Scc1 Halo‐TMR‐TEV ‐cohesin was incubated with nicked circular plasmid DNA in the presence or absence of nucleotide analogues and immunoprecipitated with anti‐Scc1 antibodies. Eluted DNA was separated by agarose gel electrophoresis. Input DNA = 5%. Mean ± SEM are shown. High temporal resolution kymographs of single Smc1/3 wild‐type or KA Scc1 Halo‐TMR‐TEV ‐cohesin complexes bound to doubly tethered λ‐DNA in the presence or absence of ATP and washed with 750 mM NaCl buffer. Scale bar = 5 μm. Source data are available online for this figure.

    Techniques Used: Binding Assay, Diffusion-based Assay, Staining, Thin Layer Chromatography, Incubation, Plasmid Preparation, Immunoprecipitation, Agarose Gel Electrophoresis

    27) Product Images from "Rapid movement and transcriptional re‐localization of human cohesin on DNA"

    Article Title: Rapid movement and transcriptional re‐localization of human cohesin on DNA

    Journal: The EMBO Journal

    doi: 10.15252/embj.201695402

    Characterization of recombinant human tetrameric cohesin complexes Cohesin loading assay. Scc1 Halo‐TMR‐TEV ‐cohesin tetramer was incubated with nicked circular plasmid DNA, immunoprecipitated with anti‐Scc1 antibodies, and washed with high‐salt buffer. DNA was eluted using proteinase K, separated by agarose gel electrophoresis, and stained with GelRed DNA stain. Input DNA = 10%. Mean ± SEM are shown. Silver staining of purified recombinant human Scc1 GFP , Scc1 GFP‐TEV and Scc1 Halo‐TMR‐TEV ‐cohesin tetramers after SDS–polyacrylamide gel electrophoresis (PAGE). TMR was visualized by UV excitation. Xenopus sperm chromatin, purified human cohesin, and interphase Xenopus egg extract were incubated for 75 min. TEV protease was then added for 15 min to cleave Scc1 TEV . Chromatin‐bound material was analyzed by immunoblotting. Human and Xenopus Scc1 can be distinguished by the GFP/Halo‐induced mobility shift. Kymographs of Scc1 GFP‐TEV ‐cohesin binding to singly or doubly tethered bacteriophage λ genomic DNA in cohesin binding buffer + Sytox Orange. Doubly tethered DNA molecules were extended in the presence and absence of buffer flow, whereas singly tethered DNA molecules were only stretched under flow. The diffusion of Scc1 GFP‐TEV ‐cohesin on doubly tethered DNA was minimal in low‐salt buffer. Scc1 GFP‐TEV ‐cohesin rapidly compacted singly tethered DNA. Kymograph of Scc1 GFP‐TEV ‐cohesin bound to λ‐DNA during buffer exchange from cohesin binding buffer to 750 mM NaCl buffer. Kymograph of Scc1 Halo‐TMR‐TEV ‐cohesin bound to doubly tethered λ‐DNA in cohesin binding buffer and washed with 750 mM NaCl buffer + Sytox Green. Note the existence of bright and dim cohesin complexes on DNA. The DNA broke spontaneously at 188 s, releasing translocating cohesin complexes. Representative field of view showing Scc1 Halo‐TMR‐TEV ‐cohesin bound to λ‐DNA in cohesin binding buffer. Representative field of view showing Scc1 Halo‐TMR‐TEV ‐cohesin bound to λ‐DNA after 750 mM NaCl wash. Upper panels: flow off; lower panels: flow on. Scc1 Halo‐TMR‐TEV ‐cohesin was pushed to the ends of doubly tethered DNA molecules by buffer flow. Data information: Flow in from top and scale bar = 5 μm in all kymographs. Source data are available online for this figure.
    Figure Legend Snippet: Characterization of recombinant human tetrameric cohesin complexes Cohesin loading assay. Scc1 Halo‐TMR‐TEV ‐cohesin tetramer was incubated with nicked circular plasmid DNA, immunoprecipitated with anti‐Scc1 antibodies, and washed with high‐salt buffer. DNA was eluted using proteinase K, separated by agarose gel electrophoresis, and stained with GelRed DNA stain. Input DNA = 10%. Mean ± SEM are shown. Silver staining of purified recombinant human Scc1 GFP , Scc1 GFP‐TEV and Scc1 Halo‐TMR‐TEV ‐cohesin tetramers after SDS–polyacrylamide gel electrophoresis (PAGE). TMR was visualized by UV excitation. Xenopus sperm chromatin, purified human cohesin, and interphase Xenopus egg extract were incubated for 75 min. TEV protease was then added for 15 min to cleave Scc1 TEV . Chromatin‐bound material was analyzed by immunoblotting. Human and Xenopus Scc1 can be distinguished by the GFP/Halo‐induced mobility shift. Kymographs of Scc1 GFP‐TEV ‐cohesin binding to singly or doubly tethered bacteriophage λ genomic DNA in cohesin binding buffer + Sytox Orange. Doubly tethered DNA molecules were extended in the presence and absence of buffer flow, whereas singly tethered DNA molecules were only stretched under flow. The diffusion of Scc1 GFP‐TEV ‐cohesin on doubly tethered DNA was minimal in low‐salt buffer. Scc1 GFP‐TEV ‐cohesin rapidly compacted singly tethered DNA. Kymograph of Scc1 GFP‐TEV ‐cohesin bound to λ‐DNA during buffer exchange from cohesin binding buffer to 750 mM NaCl buffer. Kymograph of Scc1 Halo‐TMR‐TEV ‐cohesin bound to doubly tethered λ‐DNA in cohesin binding buffer and washed with 750 mM NaCl buffer + Sytox Green. Note the existence of bright and dim cohesin complexes on DNA. The DNA broke spontaneously at 188 s, releasing translocating cohesin complexes. Representative field of view showing Scc1 Halo‐TMR‐TEV ‐cohesin bound to λ‐DNA in cohesin binding buffer. Representative field of view showing Scc1 Halo‐TMR‐TEV ‐cohesin bound to λ‐DNA after 750 mM NaCl wash. Upper panels: flow off; lower panels: flow on. Scc1 Halo‐TMR‐TEV ‐cohesin was pushed to the ends of doubly tethered DNA molecules by buffer flow. Data information: Flow in from top and scale bar = 5 μm in all kymographs. Source data are available online for this figure.

    Techniques Used: Recombinant, Incubation, Plasmid Preparation, Immunoprecipitation, Agarose Gel Electrophoresis, Staining, Silver Staining, Purification, Polyacrylamide Gel Electrophoresis, Mobility Shift, Binding Assay, Flow Cytometry, Diffusion-based Assay, Buffer Exchange

    28) Product Images from "Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system"

    Article Title: Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-017-0814-6

    Design of the CRISPR/CAS9 system for gene deletion in C. glutamicum . a Strategy for construction of pFSC. Cas9 is controlled by the IPTG-inducible Ptac promoter, the SD sequence is designed to enhance the expression of Cas9; b strategy for construction of pFST. The sgRNA cassette is under the control of the IPTG-inducible Ptrc promoter, the 20 nt target sequence is shown in gold, the backbone is a temperature sensitive repA replicon, the HDarm is ligated into pFST at the Bgl II site; c strategy for construction of the sgRNA. The red N20 is the 20 nt target sequence, and the underlined sequences are the sgRNA scaffold. The Eco RI and Xba I sites are used to assemble the sgRNA into pFST
    Figure Legend Snippet: Design of the CRISPR/CAS9 system for gene deletion in C. glutamicum . a Strategy for construction of pFSC. Cas9 is controlled by the IPTG-inducible Ptac promoter, the SD sequence is designed to enhance the expression of Cas9; b strategy for construction of pFST. The sgRNA cassette is under the control of the IPTG-inducible Ptrc promoter, the 20 nt target sequence is shown in gold, the backbone is a temperature sensitive repA replicon, the HDarm is ligated into pFST at the Bgl II site; c strategy for construction of the sgRNA. The red N20 is the 20 nt target sequence, and the underlined sequences are the sgRNA scaffold. The Eco RI and Xba I sites are used to assemble the sgRNA into pFST

    Techniques Used: CRISPR, Sequencing, Expressing

    CRISPR/Cas9-mediated genome editing in C. glutamicum ATCC 13032 and C. glutamicum CGMCC1.15647. a Schematic depicting editing procedures. The left and right arms are regions from the targeted gene and are amplified by PCR from C. glutamicum genomic DNA. LF and LR primers are used to amplify the left arm, and RF and RR primers are used to amplify the right arm. For Gibson assembly, the 5′ end of LF contains a 20 bp overhang region of the 5′ end of the Bgl II site from the pFST plasmid. The 5′ end of LR contains a 10 bp overhang region of the 5′ end of the right arm. The 5′ end of RF contains a 10 bp overhang region of the 3′ end of the left arm. The 5′ end of RR contains a 20 bp overhang region of the 3′ end of the Bgl II site from the pFST plasmid. CF and CR are primers for PCR validation of editing efficiency. The SEQ primer is used for sequencing. b The CRISPR/Cas9 system mediated disruption of the porB gene in C. glutamicum ATCC 13032. The editing efficiency was 18/18. The lane ‘ck’ is the PCR product from the wild-type strain. These results were confirmed by sequencing. c The CRISPR/Cas9 system mediated disruption of the proB gene in C. glutamicum CGMCC1.15647. The editing efficiency was 16/16
    Figure Legend Snippet: CRISPR/Cas9-mediated genome editing in C. glutamicum ATCC 13032 and C. glutamicum CGMCC1.15647. a Schematic depicting editing procedures. The left and right arms are regions from the targeted gene and are amplified by PCR from C. glutamicum genomic DNA. LF and LR primers are used to amplify the left arm, and RF and RR primers are used to amplify the right arm. For Gibson assembly, the 5′ end of LF contains a 20 bp overhang region of the 5′ end of the Bgl II site from the pFST plasmid. The 5′ end of LR contains a 10 bp overhang region of the 5′ end of the right arm. The 5′ end of RF contains a 10 bp overhang region of the 3′ end of the left arm. The 5′ end of RR contains a 20 bp overhang region of the 3′ end of the Bgl II site from the pFST plasmid. CF and CR are primers for PCR validation of editing efficiency. The SEQ primer is used for sequencing. b The CRISPR/Cas9 system mediated disruption of the porB gene in C. glutamicum ATCC 13032. The editing efficiency was 18/18. The lane ‘ck’ is the PCR product from the wild-type strain. These results were confirmed by sequencing. c The CRISPR/Cas9 system mediated disruption of the proB gene in C. glutamicum CGMCC1.15647. The editing efficiency was 16/16

    Techniques Used: CRISPR, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Sequencing

    Evaluation of editing efficiency with different arm sizes. a Design of HDarms of various sizes (600, 300, 100 bp). Both sides of the HDarm contain a 20 bp overhang region of the Bgl II site from the pFST plasmid. b Disruption of the porB gene mediated by the CRISPR/Cas9 system in C. glutamicum ATCC 13032 with a 600 bp HDarm. The editing efficiency was 10/12, the lane ‘ck’ is the PCR product from the wild-type strain. c Disruption of the porB gene mediated by the CRISPR/Cas9 system in C. glutamicum ATCC 13032 with a 300 bp HDarm. The editing efficiency was 10/12. d Disruption of the porB gene mediated by the CRISPR/Cas9 system in C. glutamicum ATCC 13032 with a 100 bp HDarm. The editing efficiency was 2/12
    Figure Legend Snippet: Evaluation of editing efficiency with different arm sizes. a Design of HDarms of various sizes (600, 300, 100 bp). Both sides of the HDarm contain a 20 bp overhang region of the Bgl II site from the pFST plasmid. b Disruption of the porB gene mediated by the CRISPR/Cas9 system in C. glutamicum ATCC 13032 with a 600 bp HDarm. The editing efficiency was 10/12, the lane ‘ck’ is the PCR product from the wild-type strain. c Disruption of the porB gene mediated by the CRISPR/Cas9 system in C. glutamicum ATCC 13032 with a 300 bp HDarm. The editing efficiency was 10/12. d Disruption of the porB gene mediated by the CRISPR/Cas9 system in C. glutamicum ATCC 13032 with a 100 bp HDarm. The editing efficiency was 2/12

    Techniques Used: Plasmid Preparation, CRISPR, Polymerase Chain Reaction

    29) Product Images from "An engineered opsin monomer scrambles phospholipids"

    Article Title: An engineered opsin monomer scrambles phospholipids

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-16842-z

    Single molecule fluorescence measurements reveal that purified WT and Quad opsins are monomers. ( A ) Schematic illustration of the single molecule pulldown (SiMPull) set up. ( B ) Representative TIRF image of SNAP-surface 549-labeled WT opsin-FLAG-SNAP; the circled spot corresponds to the photobleaching trace in panel D. ( C ) Representative TIRF image of SNAP-surface 549-labeled QUAD opsin-FLAG-SNAP; the circled spot corresponds to the photobleaching trace in panel E. ( D ) Trace depicting 1-step photobleaching of the circled spot from panel B when exposed to a 561-nm laser beam at time 0 s. The arrow depicts the point at which photobleaching occurred. ( E ) Trace depicting 1-step photobleaching of the circled spot from panel C when exposed to a 561-nm laser beam at time 0 s. The arrow depicts the point at which photobleaching occurred. ( F ) Fraction of the total population of spots that show 1-, 2-, 3-, or 4-step photobleaching (1102 and 1083 spots were analyzed for WT and QUAD opsin constructs, respectively). Error bars indicate standard errors calculated from 5 movies for each condition (169–257 spots were analyzed per movie).
    Figure Legend Snippet: Single molecule fluorescence measurements reveal that purified WT and Quad opsins are monomers. ( A ) Schematic illustration of the single molecule pulldown (SiMPull) set up. ( B ) Representative TIRF image of SNAP-surface 549-labeled WT opsin-FLAG-SNAP; the circled spot corresponds to the photobleaching trace in panel D. ( C ) Representative TIRF image of SNAP-surface 549-labeled QUAD opsin-FLAG-SNAP; the circled spot corresponds to the photobleaching trace in panel E. ( D ) Trace depicting 1-step photobleaching of the circled spot from panel B when exposed to a 561-nm laser beam at time 0 s. The arrow depicts the point at which photobleaching occurred. ( E ) Trace depicting 1-step photobleaching of the circled spot from panel C when exposed to a 561-nm laser beam at time 0 s. The arrow depicts the point at which photobleaching occurred. ( F ) Fraction of the total population of spots that show 1-, 2-, 3-, or 4-step photobleaching (1102 and 1083 spots were analyzed for WT and QUAD opsin constructs, respectively). Error bars indicate standard errors calculated from 5 movies for each condition (169–257 spots were analyzed per movie).

    Techniques Used: Fluorescence, Purification, Labeling, Construct

    30) Product Images from "Identification of a novel protein complex essential for effector translocation across the parasitophorous vacuole membrane of Toxoplasma gondii"

    Article Title: Identification of a novel protein complex essential for effector translocation across the parasitophorous vacuole membrane of Toxoplasma gondii

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1006828

    MYR2 ( TGGT1_270700 ) is essential for effector translocation. (A) Schematic of TGGT1_270700 ( MYR2 ) disruption. To disrupt the MYR2 locus, a CRISPR-Cas9 plasmid encoding a sgRNA against TGGT1_270700 was co-transfected with linearized pGRA1-HA-HPT plasmid into RH Δhpt parasites. Arrows indicate location of primers used to confirm integration of vector in the gene locus (and consequent disruption of the gene ORF) by PCR. ( B) Disruptive integration of the HXGPRT vector in an exon of MYR2 was confirmed by PCR and sequencing. ( C) Effect of MYR2 disruption and complementation on effector translocation. Wild-type (WT) and RH Δmyr2 tachyzoites were transiently transfected with a plasmid expressing Myc-tagged GRA24. For complementation, the Δmyr2 strain was co-transfected with GRA24-Myc and pGRA1:MYR2-3xHA plasmids. Transfected tachyzoites were allowed to infect HFFs for 16–24 hours. The infected monolayers were then fixed and GRA24 and MYR2 localization was assessed with anti-myc tag and anti-HA antibodies, respectively. Scale bar indicates 5 μm. White arrow indicates host nucleus lacking detectable GRA24 in the cell infected with RH Δmyr2 tachyzoites. (D) Quantitation of percentage of infected cells showing GRA24 localization in the host nucleus based on three independent experiments, each with analysis of 10 fields on at least three coverslips. Statistics were performed with one-way ANOVA and Tukey’s multiple comparison’s test. **** indicates P
    Figure Legend Snippet: MYR2 ( TGGT1_270700 ) is essential for effector translocation. (A) Schematic of TGGT1_270700 ( MYR2 ) disruption. To disrupt the MYR2 locus, a CRISPR-Cas9 plasmid encoding a sgRNA against TGGT1_270700 was co-transfected with linearized pGRA1-HA-HPT plasmid into RH Δhpt parasites. Arrows indicate location of primers used to confirm integration of vector in the gene locus (and consequent disruption of the gene ORF) by PCR. ( B) Disruptive integration of the HXGPRT vector in an exon of MYR2 was confirmed by PCR and sequencing. ( C) Effect of MYR2 disruption and complementation on effector translocation. Wild-type (WT) and RH Δmyr2 tachyzoites were transiently transfected with a plasmid expressing Myc-tagged GRA24. For complementation, the Δmyr2 strain was co-transfected with GRA24-Myc and pGRA1:MYR2-3xHA plasmids. Transfected tachyzoites were allowed to infect HFFs for 16–24 hours. The infected monolayers were then fixed and GRA24 and MYR2 localization was assessed with anti-myc tag and anti-HA antibodies, respectively. Scale bar indicates 5 μm. White arrow indicates host nucleus lacking detectable GRA24 in the cell infected with RH Δmyr2 tachyzoites. (D) Quantitation of percentage of infected cells showing GRA24 localization in the host nucleus based on three independent experiments, each with analysis of 10 fields on at least three coverslips. Statistics were performed with one-way ANOVA and Tukey’s multiple comparison’s test. **** indicates P

    Techniques Used: Translocation Assay, CRISPR, Plasmid Preparation, Transfection, Polymerase Chain Reaction, Sequencing, Expressing, Infection, Quantitation Assay

    31) Product Images from "Paradoxical Sensitivity to an Integrated Stress Response Blocking Mutation in Vanishing White Matter Cells"

    Article Title: Paradoxical Sensitivity to an Integrated Stress Response Blocking Mutation in Vanishing White Matter Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0166278

    Severe VWM mutant cells are unable to tolerate a second EIF2S1 S51A mutation. (A) Experimental design for tracking EIF2S1 S51A mutant cells. A fluorescent-tagged sgRNA/Cas9 plasmid targeting EIF2S1 was co-transfected alongside wild type (WT) or EIF2S1 S51A (Mut) templates into CHO-S21 dual reporter cells. Following FACS selection for the transfected cells they were treated with 250 nM thapsigargin (Tg) for 24 hours and reporter expression was analyzed. (B) Flow cytometry analysis of reporter activity in untreated (UT) and thapsigargin-treated (Tg) CHO-S21 cells from the experiment outlined in “A”. Note the emergence of CHOP :: GFP negative, XBP1 :: turquoise positive thapsigargin-treated cells in the pool offered an EIF2S1 S51A repair template. (C) Flow cytometry analysis of reporter activity in untreated (UT) and thapsigargin-treated (Tg) parental CHO-S21 or indicated VWM mutant cells following targeting of the EIF2S1 locus with an EIF2S1 S51A repair template (as described in “A”). Note the lack of CHOP :: GFP negative, XBP1 :: turquoise positive thapsigargin-treated putative EIF2S1 S51A ; EIF2B4 A392D or EIF2S1 S51A ; EIF2B4 R484W double mutant cells (lower right panel). (D) Percentage of CHOP :: GFP negative, XBP1 :: turquoise positive thapsigargin-treated putative EIF2S1 S51A mutant cells in the indicated population from experiments as in “C”. Shown are means ± S.D. N = 6 (Parent), 5 ( EIF2B4 A392D ), and 3 ( EIF2B4 R484W and EIF2B4 R468W ). *** P
    Figure Legend Snippet: Severe VWM mutant cells are unable to tolerate a second EIF2S1 S51A mutation. (A) Experimental design for tracking EIF2S1 S51A mutant cells. A fluorescent-tagged sgRNA/Cas9 plasmid targeting EIF2S1 was co-transfected alongside wild type (WT) or EIF2S1 S51A (Mut) templates into CHO-S21 dual reporter cells. Following FACS selection for the transfected cells they were treated with 250 nM thapsigargin (Tg) for 24 hours and reporter expression was analyzed. (B) Flow cytometry analysis of reporter activity in untreated (UT) and thapsigargin-treated (Tg) CHO-S21 cells from the experiment outlined in “A”. Note the emergence of CHOP :: GFP negative, XBP1 :: turquoise positive thapsigargin-treated cells in the pool offered an EIF2S1 S51A repair template. (C) Flow cytometry analysis of reporter activity in untreated (UT) and thapsigargin-treated (Tg) parental CHO-S21 or indicated VWM mutant cells following targeting of the EIF2S1 locus with an EIF2S1 S51A repair template (as described in “A”). Note the lack of CHOP :: GFP negative, XBP1 :: turquoise positive thapsigargin-treated putative EIF2S1 S51A ; EIF2B4 A392D or EIF2S1 S51A ; EIF2B4 R484W double mutant cells (lower right panel). (D) Percentage of CHOP :: GFP negative, XBP1 :: turquoise positive thapsigargin-treated putative EIF2S1 S51A mutant cells in the indicated population from experiments as in “C”. Shown are means ± S.D. N = 6 (Parent), 5 ( EIF2B4 A392D ), and 3 ( EIF2B4 R484W and EIF2B4 R468W ). *** P

    Techniques Used: Mutagenesis, Plasmid Preparation, Transfection, FACS, Selection, Expressing, Flow Cytometry, Cytometry, Activity Assay

    32) Product Images from "CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3"

    Article Title: CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3

    Journal: EvoDevo

    doi: 10.1186/s13227-017-0073-y

    CRISPR-based gene replacement of robo3. a Schematic of the robo3 gene showing intron/exon structure and location of gRNA target sites, robo3 TcRobo2/3 homologous donor plasmid, and the final modified robo3 TcRobo2/3 allele. Endogenous robo3 coding exons are shown as purple boxes ; 5′ and 3′ untranslated regions are shown as light gray boxes . The start of transcription is indicated by the bent arrow . Introns and exons are shown to scale, with the exception of the first intron, from which approximately 13 kb has been omitted. Red arrows indicate the location of upstream (gRNA 1) and downstream (gRNA 2) gRNA target sites. Gray brackets demarcate the region to be replaced by sequences from the donor plasmid. Arrows indicate the position and orientation of PCR primers. b Partial DNA sequences of the unmodified robo3 gene and the modified robo3 TcRobo2/3 allele. Black letters indicated endogenous DNA sequence; red letters indicate exogenous sequence. Both DNA strands are illustrated. The gRNA protospacer and PAM sequences are indicated for both gRNAs. The first five base pairs of robo3 exon 2 are unaltered in the robo3 TcRobo2/3 allele, and the robo3 coding sequence beginning with codon H21 is replaced by the HA-tagged TcRobo2/3 cDNA. The endogenous robo3 transcription start site, ATG start codon, and signal peptide are retained in exon 1. The PAM sequences and portions of both protospacers are deleted in the modified allele, ensuring that the robo3 TcRobo2/3 donor plasmid and modified robo3 TcRobo2/3 allele are not targeted by Cas9. UTR untranslated regions, 5 ′ H 5′ homology region, 3′H 3′ homology region, HA hemagglutinin epitope tag, gRNA guide RNA, HDR homology-directed repair, PAM protospacer adjacent motif
    Figure Legend Snippet: CRISPR-based gene replacement of robo3. a Schematic of the robo3 gene showing intron/exon structure and location of gRNA target sites, robo3 TcRobo2/3 homologous donor plasmid, and the final modified robo3 TcRobo2/3 allele. Endogenous robo3 coding exons are shown as purple boxes ; 5′ and 3′ untranslated regions are shown as light gray boxes . The start of transcription is indicated by the bent arrow . Introns and exons are shown to scale, with the exception of the first intron, from which approximately 13 kb has been omitted. Red arrows indicate the location of upstream (gRNA 1) and downstream (gRNA 2) gRNA target sites. Gray brackets demarcate the region to be replaced by sequences from the donor plasmid. Arrows indicate the position and orientation of PCR primers. b Partial DNA sequences of the unmodified robo3 gene and the modified robo3 TcRobo2/3 allele. Black letters indicated endogenous DNA sequence; red letters indicate exogenous sequence. Both DNA strands are illustrated. The gRNA protospacer and PAM sequences are indicated for both gRNAs. The first five base pairs of robo3 exon 2 are unaltered in the robo3 TcRobo2/3 allele, and the robo3 coding sequence beginning with codon H21 is replaced by the HA-tagged TcRobo2/3 cDNA. The endogenous robo3 transcription start site, ATG start codon, and signal peptide are retained in exon 1. The PAM sequences and portions of both protospacers are deleted in the modified allele, ensuring that the robo3 TcRobo2/3 donor plasmid and modified robo3 TcRobo2/3 allele are not targeted by Cas9. UTR untranslated regions, 5 ′ H 5′ homology region, 3′H 3′ homology region, HA hemagglutinin epitope tag, gRNA guide RNA, HDR homology-directed repair, PAM protospacer adjacent motif

    Techniques Used: CRISPR, Plasmid Preparation, Modification, Polymerase Chain Reaction, Sequencing

    Tribolium Robo2/3 can substitute for Drosophila Robo3 to promote axon pathway formation in Drosophila embryos. a – d Stage 16 Drosophila embryos stained with anti-HRP ( magenta ) and anti-FasII ( green ) antibodies. Lower images show anti-FasII channel alone from the same embryos. In wild-type embryos, FasII-positive axons form three distinct longitudinal pathways on either side of the midline, one each in the medial, intermediate, and lateral zones of the neuropile. The intermediate FasII pathway is distinct from the medial and lateral pathways in every hemisegment in wild-type embryos ( a , arrow ). In robo3 1 embryos, FasII-positive axons that normally form the intermediate pathway are displaced medially, and the intermediate pathway fails to form ( b , arrow with asterisk ). Intermediate pathways form correctly in embryos in which the robo3 gene is replaced with a robo3 cDNA ( c , arrow ). When robo3 is replaced with a TcRobo2/3 cDNA, intermediate pathways form correctly in over 88% of hemisegments ( d , arrow ), indicating that TcRobo2/3 can substitute for robo3 to promote axon pathway formation in the intermediate region of the neuropile. Bar graph shows quantification of intermediate FasII pathway defects in the genotypes shown in a – d . Error bars indicate standard error of the mean. Number of embryos scored for each genotype is indicated in parentheses . e – h Embryos carrying the sema2b - TauMyc transgene and stained with anti-HRP ( blue ), anti-FasII ( red ), and anti-Myc ( green ) antibodies. The sema2b - TauMyc transgene labels the cell bodies and axons of 2–3 neurons per hemisegment in abdominal segments A4–A8. These axons normally project across the midline and then extend anteriorly in the intermediate region of the neuropile ( e , arrowhead ). In robo3 1 embryos, these axons are displaced medially ( f , arrowhead with asterisk ), but their normal intermediate position is restored in both robo3 robo3 ( g , arrowhead ) and robo3 TcRobo2/3 embryos ( h , arrowhead )
    Figure Legend Snippet: Tribolium Robo2/3 can substitute for Drosophila Robo3 to promote axon pathway formation in Drosophila embryos. a – d Stage 16 Drosophila embryos stained with anti-HRP ( magenta ) and anti-FasII ( green ) antibodies. Lower images show anti-FasII channel alone from the same embryos. In wild-type embryos, FasII-positive axons form three distinct longitudinal pathways on either side of the midline, one each in the medial, intermediate, and lateral zones of the neuropile. The intermediate FasII pathway is distinct from the medial and lateral pathways in every hemisegment in wild-type embryos ( a , arrow ). In robo3 1 embryos, FasII-positive axons that normally form the intermediate pathway are displaced medially, and the intermediate pathway fails to form ( b , arrow with asterisk ). Intermediate pathways form correctly in embryos in which the robo3 gene is replaced with a robo3 cDNA ( c , arrow ). When robo3 is replaced with a TcRobo2/3 cDNA, intermediate pathways form correctly in over 88% of hemisegments ( d , arrow ), indicating that TcRobo2/3 can substitute for robo3 to promote axon pathway formation in the intermediate region of the neuropile. Bar graph shows quantification of intermediate FasII pathway defects in the genotypes shown in a – d . Error bars indicate standard error of the mean. Number of embryos scored for each genotype is indicated in parentheses . e – h Embryos carrying the sema2b - TauMyc transgene and stained with anti-HRP ( blue ), anti-FasII ( red ), and anti-Myc ( green ) antibodies. The sema2b - TauMyc transgene labels the cell bodies and axons of 2–3 neurons per hemisegment in abdominal segments A4–A8. These axons normally project across the midline and then extend anteriorly in the intermediate region of the neuropile ( e , arrowhead ). In robo3 1 embryos, these axons are displaced medially ( f , arrowhead with asterisk ), but their normal intermediate position is restored in both robo3 robo3 ( g , arrowhead ) and robo3 TcRobo2/3 embryos ( h , arrowhead )

    Techniques Used: Staining

    TcRobo2/3 expression reproduces Robo3’s expression pattern in the robo3 TcRobo2/3 allele. a – d Stage 16 Drosophila embryos stained with anti-HRP ( magenta ; labels all axons) and anti-Robo3 ( green ) antibodies. Lower images show anti-Robo3 channel alone from the same embryos. In wild-type embryos, endogenous Robo3 protein is detectable on longitudinal axons within the outer two-thirds of the neuropile ( a , arrowhead ). Robo3 protein is undetectable in embryos homozygous for the loss of function robo3 1 allele ( b , arrowhead with asterisk ) [ 7 , 8 ]. There are no large-scale defects detectable with anti-HRP in the axon scaffold of robo3 1 mutants. In embryos in which the robo3 gene has been replaced with an HA-tagged robo3 cDNA, Robo3 protein expressed from the modified locus reproduces its normal expression pattern ( c , arrowhead ) [ 8 ]. In our CRISPR-modified embryos in which robo3 has been replaced by TcRobo2/3 , Robo3 protein is undetectable, consistent with the removal of robo3 coding sequences ( d , arrowhead with asterisk ). e , f Stage 16 embryos stained with anti-HRP ( magenta ) and anti-HA ( green ) antibodies. Lower images show anti-HA channel alone from the same embryos. Anti-HA staining in robo3 robo3 embryos detects the Robo3 protein expressed from the modified locus and reproduces the staining pattern seen with anti-Robo3 ( e , arrowhead ). In robo3 TcRobo2/3 embryos, the HA-tagged TcRobo2/3 protein reproduces Robo3’s expression pattern and is detectable on longitudinal axons within the lateral two-thirds of the neuropile ( f , arrowhead ). Schematics of the two modified robo3 alleles are shown at lower left . The robo3 robo3 allele was generated by Spitzweck et al. [ 8 ]
    Figure Legend Snippet: TcRobo2/3 expression reproduces Robo3’s expression pattern in the robo3 TcRobo2/3 allele. a – d Stage 16 Drosophila embryos stained with anti-HRP ( magenta ; labels all axons) and anti-Robo3 ( green ) antibodies. Lower images show anti-Robo3 channel alone from the same embryos. In wild-type embryos, endogenous Robo3 protein is detectable on longitudinal axons within the outer two-thirds of the neuropile ( a , arrowhead ). Robo3 protein is undetectable in embryos homozygous for the loss of function robo3 1 allele ( b , arrowhead with asterisk ) [ 7 , 8 ]. There are no large-scale defects detectable with anti-HRP in the axon scaffold of robo3 1 mutants. In embryos in which the robo3 gene has been replaced with an HA-tagged robo3 cDNA, Robo3 protein expressed from the modified locus reproduces its normal expression pattern ( c , arrowhead ) [ 8 ]. In our CRISPR-modified embryos in which robo3 has been replaced by TcRobo2/3 , Robo3 protein is undetectable, consistent with the removal of robo3 coding sequences ( d , arrowhead with asterisk ). e , f Stage 16 embryos stained with anti-HRP ( magenta ) and anti-HA ( green ) antibodies. Lower images show anti-HA channel alone from the same embryos. Anti-HA staining in robo3 robo3 embryos detects the Robo3 protein expressed from the modified locus and reproduces the staining pattern seen with anti-Robo3 ( e , arrowhead ). In robo3 TcRobo2/3 embryos, the HA-tagged TcRobo2/3 protein reproduces Robo3’s expression pattern and is detectable on longitudinal axons within the lateral two-thirds of the neuropile ( f , arrowhead ). Schematics of the two modified robo3 alleles are shown at lower left . The robo3 robo3 allele was generated by Spitzweck et al. [ 8 ]

    Techniques Used: Expressing, Staining, Modification, CRISPR, Generated

    Sequence comparison of Drosophila Robo3 and Tribolium Robo2/3. a Schematic comparison of the two receptors showing conserved domain structure and percent identity between individual ectodomain elements. The highest degree of sequence conservation occurs within the Slit-binding Ig1 domain (70% identity). While both proteins share the evolutionarily conserved CC0 and CC1 motifs, the TcRobo2/3 cytodomain (206 aa) is less than half the length of the Robo3 cytodomain (452 aa). b Protein sequence alignment. Structural features are indicated below the sequence. Fn domains have been re-annotated relative to Evans and Bashaw [ 11 ] based on revised predictions of beta strand locations. Identical residues are shaded black ; similar residues are shaded gray . Ig immunoglobulin-like domain, Fn fibronectin type III repeat, Tm transmembrane helix, CC conserved cytoplasmic motif
    Figure Legend Snippet: Sequence comparison of Drosophila Robo3 and Tribolium Robo2/3. a Schematic comparison of the two receptors showing conserved domain structure and percent identity between individual ectodomain elements. The highest degree of sequence conservation occurs within the Slit-binding Ig1 domain (70% identity). While both proteins share the evolutionarily conserved CC0 and CC1 motifs, the TcRobo2/3 cytodomain (206 aa) is less than half the length of the Robo3 cytodomain (452 aa). b Protein sequence alignment. Structural features are indicated below the sequence. Fn domains have been re-annotated relative to Evans and Bashaw [ 11 ] based on revised predictions of beta strand locations. Identical residues are shaded black ; similar residues are shaded gray . Ig immunoglobulin-like domain, Fn fibronectin type III repeat, Tm transmembrane helix, CC conserved cytoplasmic motif

    Techniques Used: Sequencing, Binding Assay

    33) Product Images from "A structural variant in the 5’-flanking region of the TWIST2 gene affects melanocyte development in belted cattle"

    Article Title: A structural variant in the 5’-flanking region of the TWIST2 gene affects melanocyte development in belted cattle

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0180170

    Reduction of melanocytes in zebrafish embryos expressing bovine TWIST2 at 35 hpf. (A) Representative images of zebrafish embryos injected with either a control construct (pmitfa_EGFP) or a construct driving the expression of bovine TWIST2 under control of the zebrafish mitfa promoter (pmitfa_btaTWIST2_EGFP). Melanocyte counts for head and trunk are given in brackets. Scale bars correspond to 1 mm. (B) Melanocytes in the head and trunk were counted in three experiments (controls: n = 14, 16, 19; TWIST2: n = 17, 16, 19). (C) The experiments were repeated with another set of constructs that additionally had CFP as a reporter for transgenesis. In transgenic animals, cerulean fluorescence in the eyes becomes visible at ~4–5 dpf. (D) Melanocyte counts in two replicate experiments at 35 hpf from zebrafish injected with the constructs pmitfa_EGFP_cryst_CFP and pmitfa_TWIST2_EGFP_cryst_CFP. If (B) and (D) are taken together the TWIST2 overexpressing embryos had significantly fewer melanocytes in the head in 4 out of 5 experiments and in the trunk in 3 out of 5 experiments.
    Figure Legend Snippet: Reduction of melanocytes in zebrafish embryos expressing bovine TWIST2 at 35 hpf. (A) Representative images of zebrafish embryos injected with either a control construct (pmitfa_EGFP) or a construct driving the expression of bovine TWIST2 under control of the zebrafish mitfa promoter (pmitfa_btaTWIST2_EGFP). Melanocyte counts for head and trunk are given in brackets. Scale bars correspond to 1 mm. (B) Melanocytes in the head and trunk were counted in three experiments (controls: n = 14, 16, 19; TWIST2: n = 17, 16, 19). (C) The experiments were repeated with another set of constructs that additionally had CFP as a reporter for transgenesis. In transgenic animals, cerulean fluorescence in the eyes becomes visible at ~4–5 dpf. (D) Melanocyte counts in two replicate experiments at 35 hpf from zebrafish injected with the constructs pmitfa_EGFP_cryst_CFP and pmitfa_TWIST2_EGFP_cryst_CFP. If (B) and (D) are taken together the TWIST2 overexpressing embryos had significantly fewer melanocytes in the head in 4 out of 5 experiments and in the trunk in 3 out of 5 experiments.

    Techniques Used: Expressing, Injection, Construct, Transgenic Assay, Fluorescence

    Genomic context of the belt locus. (A) Haplotype analysis defined a critical interval of 37 kb indicated by blue shading for the belt causative variant (Chr3:118,578,893–118,616,348, UMD3.1 assembly, S1 Table ). The belt locus mapped to a gene poor region containing TWIST2 as the only known gene (NCBI annotation release 105; protein coding genes are shown in black, predicted non-coding RNA genes in grey). (B) A 6 kb CNV is located within the critical interval and approximately 16 kb upstream of the transcription start site of TWIST2 . The CNV is flanked by two highly homologous LINE sequences that share 94% sequence identitiy over 650 bp. (C) Experimental identification of the CNV. IGV screenshots of the illumina short read sequences illustrate a ~4-fold increased coverage in a homozygous belted ( bt/bt ) cattle with respect to a control animal ( wt/wt ) and several read-pairs with incorrect read-pair orientation at the boundaries of the CNV (indicated in green). (D) The CNV is largely composed of interspersed repeats. However, it has a short single copy region, which is highly conserved in mammals. (E) Inverse PCR strategy to confirm the presence of tandemly repeated copies. (F) Agarose gel showing the expected 4845 bp amplicon that is diagnostic for the amplified CNV in belted animals. (G) Allele-specific quantification of TWIST2 mRNA expression in adult skin. RNA-seq data were analyzed from non-belted ( wt/wt ) and heterozygous belted ( bt/wt ) animals. All animals were heterozygous for an A/G SNV in the 3’-UTR of TWIST2 . In wt/wt animals the two TWIST2 alleles were expressed at equal amounts. In bt/wt animals, the G-allele transcribed from the bt haplotype was reduced by 35% compared to the A-allele (p = 0.046, two-sided t-test).
    Figure Legend Snippet: Genomic context of the belt locus. (A) Haplotype analysis defined a critical interval of 37 kb indicated by blue shading for the belt causative variant (Chr3:118,578,893–118,616,348, UMD3.1 assembly, S1 Table ). The belt locus mapped to a gene poor region containing TWIST2 as the only known gene (NCBI annotation release 105; protein coding genes are shown in black, predicted non-coding RNA genes in grey). (B) A 6 kb CNV is located within the critical interval and approximately 16 kb upstream of the transcription start site of TWIST2 . The CNV is flanked by two highly homologous LINE sequences that share 94% sequence identitiy over 650 bp. (C) Experimental identification of the CNV. IGV screenshots of the illumina short read sequences illustrate a ~4-fold increased coverage in a homozygous belted ( bt/bt ) cattle with respect to a control animal ( wt/wt ) and several read-pairs with incorrect read-pair orientation at the boundaries of the CNV (indicated in green). (D) The CNV is largely composed of interspersed repeats. However, it has a short single copy region, which is highly conserved in mammals. (E) Inverse PCR strategy to confirm the presence of tandemly repeated copies. (F) Agarose gel showing the expected 4845 bp amplicon that is diagnostic for the amplified CNV in belted animals. (G) Allele-specific quantification of TWIST2 mRNA expression in adult skin. RNA-seq data were analyzed from non-belted ( wt/wt ) and heterozygous belted ( bt/wt ) animals. All animals were heterozygous for an A/G SNV in the 3’-UTR of TWIST2 . In wt/wt animals the two TWIST2 alleles were expressed at equal amounts. In bt/wt animals, the G-allele transcribed from the bt haplotype was reduced by 35% compared to the A-allele (p = 0.046, two-sided t-test).

    Techniques Used: Variant Assay, Sequencing, Inverse PCR, Agarose Gel Electrophoresis, Amplification, Diagnostic Assay, Expressing, RNA Sequencing Assay

    34) Product Images from "Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2"

    Article Title: Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00060-2

    Comparison of characteristics of CRY2-based clustering modules. a Fluorescence images of cells expressing each of the indicated constructs following exposure to blue light for 1 s. Right , kymographs corresponding to yellow lines in left images. Yellow arrows indicate illumination time points. b Size distribution of clusters in the nucleus ( top ) and in the cytoplasm ( bottom ) in cells expressing either CRY2olig or CRY2clust. c Graph showing time to reach half-maximal and basal cluster ratio ( T 1/2 ) for assembly and disassembly, respectively ( n = 29, 35, 34 cells). d Fluorescence images of R-GECO1 in cells coexpressing either OptoSTIM1 or OptoSTIM1 (CRY2clust). Right , kymographs corresponding to yellow lines in left images. e Graph showing time to reach half-maximal R-GECO1 fluorescence after light illumination in cells expressing the indicated construct ( n = 62, 75 cells). ** P = 3.65 × 10 –10 by Student’s two-tailed t -test. f The normalized nuclear/cytoplasmic ERK2-EGFP ratio upon light illumination on cells expressing the indicated optogenetic Raf1 module ( n = 32, 48 cells). Values are expressed as means ± s.e.m. Scale bars, 20 μm
    Figure Legend Snippet: Comparison of characteristics of CRY2-based clustering modules. a Fluorescence images of cells expressing each of the indicated constructs following exposure to blue light for 1 s. Right , kymographs corresponding to yellow lines in left images. Yellow arrows indicate illumination time points. b Size distribution of clusters in the nucleus ( top ) and in the cytoplasm ( bottom ) in cells expressing either CRY2olig or CRY2clust. c Graph showing time to reach half-maximal and basal cluster ratio ( T 1/2 ) for assembly and disassembly, respectively ( n = 29, 35, 34 cells). d Fluorescence images of R-GECO1 in cells coexpressing either OptoSTIM1 or OptoSTIM1 (CRY2clust). Right , kymographs corresponding to yellow lines in left images. e Graph showing time to reach half-maximal R-GECO1 fluorescence after light illumination in cells expressing the indicated construct ( n = 62, 75 cells). ** P = 3.65 × 10 –10 by Student’s two-tailed t -test. f The normalized nuclear/cytoplasmic ERK2-EGFP ratio upon light illumination on cells expressing the indicated optogenetic Raf1 module ( n = 32, 48 cells). Values are expressed as means ± s.e.m. Scale bars, 20 μm

    Techniques Used: Fluorescence, Expressing, Construct, Two Tailed Test

    35) Product Images from "A quantitative model for the rate-limiting process of UGA alternative assignments to stop and selenocysteine codons"

    Article Title: A quantitative model for the rate-limiting process of UGA alternative assignments to stop and selenocysteine codons

    Journal: PLoS Computational Biology

    doi: 10.1371/journal.pcbi.1005367

    Experimental and predicted Sec incorporation efficiencies in four SECIS constructs. (a) The relationship between protein synthesis and abundance for P T under 40 nM selenium concentration in the experimental data of four SECIS constructs: GPX1 (red), SEPHS2 (blue), SEPX1 (brown), and SELK (green). A solid circle indicates the mean GFP value for each RFP value. (b) The relationship between protein synthesis and abundance for P T under 40 nM selenium concentration according to the models inferred from experimental data.
    Figure Legend Snippet: Experimental and predicted Sec incorporation efficiencies in four SECIS constructs. (a) The relationship between protein synthesis and abundance for P T under 40 nM selenium concentration in the experimental data of four SECIS constructs: GPX1 (red), SEPHS2 (blue), SEPX1 (brown), and SELK (green). A solid circle indicates the mean GFP value for each RFP value. (b) The relationship between protein synthesis and abundance for P T under 40 nM selenium concentration according to the models inferred from experimental data.

    Techniques Used: Size-exclusion Chromatography, Construct, Concentration Assay

    The effect of selenium supply and SEPHS2 synthesis level on UGA definition. (a) The relationship between protein synthesis and abundance for P T analyzed under various selenium concentrations. Both original and processed experimental results are presented in the graph and are represented by “original” and “mean”, respectively. The processed results present the mean abundance at each synthesis level. Since the half-life of P S is not affected by selenium supply, only P S analyzed at 40 nM selenium concentration is shown. (b) GPS assay of P T under various selenium concentrations. (c) GPS assay of P T under 40 nM selenium and various synthesis levels. Relative synthesis levels were estimated from the GPS assay. (d) The ratios of P L and P S abundance were quantified by Western blotting. Relative mRNA levels were estimated from the GPS assay.
    Figure Legend Snippet: The effect of selenium supply and SEPHS2 synthesis level on UGA definition. (a) The relationship between protein synthesis and abundance for P T analyzed under various selenium concentrations. Both original and processed experimental results are presented in the graph and are represented by “original” and “mean”, respectively. The processed results present the mean abundance at each synthesis level. Since the half-life of P S is not affected by selenium supply, only P S analyzed at 40 nM selenium concentration is shown. (b) GPS assay of P T under various selenium concentrations. (c) GPS assay of P T under 40 nM selenium and various synthesis levels. Relative synthesis levels were estimated from the GPS assay. (d) The ratios of P L and P S abundance were quantified by Western blotting. Relative mRNA levels were estimated from the GPS assay.

    Techniques Used: Concentration Assay, Western Blot

    Protein half-life analysis of full-length and truncated SEPHS2. (a) Distributions of protein stability measurements of P L or P S by the GPS assay. P L and P S were expressed from SEPHS2 mutant transcripts that exclusively express one form of SEPHS2. % of Max indicates normalized cell counts such that the peak value of each distribution is 100%. (b) The relationship between protein synthesis and abundance for P L and P S . Each dot represents a single cell carrying the indicated GPS reporter with a corresponding protein synthesis (RFP) and protein abundance (GFP). The GFP/RFP ratio, or the slope of the protein synthesis-abundance plot passing through the origin, reflects the protein half-life. A hypothetical line for P T , the total amount of proteins of both forms, is shown. (c-d) GPS analysis of P L and P S under various selenium concentrations (c) or synthesis levels (d). Relative mRNA levels are quantifications of the RFP signals in the GPS assay.
    Figure Legend Snippet: Protein half-life analysis of full-length and truncated SEPHS2. (a) Distributions of protein stability measurements of P L or P S by the GPS assay. P L and P S were expressed from SEPHS2 mutant transcripts that exclusively express one form of SEPHS2. % of Max indicates normalized cell counts such that the peak value of each distribution is 100%. (b) The relationship between protein synthesis and abundance for P L and P S . Each dot represents a single cell carrying the indicated GPS reporter with a corresponding protein synthesis (RFP) and protein abundance (GFP). The GFP/RFP ratio, or the slope of the protein synthesis-abundance plot passing through the origin, reflects the protein half-life. A hypothetical line for P T , the total amount of proteins of both forms, is shown. (c-d) GPS analysis of P L and P S under various selenium concentrations (c) or synthesis levels (d). Relative mRNA levels are quantifications of the RFP signals in the GPS assay.

    Techniques Used: Mutagenesis

    Comparison of experimental and predicted Sec incorporation efficiencies in SEPHS2. (a) The relationship between protein synthesis and abundance for P T analyzed under various selenium concentrations. Dots denote mean GFP values for each RFP value in the experimental data and are the same as Fig 3A . Solid circles denote the same quantities from model fitting. (b) The relationship between the full length protein quantities and mRNA levels under various selenium concentrations from model prediction.
    Figure Legend Snippet: Comparison of experimental and predicted Sec incorporation efficiencies in SEPHS2. (a) The relationship between protein synthesis and abundance for P T analyzed under various selenium concentrations. Dots denote mean GFP values for each RFP value in the experimental data and are the same as Fig 3A . Solid circles denote the same quantities from model fitting. (b) The relationship between the full length protein quantities and mRNA levels under various selenium concentrations from model prediction.

    Techniques Used: Size-exclusion Chromatography

    36) Product Images from "The aromatic amino acid hydroxylase genes AAH1 and AAH2 in Toxoplasma gondii contribute to transmission in the cat"

    Article Title: The aromatic amino acid hydroxylase genes AAH1 and AAH2 in Toxoplasma gondii contribute to transmission in the cat

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1006272

    Disruption of the AAH1 and AAH2 genes. (A) Schematic of the AAH2 knockout strategy in the wild-type ME49 Δhxg :: Luc strain (referred to as WT). A CRISPR-Cas9 construct with guide RNAs targeted to the 5’ and 3’ UTRs of AAH2 was co-transfected with the pΔaah2 :: HXG plasmid ( S2 Table ) and selected for with MPA +Xanthine to delete AAH2 to produce the clone Δaah2 :: HXG ( Δh2-HXG ). Subsequently, the HXG gene was replaced with either a clean fusion of the AAH2 5’ and 3’ UTRs ( pΔaah2 ) or an AAH2 cDNA construct ( pAAH2 ). ( S2 Table ) using 6-thioxanthine selection against the HXG locus to create the clean knockout clone Δaah2 ( Δh2 ) (upper panel) and the complement clone Δaah2 :: AAH2 ( Δh2-H2 ) (lower panel). Yellow Bars: CRISPR targeting sites. Black bars: PCR screening primer target regions ( S3 Table ). (B) Schematic of the knockout strategy for AAH1 . A CRISPR-Cas9 construct with guide RNAs targeted to the 5’ and 3’ UTRs of AAH1 was co-transfected with the pΔaah1 :: DHFR-Ts repair construct ( S2 Table ) into WT or Δaah2 parasites to create the clones Δaah1 ( Δh1 ) and Δaah1Δaah2 ( Δh1Δh2 ). Transfectants were selected for via pyrimethamine resistance. Subsequently, using pΔuprt :: AAH1 :: HXG , a cDNA copy of AAH1 driven by its native 5’ and 3’ UTRs was complemented into the UPRT locus by means of the HXGPRT drug resistance marker selected for with MPA +Xanthine, negative selection against UPRT with FUDR, and a single-cutting CRISPR-Cas9 construct targeted to the UPRT gene ( S2 Table ), creating the complement clones Δaah1-AAH1 ( Δh1-H1 ) and Δaah1Δaah2-AAH1 ( Δh1Δh2-H1 ). Brown Yellow Bars: CRISPR targeting sites. Black bars: PCR screening primer target regions ( S3 Table ). (C) PCR verification of successful ablation and complementation of knockouts. Expected product sizes: Tubulin (Tub): 0.378kb. AAH1 (H1): 0.745kb (Native), 0.278kb (cDNA). AAH2 (H2): 0.745kb (Native), 0.278kb (cDNA). (D) Growth assays of parasites seeded into 96-well plates and allowed to proliferate for 24 h, then quantified using a luciferase assay. The WT, Δh1 , Δh2, Δh1Δh2 , Δh1-H1 , Δh2-H2 , and Δh1Δh2-H1 parasites showed no significant difference in total growth (Kruskal-Wallis test, P = 0.0672, N = 3 per strain).
    Figure Legend Snippet: Disruption of the AAH1 and AAH2 genes. (A) Schematic of the AAH2 knockout strategy in the wild-type ME49 Δhxg :: Luc strain (referred to as WT). A CRISPR-Cas9 construct with guide RNAs targeted to the 5’ and 3’ UTRs of AAH2 was co-transfected with the pΔaah2 :: HXG plasmid ( S2 Table ) and selected for with MPA +Xanthine to delete AAH2 to produce the clone Δaah2 :: HXG ( Δh2-HXG ). Subsequently, the HXG gene was replaced with either a clean fusion of the AAH2 5’ and 3’ UTRs ( pΔaah2 ) or an AAH2 cDNA construct ( pAAH2 ). ( S2 Table ) using 6-thioxanthine selection against the HXG locus to create the clean knockout clone Δaah2 ( Δh2 ) (upper panel) and the complement clone Δaah2 :: AAH2 ( Δh2-H2 ) (lower panel). Yellow Bars: CRISPR targeting sites. Black bars: PCR screening primer target regions ( S3 Table ). (B) Schematic of the knockout strategy for AAH1 . A CRISPR-Cas9 construct with guide RNAs targeted to the 5’ and 3’ UTRs of AAH1 was co-transfected with the pΔaah1 :: DHFR-Ts repair construct ( S2 Table ) into WT or Δaah2 parasites to create the clones Δaah1 ( Δh1 ) and Δaah1Δaah2 ( Δh1Δh2 ). Transfectants were selected for via pyrimethamine resistance. Subsequently, using pΔuprt :: AAH1 :: HXG , a cDNA copy of AAH1 driven by its native 5’ and 3’ UTRs was complemented into the UPRT locus by means of the HXGPRT drug resistance marker selected for with MPA +Xanthine, negative selection against UPRT with FUDR, and a single-cutting CRISPR-Cas9 construct targeted to the UPRT gene ( S2 Table ), creating the complement clones Δaah1-AAH1 ( Δh1-H1 ) and Δaah1Δaah2-AAH1 ( Δh1Δh2-H1 ). Brown Yellow Bars: CRISPR targeting sites. Black bars: PCR screening primer target regions ( S3 Table ). (C) PCR verification of successful ablation and complementation of knockouts. Expected product sizes: Tubulin (Tub): 0.378kb. AAH1 (H1): 0.745kb (Native), 0.278kb (cDNA). AAH2 (H2): 0.745kb (Native), 0.278kb (cDNA). (D) Growth assays of parasites seeded into 96-well plates and allowed to proliferate for 24 h, then quantified using a luciferase assay. The WT, Δh1 , Δh2, Δh1Δh2 , Δh1-H1 , Δh2-H2 , and Δh1Δh2-H1 parasites showed no significant difference in total growth (Kruskal-Wallis test, P = 0.0672, N = 3 per strain).

    Techniques Used: Knock-Out, CRISPR, Construct, Transfection, Plasmid Preparation, Selection, Polymerase Chain Reaction, Clone Assay, Marker, Luciferase

    37) Product Images from "Membrane Fluidity Is Regulated Cell Nonautonomously by Caenorhabditis elegans PAQR-2 and Its Mammalian Homolog AdipoR2"

    Article Title: Membrane Fluidity Is Regulated Cell Nonautonomously by Caenorhabditis elegans PAQR-2 and Its Mammalian Homolog AdipoR2

    Journal: Genetics

    doi: 10.1534/genetics.118.301272

    Germline and vitellogenin transport defects in the paqr-2 and iglr-2 mutants. (A and B) Main features of the posterior gonad of C. elegans (boxed area in A is detailed in B). The gonad is enclosed by the gonad sheath cells. In the distal end, nuclei share a common cytoplasm, hence forming a syncytium, and divide by mitosis and, more proximally, by meiosis. They accumulate yolk during the pachytene stage at the end of which they become fully surrounded by a membrane, becoming oocytes that continue to mature by the accumulation of yolk material. (C–H) DAPI staining showing that the paqr-2 and iglr-2 mutants have gross defects in their germline, especially in the pachytene region where large aggregates are evident (arrowheads). Note that the blue DAPI hue was converted to yellow to improve contrast. (I–N) Visualization of germline membranous structures reveals severe defects in germ cell shape and organization in the paqr-2 and iglr-2 mutants, which is most pronounced in pachytene and oocyte stages. Note the presence of deformed and abnormally small oocytes in the ventral side of the gonad in both mutants (arrowheads). (O–T) DIC images accompanied by the visualization of apoptotic corpses using CED-1::GFP reveals an increase in the frequency of cell death within the germline of the paqr-2 and iglr-2 mutants, (U) which is quantified in 1-day-old adult worms ( n = 20). Note again the abnormal presence of apoptotic clusters in the mutant (arrowheads). (V–X) Visualization of the VIT-2::GFP reporter reveals a clear accumulation of vitellogenin in embryos of wild-type N2 worms (white arrowheads) whereas the paqr-2 and iglr-2 mutants exhibit a gross mislocalization of vitellogenin, which accumulates in the pseudocoelomic space (yellow arrowheads); the average percentage of individuals with clear egg-enriched VIT-2::GFP are indicated together with the range corresponding to their 95% confidence interval. (Y) Tissue-specific expression of paqr-2(+) suppressed the vitellogenin mislocation defect of the paqr-2 mutant (see Figure 2A for a description of the transgenes used); values that differed significantly from paqr-2 are indicated.
    Figure Legend Snippet: Germline and vitellogenin transport defects in the paqr-2 and iglr-2 mutants. (A and B) Main features of the posterior gonad of C. elegans (boxed area in A is detailed in B). The gonad is enclosed by the gonad sheath cells. In the distal end, nuclei share a common cytoplasm, hence forming a syncytium, and divide by mitosis and, more proximally, by meiosis. They accumulate yolk during the pachytene stage at the end of which they become fully surrounded by a membrane, becoming oocytes that continue to mature by the accumulation of yolk material. (C–H) DAPI staining showing that the paqr-2 and iglr-2 mutants have gross defects in their germline, especially in the pachytene region where large aggregates are evident (arrowheads). Note that the blue DAPI hue was converted to yellow to improve contrast. (I–N) Visualization of germline membranous structures reveals severe defects in germ cell shape and organization in the paqr-2 and iglr-2 mutants, which is most pronounced in pachytene and oocyte stages. Note the presence of deformed and abnormally small oocytes in the ventral side of the gonad in both mutants (arrowheads). (O–T) DIC images accompanied by the visualization of apoptotic corpses using CED-1::GFP reveals an increase in the frequency of cell death within the germline of the paqr-2 and iglr-2 mutants, (U) which is quantified in 1-day-old adult worms ( n = 20). Note again the abnormal presence of apoptotic clusters in the mutant (arrowheads). (V–X) Visualization of the VIT-2::GFP reporter reveals a clear accumulation of vitellogenin in embryos of wild-type N2 worms (white arrowheads) whereas the paqr-2 and iglr-2 mutants exhibit a gross mislocalization of vitellogenin, which accumulates in the pseudocoelomic space (yellow arrowheads); the average percentage of individuals with clear egg-enriched VIT-2::GFP are indicated together with the range corresponding to their 95% confidence interval. (Y) Tissue-specific expression of paqr-2(+) suppressed the vitellogenin mislocation defect of the paqr-2 mutant (see Figure 2A for a description of the transgenes used); values that differed significantly from paqr-2 are indicated.

    Techniques Used: Staining, Mutagenesis, Expressing

    Tissue-specific rescue of paqr-2 mutant phenotypes. (A) Overview of the constructs used and their expression patterns. (B) Average length of ≥20 worms (initially synchronized L1s) with the indicated genotypes cultivated for 72 hr on normal plates (NGM), plates containing 20 mM glucose, or at 15°. Two transgenic lines, designated “A” and “B,” were obtained for each extrachromosomal array transgene and transgenic worms were identified via the co-injected rol -6 marker, which causes a Roller phenotype. The dashed line represents the approximate length of the L1s at the start of the experiments, and representative images are shown in C. (D) Scoring of the tail tip phenotype in worms of the indicated genotypes, with an example of a normal and a defective tail shown in E, where the arrowhead indicates the position of the anus. At least 100 1-day-old adult worms were scored for each genotype. (F) Average brood size of 10 worms of the indicated genotypes. (G) Illustration of a FRAP experiment, showing a pGLO-1P :: GFP-CAAX –positive intestinal membrane before. The circle indicates the size of the area to be bleached; arrowheads point to well-defined intestinal membranes and “n” indicates a nucleus. (H) FRAP result showing that N2, paqr-2 mutant, and paqr-2 mutant carrying a hypodermis-specific paqr-2(+) transgene have all similar membrane fluidity on normal plates (NGM), and that the hypodermis-specific expression of paqr-2(+) suppresses the loss of fluidity in the intestine of the paqr-2 mutant grown on 20 mM glucose (GLU). The T half is the time in seconds required to reach half of the maximum fluorescence recovery (L1+16 hr worms; n ≥ 5 worms). Values in B, D, and F that differed significantly from paqr-2 are indicated. ** P
    Figure Legend Snippet: Tissue-specific rescue of paqr-2 mutant phenotypes. (A) Overview of the constructs used and their expression patterns. (B) Average length of ≥20 worms (initially synchronized L1s) with the indicated genotypes cultivated for 72 hr on normal plates (NGM), plates containing 20 mM glucose, or at 15°. Two transgenic lines, designated “A” and “B,” were obtained for each extrachromosomal array transgene and transgenic worms were identified via the co-injected rol -6 marker, which causes a Roller phenotype. The dashed line represents the approximate length of the L1s at the start of the experiments, and representative images are shown in C. (D) Scoring of the tail tip phenotype in worms of the indicated genotypes, with an example of a normal and a defective tail shown in E, where the arrowhead indicates the position of the anus. At least 100 1-day-old adult worms were scored for each genotype. (F) Average brood size of 10 worms of the indicated genotypes. (G) Illustration of a FRAP experiment, showing a pGLO-1P :: GFP-CAAX –positive intestinal membrane before. The circle indicates the size of the area to be bleached; arrowheads point to well-defined intestinal membranes and “n” indicates a nucleus. (H) FRAP result showing that N2, paqr-2 mutant, and paqr-2 mutant carrying a hypodermis-specific paqr-2(+) transgene have all similar membrane fluidity on normal plates (NGM), and that the hypodermis-specific expression of paqr-2(+) suppresses the loss of fluidity in the intestine of the paqr-2 mutant grown on 20 mM glucose (GLU). The T half is the time in seconds required to reach half of the maximum fluorescence recovery (L1+16 hr worms; n ≥ 5 worms). Values in B, D, and F that differed significantly from paqr-2 are indicated. ** P

    Techniques Used: Mutagenesis, Construct, Expressing, Transgenic Assay, Injection, Marker, Fluorescence

    Tissue specificity of the fat-6 and fat-7 requirements. (A) Only paqr-2(+) expressed from its native promoter can significantly restore the expression levels of the fat-7 :: gfp reporter in the paqr-2 mutant (1-day-old adult worms; n ≥ 20). (B–E) Expression pattern of the CRISPR-modified fat-6 locus fused to GFP at the 3′ end of the coding region. Note the strong intestinal expression (arrowheads in C) as well as the distinct hypodermal cell expression in a different focal plane shown in the enlarged insets in D and E (arrowheads). (F) Tail tip phenotype of 1-day-old transgenic worms with the indicated genotypes. Both fat-6 and fat-7 contribute to the ability of the Ppaqr-2(+) transgene to suppress the tail tip phenotype of the paqr-2 mutant ( n ≥ 100). (G) Length of 1-day-old adult worms with the indicated genotypes cultivated on normal plates (NGM) or 20 mM glucose ( n ≥ 20). (H) Brood size of worms with the indicated genotypes cultivated on normal plates ( n = 10). * P
    Figure Legend Snippet: Tissue specificity of the fat-6 and fat-7 requirements. (A) Only paqr-2(+) expressed from its native promoter can significantly restore the expression levels of the fat-7 :: gfp reporter in the paqr-2 mutant (1-day-old adult worms; n ≥ 20). (B–E) Expression pattern of the CRISPR-modified fat-6 locus fused to GFP at the 3′ end of the coding region. Note the strong intestinal expression (arrowheads in C) as well as the distinct hypodermal cell expression in a different focal plane shown in the enlarged insets in D and E (arrowheads). (F) Tail tip phenotype of 1-day-old transgenic worms with the indicated genotypes. Both fat-6 and fat-7 contribute to the ability of the Ppaqr-2(+) transgene to suppress the tail tip phenotype of the paqr-2 mutant ( n ≥ 100). (G) Length of 1-day-old adult worms with the indicated genotypes cultivated on normal plates (NGM) or 20 mM glucose ( n ≥ 20). (H) Brood size of worms with the indicated genotypes cultivated on normal plates ( n = 10). * P

    Techniques Used: Expressing, Mutagenesis, CRISPR, Modification, Transgenic Assay

    Mosaic analysis of paqr2;Ex[sur-5 :: gfp(NLS) pPAQR-2] worms selected for growth to adulthood on 20 mM glucose. (A) Cell lineages and tissues carrying the extrachromosomal arrays were identified by the expression of GFP. Fifty worms able to grow into adults on 20 mM glucose and not expressing GFP in the intestine were selected for the analysis because expression in that organ obscures expression elsewhere ( Yochem et al. 1998 ). The transgenic statue of each cell lineage is color-coded in each of the 50 worms based on GFP expression in identifiable cells. (B–J) Example of GFP-positive tissues from a mosaic analysis study. Each panel is from a different animal carrying the paqr-2;Ex[sur-5 :: gfp(NLS) pPAQR-2] in different tissues, as indicated. Bars, 50 μm. BWM, body wall muscles; EXC, excretory canal cell; GSC, gonad sheath cells; SEAM, seam cells; SPERMTH A and P, anterior and posterior spermatheca, respectively; VCs, ventral cord neurons 2–6; Ventral Hyp Ridge, ventral hypodermal ridge; VNC, other ventral cord neurons.
    Figure Legend Snippet: Mosaic analysis of paqr2;Ex[sur-5 :: gfp(NLS) pPAQR-2] worms selected for growth to adulthood on 20 mM glucose. (A) Cell lineages and tissues carrying the extrachromosomal arrays were identified by the expression of GFP. Fifty worms able to grow into adults on 20 mM glucose and not expressing GFP in the intestine were selected for the analysis because expression in that organ obscures expression elsewhere ( Yochem et al. 1998 ). The transgenic statue of each cell lineage is color-coded in each of the 50 worms based on GFP expression in identifiable cells. (B–J) Example of GFP-positive tissues from a mosaic analysis study. Each panel is from a different animal carrying the paqr-2;Ex[sur-5 :: gfp(NLS) pPAQR-2] in different tissues, as indicated. Bars, 50 μm. BWM, body wall muscles; EXC, excretory canal cell; GSC, gonad sheath cells; SEAM, seam cells; SPERMTH A and P, anterior and posterior spermatheca, respectively; VCs, ventral cord neurons 2–6; Ventral Hyp Ridge, ventral hypodermal ridge; VNC, other ventral cord neurons.

    Techniques Used: Expressing, Transgenic Assay

    38) Product Images from "Chicory R2R3-MYB transcription factors CiMYB5 and CiMYB3 regulate fructan 1-exohydrolase expression in response to abiotic stress and hormonal cues"

    Article Title: Chicory R2R3-MYB transcription factors CiMYB5 and CiMYB3 regulate fructan 1-exohydrolase expression in response to abiotic stress and hormonal cues

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/erx210

    Chicory MYB transcription factors CiMYB3 and CiMYB5 activate the promoters of 1-FEH1 and 1-FEH2a / b but not of fructosyltransferase genes 1-SST and 1-FFT . (A) Promoter sequences p1-FEH1 (1195 bp), p1-FEH2a (1147 bp), p1-FEH2b (1448 bp), p1-SST (1110 bp), and p1-FFT (948 bp) were fused upstream of a firefly luciferase gene as reporter construct. The symbol ‘!’ indicates the 1448 bp insertion (−292 to −1740 bp upstream of ATG) of the p1-FEH2b as compared with p1-FEH2a . Transient transactivation of promoters was performed in grapevine suspension-cultured cells, following particle co-bombardment of the promoter-luciferase construct with the effector construct (pART7-CiMYB; with empty pART7 vector serving as control), and the Renilla luciferase plasmid pRluc for normalization of transfection efficiency. Luciferase activity was expressed in arbitrary units relative to the activity of Renilla luciferase. (B) Fold induction of FAZY promoter activity in the presence of CiMYB factor, relative to the empty vector control. Basal promoter activities are expressed as relative luciferase activities (firefly/ Renilla ). Bars indicate means±SD of three technical replicates. The results were confirmed in two independent experiments. Asterisks represent significant difference as determined by Student’s t -test (* P
    Figure Legend Snippet: Chicory MYB transcription factors CiMYB3 and CiMYB5 activate the promoters of 1-FEH1 and 1-FEH2a / b but not of fructosyltransferase genes 1-SST and 1-FFT . (A) Promoter sequences p1-FEH1 (1195 bp), p1-FEH2a (1147 bp), p1-FEH2b (1448 bp), p1-SST (1110 bp), and p1-FFT (948 bp) were fused upstream of a firefly luciferase gene as reporter construct. The symbol ‘!’ indicates the 1448 bp insertion (−292 to −1740 bp upstream of ATG) of the p1-FEH2b as compared with p1-FEH2a . Transient transactivation of promoters was performed in grapevine suspension-cultured cells, following particle co-bombardment of the promoter-luciferase construct with the effector construct (pART7-CiMYB; with empty pART7 vector serving as control), and the Renilla luciferase plasmid pRluc for normalization of transfection efficiency. Luciferase activity was expressed in arbitrary units relative to the activity of Renilla luciferase. (B) Fold induction of FAZY promoter activity in the presence of CiMYB factor, relative to the empty vector control. Basal promoter activities are expressed as relative luciferase activities (firefly/ Renilla ). Bars indicate means±SD of three technical replicates. The results were confirmed in two independent experiments. Asterisks represent significant difference as determined by Student’s t -test (* P

    Techniques Used: Luciferase, Construct, Cell Culture, Plasmid Preparation, Transfection, Activity Assay

    Identification of chicory R2R3-MYB transcription factors co-induced with fructan 1-exohydrolases ( 1-FEH1 and 1-FEH2 ) by cold treatment. Expression of 34 R2R3-MYB TFs in chicory hairy root cultures (CiHRC) exposed to cold treatment. Transcript levels were detected by qRT-PCR, normalized against expression of RPL19, and expressed relative to those of control samples (0 h), which were set to 1.0 as indicated with a horizontal line. (A) Expression of CiMYB1 , CiMYB3 , CiMYB4 , and CiMYB5 was strongly co-induced with 1-FEH1 and 1-FEH2 . (B, C) All other R2R3-MYB genes were not co-expressed with 1-FEH genes. Note that 1-FEH2 transcripts include those of 1-FEH2a and 1-FEH2b. Values are means±SD of three independent experiments. Asterisks represent significant difference as determined by Student’s t -test (* P
    Figure Legend Snippet: Identification of chicory R2R3-MYB transcription factors co-induced with fructan 1-exohydrolases ( 1-FEH1 and 1-FEH2 ) by cold treatment. Expression of 34 R2R3-MYB TFs in chicory hairy root cultures (CiHRC) exposed to cold treatment. Transcript levels were detected by qRT-PCR, normalized against expression of RPL19, and expressed relative to those of control samples (0 h), which were set to 1.0 as indicated with a horizontal line. (A) Expression of CiMYB1 , CiMYB3 , CiMYB4 , and CiMYB5 was strongly co-induced with 1-FEH1 and 1-FEH2 . (B, C) All other R2R3-MYB genes were not co-expressed with 1-FEH genes. Note that 1-FEH2 transcripts include those of 1-FEH2a and 1-FEH2b. Values are means±SD of three independent experiments. Asterisks represent significant difference as determined by Student’s t -test (* P

    Techniques Used: Expressing, Quantitative RT-PCR

    Chicory MYB transcription factors CiMYB3 and CiMYB5 interact with the conserved MYB-core motif (C/T)NGTT(A/G) that is overrepresented in 1-FEH promoters. (A) For the yeast-one-hybrid assay, a fragment of 341 bp (−387 to −727 bp upstream of ATG) of the 1-FEH1 promoter and a fragment of 201 bp (−1 to −207 bp upstream of ATG) of the 1-FEH2a promoter were respectively cloned as bait sequences. The concentrations of aureobasidin A (AbA) used to eliminate the background of p1-FEH1 and p1-FEH2a bait strains were 100 and 300 ng ml −1 , respectively. Yeast cells transformed with CiMYB-pGADT7 plasmid, but not pGADT7 empty vector, were able to grow on leucine-deficient synthetic dropout medium (SD/−Leu) supplemented with AbA antibiotics. (B) One synthetic DNA fragment harboring four copies of the MYB-core motif taken from the 1-FEH1 promoter was sufficient to activate luciferase expression via CiMYB3 and CiMYB5; for further details see Fig. 2 . The results were confirmed in two independent experiments. Asterisks represent significant difference as determined by Student’s t -test (* P
    Figure Legend Snippet: Chicory MYB transcription factors CiMYB3 and CiMYB5 interact with the conserved MYB-core motif (C/T)NGTT(A/G) that is overrepresented in 1-FEH promoters. (A) For the yeast-one-hybrid assay, a fragment of 341 bp (−387 to −727 bp upstream of ATG) of the 1-FEH1 promoter and a fragment of 201 bp (−1 to −207 bp upstream of ATG) of the 1-FEH2a promoter were respectively cloned as bait sequences. The concentrations of aureobasidin A (AbA) used to eliminate the background of p1-FEH1 and p1-FEH2a bait strains were 100 and 300 ng ml −1 , respectively. Yeast cells transformed with CiMYB-pGADT7 plasmid, but not pGADT7 empty vector, were able to grow on leucine-deficient synthetic dropout medium (SD/−Leu) supplemented with AbA antibiotics. (B) One synthetic DNA fragment harboring four copies of the MYB-core motif taken from the 1-FEH1 promoter was sufficient to activate luciferase expression via CiMYB3 and CiMYB5; for further details see Fig. 2 . The results were confirmed in two independent experiments. Asterisks represent significant difference as determined by Student’s t -test (* P

    Techniques Used: Y1H Assay, Clone Assay, Transformation Assay, Plasmid Preparation, Luciferase, Expressing

    39) Product Images from "Mutations in dock1 disrupt early Schwann cell development"

    Article Title: Mutations in dock1 disrupt early Schwann cell development

    Journal: Neural Development

    doi: 10.1186/s13064-018-0114-9

    stl145 mutants exhibit delays in radial sorting and decreased expression of krox20. a-g) TEM of cross-sections of the PLLn. Myelinated axons are pseudocolored in green and axons associated with promyelinating Schwann cells are pseudocolored in purple. Scale bars = 500 nm. a, b) Micrographs from the same PLLn within a MZ dock1 stl145 heterozygote show Schwann cells myelinating axons at 60 hpf. C) An MZ dock1 stl145 homozygous larva does not have myelinated axons at 60 hpf, but Schwann cells are extending processes into axon bundles. C′) Magnification of inset from C shows an axon surrounded by a pro-myelinating Schwann cell. d, e) Schwann cells can myelinate and sort axons at 3 dpf in wild-type (n = 6 animals, 10 nerves) and mutant larvae ( n = 4 animals, 6 nerves). f, g) More sorted axons are present in mutants ( n = 8 animals, 15 nerves) at 5 dpf compared to controls ( n = 11 animals, 17 nerves). Quantification of the number of sorted axons at h) 3 dpf and i) 5 dpf shows a statistical difference at 5 dpf (unpaired t Test with Welch’s correction). j, k) Lateral view of WISH for krox20 at 3 dpf. Arrowheads indicate PLLn. Inset panels show a magnified view of the PLLn. Scale bar = 50 μm. j) krox20 is expressed along the PLLn of control larvae ( n = 67) whereas k) dock1 stl145 homozygous mutants express little to no krox20 along the PLLn (n = 18/19). l) Quantification of WISH for krox20 at 3 dpf based on phenotypic classes and genotypes for the stl145 lesion ( p
    Figure Legend Snippet: stl145 mutants exhibit delays in radial sorting and decreased expression of krox20. a-g) TEM of cross-sections of the PLLn. Myelinated axons are pseudocolored in green and axons associated with promyelinating Schwann cells are pseudocolored in purple. Scale bars = 500 nm. a, b) Micrographs from the same PLLn within a MZ dock1 stl145 heterozygote show Schwann cells myelinating axons at 60 hpf. C) An MZ dock1 stl145 homozygous larva does not have myelinated axons at 60 hpf, but Schwann cells are extending processes into axon bundles. C′) Magnification of inset from C shows an axon surrounded by a pro-myelinating Schwann cell. d, e) Schwann cells can myelinate and sort axons at 3 dpf in wild-type (n = 6 animals, 10 nerves) and mutant larvae ( n = 4 animals, 6 nerves). f, g) More sorted axons are present in mutants ( n = 8 animals, 15 nerves) at 5 dpf compared to controls ( n = 11 animals, 17 nerves). Quantification of the number of sorted axons at h) 3 dpf and i) 5 dpf shows a statistical difference at 5 dpf (unpaired t Test with Welch’s correction). j, k) Lateral view of WISH for krox20 at 3 dpf. Arrowheads indicate PLLn. Inset panels show a magnified view of the PLLn. Scale bar = 50 μm. j) krox20 is expressed along the PLLn of control larvae ( n = 67) whereas k) dock1 stl145 homozygous mutants express little to no krox20 along the PLLn (n = 18/19). l) Quantification of WISH for krox20 at 3 dpf based on phenotypic classes and genotypes for the stl145 lesion ( p

    Techniques Used: Expressing, Transmission Electron Microscopy, Mutagenesis

    Roles of GEFs in Schwann cell development. Several canonical a nd atypical GEFs have been characterized in Schwann cell development, primarily during Schwann cell migration. Dock1 functions either cell autonomously or non-cell autonomously to regulate immature to myelinating stages of Schwann cell development
    Figure Legend Snippet: Roles of GEFs in Schwann cell development. Several canonical a nd atypical GEFs have been characterized in Schwann cell development, primarily during Schwann cell migration. Dock1 functions either cell autonomously or non-cell autonomously to regulate immature to myelinating stages of Schwann cell development

    Techniques Used: Migration

    stl145 mutants exhibit decreased mbp expression in the PNS. a-d) Lateral views of mbp expression by WISH. Arrowheads indicate the PLLn. Asterisks indicate the central nervous system (CNS). Inset panels show a magnified view of the PLLn. Scale bars = 100 μm. a) mbp at 3 dpf is strongly expressed in the PLLn of control larva ( n = 93/96). b) stl145 mutants at 3dpf exhibit reduced mbp expression in the PLLn ( n = 34). c) mbp expression is strongly expressed in the PLLn of control larva at 5 dpf ( n = 52/62). d) stl145 mutants at 5 dpf express mbp , but at reduced levels compared to control siblings ( n = 27/30). e) Analysis of whole genome sequencing data showed that chromosome 12 exhibited the highest mutant to wild-type allele ratio. f) Within the most highly linked region of chromosome 12, dock1 was the only gene that contained an early stop codon. g) A schematic of the protein structure of Dock1 and the location of the stl145 lesion. The SH3 and proline rich domains can bind adaptor proteins. The DHR-1 domain interacts with PtdIns(3,4,5)P 3 and the DHR-2 domain is the catalytic domain can that catalyzes the exchange of GDP for GTP in Rac1. h-i) Quantification of WISH for mbp at 3 dpf (h) and 5 dpf (i) , respectively, based on phenotypic classes and genotypes for the stl145 lesion. **** p
    Figure Legend Snippet: stl145 mutants exhibit decreased mbp expression in the PNS. a-d) Lateral views of mbp expression by WISH. Arrowheads indicate the PLLn. Asterisks indicate the central nervous system (CNS). Inset panels show a magnified view of the PLLn. Scale bars = 100 μm. a) mbp at 3 dpf is strongly expressed in the PLLn of control larva ( n = 93/96). b) stl145 mutants at 3dpf exhibit reduced mbp expression in the PLLn ( n = 34). c) mbp expression is strongly expressed in the PLLn of control larva at 5 dpf ( n = 52/62). d) stl145 mutants at 5 dpf express mbp , but at reduced levels compared to control siblings ( n = 27/30). e) Analysis of whole genome sequencing data showed that chromosome 12 exhibited the highest mutant to wild-type allele ratio. f) Within the most highly linked region of chromosome 12, dock1 was the only gene that contained an early stop codon. g) A schematic of the protein structure of Dock1 and the location of the stl145 lesion. The SH3 and proline rich domains can bind adaptor proteins. The DHR-1 domain interacts with PtdIns(3,4,5)P 3 and the DHR-2 domain is the catalytic domain can that catalyzes the exchange of GDP for GTP in Rac1. h-i) Quantification of WISH for mbp at 3 dpf (h) and 5 dpf (i) , respectively, based on phenotypic classes and genotypes for the stl145 lesion. **** p

    Techniques Used: Expressing, Sequencing, Mutagenesis

    Mutations in dock1 cause decreased mbp expression in the PNS. a-d) Lateral views of mbp expression by WISH at 3 dpf. Arrowheads indicate PLLn. Asterisks indicates the CNS. Inset panels show a magnified view of PLLn. Scale bars = 100 μm . a) Control larvae robustly express mbp in the PLLn ( n = 29/38). b) dock1 stl145 homozygous mutants exhibit strongly reduced mbp expression in the PLLn ( n = 6/6). c) Control larvae injected with dock1 mRNA exhibit strong expression of mbp in the PLLn ( n = 50/53). d) dock1 stl145 homozygous mutants injected with dock1 mRNA robustly express mbp in the PLLn ( n = 13/25). e) Quantification of the percent phenotypic classes larvae were scored for mbp expression in the PLLn at 3 dpf. Control = pooled uninjected and phenol red injected larvae. f) A schematic of the Dock1 protein with the locations of the stl366 , stl365 , and stl145 lesions indicated. g-j) Lateral views of mbp expression by WISH at 3 dpf. Arrowheads indicate the PLLn. Asterisks indicate the CNS. Inset panels show a magnified view of PLLn. Scale bars = 100 μm. g) dock1 stl365 homozygous mutants ( n = 20) and h) dock1 stl366 homozygous mutants exhibit reduced mbp expression in the PLLn ( n = 15/16). i) dock1 stl145/stl365 compound heterozygotes and j) dock1 stl145/stl366 compound heterozygotes exhibit reduced mbp expression in the PLLn. k, l) Quantification of WISH for mbp from dock1 stl365 (k) and dock1 stl366 (l) in-crosses based on phenotypic classes and genotypes for the respective lesions. * p
    Figure Legend Snippet: Mutations in dock1 cause decreased mbp expression in the PNS. a-d) Lateral views of mbp expression by WISH at 3 dpf. Arrowheads indicate PLLn. Asterisks indicates the CNS. Inset panels show a magnified view of PLLn. Scale bars = 100 μm . a) Control larvae robustly express mbp in the PLLn ( n = 29/38). b) dock1 stl145 homozygous mutants exhibit strongly reduced mbp expression in the PLLn ( n = 6/6). c) Control larvae injected with dock1 mRNA exhibit strong expression of mbp in the PLLn ( n = 50/53). d) dock1 stl145 homozygous mutants injected with dock1 mRNA robustly express mbp in the PLLn ( n = 13/25). e) Quantification of the percent phenotypic classes larvae were scored for mbp expression in the PLLn at 3 dpf. Control = pooled uninjected and phenol red injected larvae. f) A schematic of the Dock1 protein with the locations of the stl366 , stl365 , and stl145 lesions indicated. g-j) Lateral views of mbp expression by WISH at 3 dpf. Arrowheads indicate the PLLn. Asterisks indicate the CNS. Inset panels show a magnified view of PLLn. Scale bars = 100 μm. g) dock1 stl365 homozygous mutants ( n = 20) and h) dock1 stl366 homozygous mutants exhibit reduced mbp expression in the PLLn ( n = 15/16). i) dock1 stl145/stl365 compound heterozygotes and j) dock1 stl145/stl366 compound heterozygotes exhibit reduced mbp expression in the PLLn. k, l) Quantification of WISH for mbp from dock1 stl365 (k) and dock1 stl366 (l) in-crosses based on phenotypic classes and genotypes for the respective lesions. * p

    Techniques Used: Expressing, Injection

    Schwann cell migration and number is not affected in stl145 mutants. a, b) Lateral view of WISH for sox10 at 2 dpf. Arrowheads indicate the PLLn. Asterisks indicate the CNS. a) Strongly expressing sox10 positive cells are located throughout the PLLn in control larvae ( n = 21/23), similar to b) dock1 stl145 homozygous mutant larva ( n = 18). c) Quantification of WISH for sox10 at 2 dpf based on phenotypic classes and genotypes for the stl145 lesion shows no significant difference in expression ( p = 0.3522, Bars represent means ± SD; Chi-squared analysis). d, g’) Still images from time-lapse imaging from 30 to 31.5 hpf in Tg(foxd3:gfp) wild-type larvae injected with sox10:Lifeact-RFP . Prime panels show Lifeact-RFP strongly localized at the back of migrating Schwann cells (arrowheads). Scale bars = 20 μm. h-k′) Still images from time-lapse imaging from 30 to 31.5 hpf in Tg(foxd3:gfp) dock1 stl145/stl145 larvae injected with sox10:Lifeact-RFP . Prime panels show Lifeact-RFP strongly localized at the back of migrating Schwann cells (arrowheads). l, m) Lateral view of PLLn in 2 dpf larvae containing Tg(foxd3:gfp) and Tg(sox10(4.9):nls-eos) . Arrows point to examples of double positive Schwann cells. Counting the number of Schwann cells double positive for GFP and RFP in l) control ( n = 34) and m) dock1 stl145 homozygous mutants (n = 9). Scale bars = 100 μm. n) Quantification of the number of Schwann cells within a defined region of the PLLn revealed no significant difference in Schwann cell number (NS, p = 0.1360). Bars represent means ± SD; unpaired t Test with Welch’s correction
    Figure Legend Snippet: Schwann cell migration and number is not affected in stl145 mutants. a, b) Lateral view of WISH for sox10 at 2 dpf. Arrowheads indicate the PLLn. Asterisks indicate the CNS. a) Strongly expressing sox10 positive cells are located throughout the PLLn in control larvae ( n = 21/23), similar to b) dock1 stl145 homozygous mutant larva ( n = 18). c) Quantification of WISH for sox10 at 2 dpf based on phenotypic classes and genotypes for the stl145 lesion shows no significant difference in expression ( p = 0.3522, Bars represent means ± SD; Chi-squared analysis). d, g’) Still images from time-lapse imaging from 30 to 31.5 hpf in Tg(foxd3:gfp) wild-type larvae injected with sox10:Lifeact-RFP . Prime panels show Lifeact-RFP strongly localized at the back of migrating Schwann cells (arrowheads). Scale bars = 20 μm. h-k′) Still images from time-lapse imaging from 30 to 31.5 hpf in Tg(foxd3:gfp) dock1 stl145/stl145 larvae injected with sox10:Lifeact-RFP . Prime panels show Lifeact-RFP strongly localized at the back of migrating Schwann cells (arrowheads). l, m) Lateral view of PLLn in 2 dpf larvae containing Tg(foxd3:gfp) and Tg(sox10(4.9):nls-eos) . Arrows point to examples of double positive Schwann cells. Counting the number of Schwann cells double positive for GFP and RFP in l) control ( n = 34) and m) dock1 stl145 homozygous mutants (n = 9). Scale bars = 100 μm. n) Quantification of the number of Schwann cells within a defined region of the PLLn revealed no significant difference in Schwann cell number (NS, p = 0.1360). Bars represent means ± SD; unpaired t Test with Welch’s correction

    Techniques Used: Migration, Expressing, Mutagenesis, Imaging, Injection

    PNS myelination is significantly reduced in stl145 mutants. a, b) TEM of a cross-section of the PLLn at 3 dpf. Myelinated axons are pseudocolored in green. Scale bars = 500 nm. a) Axons in wild-type PLLn begin to be myelinated while b) dock1 stl145 homozygous mutant PLLn exhibits fewer myelination of axons. c) Quantification of the percent myelinated axons shows a significant difference between control ( n = 6 animals, 10 nerves) and dock1 stl145 mutants ( n = 4 animals, 6 nerves). d) Quantification of the total number of axons (NS, p = 0.0983). e, f) Quantification of a cross-section of the PLLn at 5 dpf. Myelinated axons are pseudocolored in green. Scale bars = 500 nm. e) The PLLn of a wild-type larva contains numerous myelinated axons whereas f) a dock1 stl145 homozygous mutant PLLn contains fewer myelinated axons. g) Quantification of the percent myelinated axons shows a significant difference between control ( n = 11 animals, 18 nerves) and dock1 stl145 mutants ( n = 9 animals, 15 nerves). h) Quantification of the total number of axons (NS, p = 0.3031). Bars represent means ± SD. *** p
    Figure Legend Snippet: PNS myelination is significantly reduced in stl145 mutants. a, b) TEM of a cross-section of the PLLn at 3 dpf. Myelinated axons are pseudocolored in green. Scale bars = 500 nm. a) Axons in wild-type PLLn begin to be myelinated while b) dock1 stl145 homozygous mutant PLLn exhibits fewer myelination of axons. c) Quantification of the percent myelinated axons shows a significant difference between control ( n = 6 animals, 10 nerves) and dock1 stl145 mutants ( n = 4 animals, 6 nerves). d) Quantification of the total number of axons (NS, p = 0.0983). e, f) Quantification of a cross-section of the PLLn at 5 dpf. Myelinated axons are pseudocolored in green. Scale bars = 500 nm. e) The PLLn of a wild-type larva contains numerous myelinated axons whereas f) a dock1 stl145 homozygous mutant PLLn contains fewer myelinated axons. g) Quantification of the percent myelinated axons shows a significant difference between control ( n = 11 animals, 18 nerves) and dock1 stl145 mutants ( n = 9 animals, 15 nerves). h) Quantification of the total number of axons (NS, p = 0.3031). Bars represent means ± SD. *** p

    Techniques Used: Transmission Electron Microscopy, Mutagenesis

    40) Product Images from "PWWP2A binds distinct chromatin moieties and interacts with an MTA1-specific core NuRD complex"

    Article Title: PWWP2A binds distinct chromatin moieties and interacts with an MTA1-specific core NuRD complex

    Journal: Nature Communications

    doi: 10.1038/s41467-018-06665-5

    PWWP2A interacts with members of a core NuRD complex via MTA1. a Volcano plot of label-free interaction of GFP–PWWP2A-associated mononucleosomes. Significantly enriched proteins over GFP-associated mononucleosomes are shown in the upper right part. t test differences were obtained by two-sample t test. PWWP2A is highlighted in green, members of the core NuRD (M1HR) complex in red, previously identified H2A.Z-mononucleosome binders 12 in blue, PWWP2A-specific interactors not found in H2A.Z pulldowns 12 in black and background binding proteins in gray. b Immunoblots of several NuRD members (MTA1, HDAC2, RBBP7, RBBP4, and CHD4) and H3 upon GST and GST–PWWP2A IP with HK cell-derived mononucleosomes. c Upper part: schematic depiction of mammalian MTA1-3 paralogues. Lower part: immunoblots of PWWP2A or MBD3 after IP of endogenously tagged MTA1–FLAG, MTA2–GFP, or MTA3–FLAG from mouse embryonic stem cell (mESC) nuclear extracts. Input lanes represent 10% of the lysate used for the IP. d FLAG-PWWP2A IPs with cell lysates from HEK293 cells co-transfected with combinations of plasmids encoding FLAG-PWWP2A, HDAC1 (tagless), HA-RBBP4, and either HA-MTA1 or HA-MTA2. Left panel: western blot of inputs. Right panel: SYPRO Ruby-stained SDS-PAGE of the precipitated proteins. e Top: schematic depiction of domain structure of PWWP2A and deletion constructs. Bottom: coomassie-stained SDS–PAGE gel with indicated recombinant PWWP2A deletion constructs on beads (left) and immunoblots of IPs from lysates from HEK293 cells expressing HA-MTA1 (right)
    Figure Legend Snippet: PWWP2A interacts with members of a core NuRD complex via MTA1. a Volcano plot of label-free interaction of GFP–PWWP2A-associated mononucleosomes. Significantly enriched proteins over GFP-associated mononucleosomes are shown in the upper right part. t test differences were obtained by two-sample t test. PWWP2A is highlighted in green, members of the core NuRD (M1HR) complex in red, previously identified H2A.Z-mononucleosome binders 12 in blue, PWWP2A-specific interactors not found in H2A.Z pulldowns 12 in black and background binding proteins in gray. b Immunoblots of several NuRD members (MTA1, HDAC2, RBBP7, RBBP4, and CHD4) and H3 upon GST and GST–PWWP2A IP with HK cell-derived mononucleosomes. c Upper part: schematic depiction of mammalian MTA1-3 paralogues. Lower part: immunoblots of PWWP2A or MBD3 after IP of endogenously tagged MTA1–FLAG, MTA2–GFP, or MTA3–FLAG from mouse embryonic stem cell (mESC) nuclear extracts. Input lanes represent 10% of the lysate used for the IP. d FLAG-PWWP2A IPs with cell lysates from HEK293 cells co-transfected with combinations of plasmids encoding FLAG-PWWP2A, HDAC1 (tagless), HA-RBBP4, and either HA-MTA1 or HA-MTA2. Left panel: western blot of inputs. Right panel: SYPRO Ruby-stained SDS-PAGE of the precipitated proteins. e Top: schematic depiction of domain structure of PWWP2A and deletion constructs. Bottom: coomassie-stained SDS–PAGE gel with indicated recombinant PWWP2A deletion constructs on beads (left) and immunoblots of IPs from lysates from HEK293 cells expressing HA-MTA1 (right)

    Techniques Used: Binding Assay, Western Blot, Derivative Assay, Transfection, Staining, SDS Page, Construct, Recombinant, Expressing

    IC distinguishes between H2A and H2A.Z, whereas IN recognizes nucleosomal linker DNA. a Schematic representation of recombinant GST–PWWP2A deletions (GST-I, GST–IN, and GST-IC) used in cEMSAs. b Representative cEMSA in which a 1:1 mixture of H2A- and H2A.Z-containing nucleosomes (each with a distinct fluorescent tag) was incubated with increasing concentrations of GST-tagged I-domain constructs. The top gel shows detection of the H2A.Z nucleosomes and the bottom gel detection of the H2A nucleosomes. In both cases, the DNA contained a 20-bp linker DNA (Widom 601-sequence) on each side of the nucleosome (20–Θ–20). GST alone served as negative control. * Free DNA, ** nucleosome, *** nucleosome GST–protein complex. Arrow indicates loss of signal when nucleosome GST–protein complexes are formed. c Left: representative cEMSAs similar to ( b ) using recombinant wildtype mononucleosomes (WT, top) or mononucleosomes lacking single histone tails (TL, bottom) containing 20-bp linker DNA (20–Θ–20). Nucleosomes were incubated with the indicated concentrations of GST–IN and the gel visualized by fluorescence detection of the indicated nucleosome. Right: quantification of signal intensities of nucleosomes (**) using Image Studio Lite Ver 5.2 (LI-COR). Error bars indicate SEM of three independent replicates. d Representative EMSA using Cy-5 labeled 187-bp dsDNA and the indicated concentrations of GST–IN and GST-IC. * free DNA, *** DNA–GST–protein complex. Arrow indicates unbound DNA. e Left: representative cEMSAs similar to ( b ) using recombinant H2A.Z-containing mononucleosomes without (0–Θ–0, top) and with (20–Θ–20, bottom) linker DNA; these nucleosomes were incubated with the indicated concentrations of GST-I, GST–IN, and GST-IC. * Free DNA, ** nucleosome, *** nucleosome GST–protein complex. Arrow indicates loss of signal when nucleosome GST–protein complexes are formed. Right: Quantification of signal intensities of nucleosomes ( ** ) using Image Studio Lite Ver 5.2 (LI-COR). Error bars indicate SEM of three independent replicates
    Figure Legend Snippet: IC distinguishes between H2A and H2A.Z, whereas IN recognizes nucleosomal linker DNA. a Schematic representation of recombinant GST–PWWP2A deletions (GST-I, GST–IN, and GST-IC) used in cEMSAs. b Representative cEMSA in which a 1:1 mixture of H2A- and H2A.Z-containing nucleosomes (each with a distinct fluorescent tag) was incubated with increasing concentrations of GST-tagged I-domain constructs. The top gel shows detection of the H2A.Z nucleosomes and the bottom gel detection of the H2A nucleosomes. In both cases, the DNA contained a 20-bp linker DNA (Widom 601-sequence) on each side of the nucleosome (20–Θ–20). GST alone served as negative control. * Free DNA, ** nucleosome, *** nucleosome GST–protein complex. Arrow indicates loss of signal when nucleosome GST–protein complexes are formed. c Left: representative cEMSAs similar to ( b ) using recombinant wildtype mononucleosomes (WT, top) or mononucleosomes lacking single histone tails (TL, bottom) containing 20-bp linker DNA (20–Θ–20). Nucleosomes were incubated with the indicated concentrations of GST–IN and the gel visualized by fluorescence detection of the indicated nucleosome. Right: quantification of signal intensities of nucleosomes (**) using Image Studio Lite Ver 5.2 (LI-COR). Error bars indicate SEM of three independent replicates. d Representative EMSA using Cy-5 labeled 187-bp dsDNA and the indicated concentrations of GST–IN and GST-IC. * free DNA, *** DNA–GST–protein complex. Arrow indicates unbound DNA. e Left: representative cEMSAs similar to ( b ) using recombinant H2A.Z-containing mononucleosomes without (0–Θ–0, top) and with (20–Θ–20, bottom) linker DNA; these nucleosomes were incubated with the indicated concentrations of GST-I, GST–IN, and GST-IC. * Free DNA, ** nucleosome, *** nucleosome GST–protein complex. Arrow indicates loss of signal when nucleosome GST–protein complexes are formed. Right: Quantification of signal intensities of nucleosomes ( ** ) using Image Studio Lite Ver 5.2 (LI-COR). Error bars indicate SEM of three independent replicates

    Techniques Used: Recombinant, Incubation, Construct, Sequencing, Negative Control, Fluorescence, Labeling

    PWWP domain binds nucleic acids and S_PWWP interacts with H3K36me3. a Representative cEMSA using recombinant H2A.Z-containing mononucleosomes assembled either without (0–Θ–0, top) or with linker DNA (20–Θ–20, bottom) incubated with indicated increasing concentrations of GST–PWWP. GST alone served as negative control. * Free DNA, ** nucleosome, *** nucleosome GST–PWWP complex. Arrow indicates loss of signal when nucleosome GST–protein complexes are formed. b In silico structure of PWWP domain modeled with the web browser-based tool iTASSER and visualized with Chimera (1.8.0). β-barrels (β1–β5) are colored in red, α-helixes (α1–α3), and η-helix in blue and the three residues forming the aromatic cage (F666, W669, and W695) are highlighted in green and depicted in stick mode. NT = N-terminus, CT = C-terminus. c Top left: schematic representation of recombinant GST–PWWP2A and deletions (GST-P1, GST-I, GST-I_S, GST-I_S_PWWP, GST-S_PWWP, and GST–PWWP) used in cell-derived mononucleosome-IPs. Top right: Immunoblotting of different histone PTMs upon GST–PWWP2A deletion construct (GST–PWWP2A, GST-P1, GST-I, GST-I_S, GST-I_S_PWWP, GST-S_PWWP, and GST–PWWP) IPs with HK cell-derived mononucleosomes. Notice enrichment of H3K36me3 in comparison to other modifications in S_PWWP pulldown. GST alone served as negative control. Bottom: Data quantification was done for three biological replicates for each PTM ( n = 3). Data shown are means and error bars depict SEM. d Left: immunoblotting of H3K36me3 and H2A.Z upon GST–PWWP2A, GST-PWWP2A_ΔIC and GST-S_PWWP IPs with HK cell-derived mononucleosomes. Right: Data quantification of H3K36me3 enrichment (middle) and H2A.Z binding (right) was done for three biological replicates ( n = 3). Data shown are means and error bars depict SEM. e Left: immunoblotting of H3K36me3 upon GST-S_PWWP aromatic cage point mutants (GST-S_PWWP_F666A, GST-S_PWWP_W669A, GST-S_PWWP_W695A) IPs with HK cell-derived mononucleosomes. Notice reduction of H3K36me3 in GST-S_PWWP_W669A and GST-S_PWWP_W695A pulldowns. Right: Data quantification was done for three biological replicates ( n = 3). Data shown are means and error bars depict SEM
    Figure Legend Snippet: PWWP domain binds nucleic acids and S_PWWP interacts with H3K36me3. a Representative cEMSA using recombinant H2A.Z-containing mononucleosomes assembled either without (0–Θ–0, top) or with linker DNA (20–Θ–20, bottom) incubated with indicated increasing concentrations of GST–PWWP. GST alone served as negative control. * Free DNA, ** nucleosome, *** nucleosome GST–PWWP complex. Arrow indicates loss of signal when nucleosome GST–protein complexes are formed. b In silico structure of PWWP domain modeled with the web browser-based tool iTASSER and visualized with Chimera (1.8.0). β-barrels (β1–β5) are colored in red, α-helixes (α1–α3), and η-helix in blue and the three residues forming the aromatic cage (F666, W669, and W695) are highlighted in green and depicted in stick mode. NT = N-terminus, CT = C-terminus. c Top left: schematic representation of recombinant GST–PWWP2A and deletions (GST-P1, GST-I, GST-I_S, GST-I_S_PWWP, GST-S_PWWP, and GST–PWWP) used in cell-derived mononucleosome-IPs. Top right: Immunoblotting of different histone PTMs upon GST–PWWP2A deletion construct (GST–PWWP2A, GST-P1, GST-I, GST-I_S, GST-I_S_PWWP, GST-S_PWWP, and GST–PWWP) IPs with HK cell-derived mononucleosomes. Notice enrichment of H3K36me3 in comparison to other modifications in S_PWWP pulldown. GST alone served as negative control. Bottom: Data quantification was done for three biological replicates for each PTM ( n = 3). Data shown are means and error bars depict SEM. d Left: immunoblotting of H3K36me3 and H2A.Z upon GST–PWWP2A, GST-PWWP2A_ΔIC and GST-S_PWWP IPs with HK cell-derived mononucleosomes. Right: Data quantification of H3K36me3 enrichment (middle) and H2A.Z binding (right) was done for three biological replicates ( n = 3). Data shown are means and error bars depict SEM. e Left: immunoblotting of H3K36me3 upon GST-S_PWWP aromatic cage point mutants (GST-S_PWWP_F666A, GST-S_PWWP_W669A, GST-S_PWWP_W695A) IPs with HK cell-derived mononucleosomes. Notice reduction of H3K36me3 in GST-S_PWWP_W669A and GST-S_PWWP_W695A pulldowns. Right: Data quantification was done for three biological replicates ( n = 3). Data shown are means and error bars depict SEM

    Techniques Used: Recombinant, Incubation, Negative Control, In Silico, Derivative Assay, Construct, Binding Assay

    Related Articles

    Clone Assay:

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP
    Article Snippet: .. Construction of HaloTag fusion protein plasmids The coding sequence of human PTBP1 with stop codon, which encodes polypyrimidine-tract binding protein (PTB), was cloned into the pENTR4 vector using Gibson Assembly (catalog No. E2611; New England Biolabs). .. Then LR recombination reaction (Invitrogen, Catalog No. 11791020) was applied to transfer the entry sequence into a destination vector, which is engineered in house from a pMSCV-puro (Clontech, PT3303-5) plasmid with inserted N-terminal HaloTag, followed by 3× TEV cleavage sites, 2× StrepII, and a Gateway™ recombination cassette.

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2
    Article Snippet: .. The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA). .. The full-length (1797 bp) IGF2BP2 CDS lacking the start codon was generated by RT-PCR using total RNA extracted from HTR-8/SVneo cells and inserted into the EcoR I and Bgl II sites downstream of the FLAG peptide sequence in the N-terminal pFLAG-CMV-4 vector (Sigma, St. Louis, MO, USA).

    Article Title: Glycoconjugate vaccine using a genetically modified O antigen induces protective antibodies to Francisella tularensis
    Article Snippet: .. To achieve a clean wzz1 deletion, 0.5-kb upstream and downstream DNA regions were PCR-amplified by Q5 polymerase (New England Biolabs) using primers ( ) and cloned into pMP812 suicide plasmid using a Gibson Assembly Kit (New England Biolabs) following the manufacturer’s recommendations. .. To generate the VHMW LPS-producing strain, two wzz homologs were identified in F. novicida U112 (FTN_1433 and FTN_0925), and each was separately cloned into pMP633 plasmid under groEL promoter using the Gibson Assembly Kit ( ).

    Article Title: Serendipita indica E5′ NT modulates extracellular nucleotide levels in the plant apoplast and affects fungal colonization
    Article Snippet: .. For the construction of SPE5′NT :mCherry:E5′NTwoSP , Si E5′NT without signal peptide (E5′NT woSP ) was amplified from the plasmid TOPO‐E5′NT using Phusion DNA polymerase (NEB) by respective oligonucleotides ( ) and cloned into the Bam HI digested plasmid ProUm Pit2:: SPDld1 :mCherry:Dld1woSP (Nostadt et al , unpublished data), generating the plasmid ProUm Pit2:: SPDld1 :mCherry:E5′NTwoSP . .. Subsequently, ProUm Pit2:: SPDld1 :mCherry:E5′NTwoSP was digested with Sac II and Nco I and ligated with a DNA fragment encoding the E5′NT signal peptide (SPE5′NT ) digested with the same restriction enzymes, replacing the Dld1 signal peptide (SPDld1 ) and generating the construct ProUm Pit2:: SPE5′NT :mCherry:E5′NTwoSP .

    Article Title: Improvement of the CRISPR-Cpf1 system with ribozyme-processed crRNA
    Article Snippet: .. The U6-cr, U6-cr-HDV and U6-HH-cr-HDV DNA fragments containing two BsmBI enzyme sites for crRNA cloning were synthesized by IDT and cloned into the pSilencer2.0-U6 vector using the PmII and HindIII restriction enzyme sites by the Gibson cloning method (NEB). .. The DNA oligonucleotides encoding the crRNA targeting sequences were annealed and inserted into crRNA expression vectors via the BsmBI sites.

    Amplification:

    Article Title: Serendipita indica E5′ NT modulates extracellular nucleotide levels in the plant apoplast and affects fungal colonization
    Article Snippet: .. For the construction of SPE5′NT :mCherry:E5′NTwoSP , Si E5′NT without signal peptide (E5′NT woSP ) was amplified from the plasmid TOPO‐E5′NT using Phusion DNA polymerase (NEB) by respective oligonucleotides ( ) and cloned into the Bam HI digested plasmid ProUm Pit2:: SPDld1 :mCherry:Dld1woSP (Nostadt et al , unpublished data), generating the plasmid ProUm Pit2:: SPDld1 :mCherry:E5′NTwoSP . .. Subsequently, ProUm Pit2:: SPDld1 :mCherry:E5′NTwoSP was digested with Sac II and Nco I and ligated with a DNA fragment encoding the E5′NT signal peptide (SPE5′NT ) digested with the same restriction enzymes, replacing the Dld1 signal peptide (SPDld1 ) and generating the construct ProUm Pit2:: SPE5′NT :mCherry:E5′NTwoSP .

    Synthesized:

    Article Title: Improvement of the CRISPR-Cpf1 system with ribozyme-processed crRNA
    Article Snippet: .. The U6-cr, U6-cr-HDV and U6-HH-cr-HDV DNA fragments containing two BsmBI enzyme sites for crRNA cloning were synthesized by IDT and cloned into the pSilencer2.0-U6 vector using the PmII and HindIII restriction enzyme sites by the Gibson cloning method (NEB). .. The DNA oligonucleotides encoding the crRNA targeting sequences were annealed and inserted into crRNA expression vectors via the BsmBI sites.

    Mutagenesis:

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2
    Article Snippet: .. The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA). .. The full-length (1797 bp) IGF2BP2 CDS lacking the start codon was generated by RT-PCR using total RNA extracted from HTR-8/SVneo cells and inserted into the EcoR I and Bgl II sites downstream of the FLAG peptide sequence in the N-terminal pFLAG-CMV-4 vector (Sigma, St. Louis, MO, USA).

    Construct:

    Article Title: Mek1 coordinates meiotic progression with DNA break repair by directly phosphorylating and inhibiting the yeast pachytene exit regulator Ndt80
    Article Snippet: .. The ndt80-6A , 6D and 8D alleles, in pNH400, pNH401 and pNH405, respectively, were constructed using three fragment Gibson Assembly (GA) reactions (New England BioLabs). ..

    Sequencing:

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP
    Article Snippet: .. Construction of HaloTag fusion protein plasmids The coding sequence of human PTBP1 with stop codon, which encodes polypyrimidine-tract binding protein (PTB), was cloned into the pENTR4 vector using Gibson Assembly (catalog No. E2611; New England Biolabs). .. Then LR recombination reaction (Invitrogen, Catalog No. 11791020) was applied to transfer the entry sequence into a destination vector, which is engineered in house from a pMSCV-puro (Clontech, PT3303-5) plasmid with inserted N-terminal HaloTag, followed by 3× TEV cleavage sites, 2× StrepII, and a Gateway™ recombination cassette.

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2
    Article Snippet: .. The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA). .. The full-length (1797 bp) IGF2BP2 CDS lacking the start codon was generated by RT-PCR using total RNA extracted from HTR-8/SVneo cells and inserted into the EcoR I and Bgl II sites downstream of the FLAG peptide sequence in the N-terminal pFLAG-CMV-4 vector (Sigma, St. Louis, MO, USA).

    Generated:

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2
    Article Snippet: .. The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA). .. The full-length (1797 bp) IGF2BP2 CDS lacking the start codon was generated by RT-PCR using total RNA extracted from HTR-8/SVneo cells and inserted into the EcoR I and Bgl II sites downstream of the FLAG peptide sequence in the N-terminal pFLAG-CMV-4 vector (Sigma, St. Louis, MO, USA).

    Polymerase Chain Reaction:

    Article Title: Glycoconjugate vaccine using a genetically modified O antigen induces protective antibodies to Francisella tularensis
    Article Snippet: .. To achieve a clean wzz1 deletion, 0.5-kb upstream and downstream DNA regions were PCR-amplified by Q5 polymerase (New England Biolabs) using primers ( ) and cloned into pMP812 suicide plasmid using a Gibson Assembly Kit (New England Biolabs) following the manufacturer’s recommendations. .. To generate the VHMW LPS-producing strain, two wzz homologs were identified in F. novicida U112 (FTN_1433 and FTN_0925), and each was separately cloned into pMP633 plasmid under groEL promoter using the Gibson Assembly Kit ( ).

    Binding Assay:

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP
    Article Snippet: .. Construction of HaloTag fusion protein plasmids The coding sequence of human PTBP1 with stop codon, which encodes polypyrimidine-tract binding protein (PTB), was cloned into the pENTR4 vector using Gibson Assembly (catalog No. E2611; New England Biolabs). .. Then LR recombination reaction (Invitrogen, Catalog No. 11791020) was applied to transfer the entry sequence into a destination vector, which is engineered in house from a pMSCV-puro (Clontech, PT3303-5) plasmid with inserted N-terminal HaloTag, followed by 3× TEV cleavage sites, 2× StrepII, and a Gateway™ recombination cassette.

    Plasmid Preparation:

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP
    Article Snippet: .. Construction of HaloTag fusion protein plasmids The coding sequence of human PTBP1 with stop codon, which encodes polypyrimidine-tract binding protein (PTB), was cloned into the pENTR4 vector using Gibson Assembly (catalog No. E2611; New England Biolabs). .. Then LR recombination reaction (Invitrogen, Catalog No. 11791020) was applied to transfer the entry sequence into a destination vector, which is engineered in house from a pMSCV-puro (Clontech, PT3303-5) plasmid with inserted N-terminal HaloTag, followed by 3× TEV cleavage sites, 2× StrepII, and a Gateway™ recombination cassette.

    Article Title: Glycoconjugate vaccine using a genetically modified O antigen induces protective antibodies to Francisella tularensis
    Article Snippet: .. To achieve a clean wzz1 deletion, 0.5-kb upstream and downstream DNA regions were PCR-amplified by Q5 polymerase (New England Biolabs) using primers ( ) and cloned into pMP812 suicide plasmid using a Gibson Assembly Kit (New England Biolabs) following the manufacturer’s recommendations. .. To generate the VHMW LPS-producing strain, two wzz homologs were identified in F. novicida U112 (FTN_1433 and FTN_0925), and each was separately cloned into pMP633 plasmid under groEL promoter using the Gibson Assembly Kit ( ).

    Article Title: Serendipita indica E5′ NT modulates extracellular nucleotide levels in the plant apoplast and affects fungal colonization
    Article Snippet: .. For the construction of SPE5′NT :mCherry:E5′NTwoSP , Si E5′NT without signal peptide (E5′NT woSP ) was amplified from the plasmid TOPO‐E5′NT using Phusion DNA polymerase (NEB) by respective oligonucleotides ( ) and cloned into the Bam HI digested plasmid ProUm Pit2:: SPDld1 :mCherry:Dld1woSP (Nostadt et al , unpublished data), generating the plasmid ProUm Pit2:: SPDld1 :mCherry:E5′NTwoSP . .. Subsequently, ProUm Pit2:: SPDld1 :mCherry:E5′NTwoSP was digested with Sac II and Nco I and ligated with a DNA fragment encoding the E5′NT signal peptide (SPE5′NT ) digested with the same restriction enzymes, replacing the Dld1 signal peptide (SPDld1 ) and generating the construct ProUm Pit2:: SPE5′NT :mCherry:E5′NTwoSP .

    Article Title: Improvement of the CRISPR-Cpf1 system with ribozyme-processed crRNA
    Article Snippet: .. The U6-cr, U6-cr-HDV and U6-HH-cr-HDV DNA fragments containing two BsmBI enzyme sites for crRNA cloning were synthesized by IDT and cloned into the pSilencer2.0-U6 vector using the PmII and HindIII restriction enzyme sites by the Gibson cloning method (NEB). .. The DNA oligonucleotides encoding the crRNA targeting sequences were annealed and inserted into crRNA expression vectors via the BsmBI sites.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs transgene construction gibson cloning
    Polar clearing requires the ability of TPXL-1 to activate Aurora A. (A) Schematics of the protein products of the WT and Aurora A–binding defective (FD) tpxl-1 <t>transgenes.</t> (B) Immunoblots of control (N2) worms and worms expressing TPXL-1 WT or TPXL-1 FD after depletion of endogenous TPXL-1 by RNAi were probed for TPXL-1 and α-tubulin as a loading control. (C) Spindle length calculated by measuring the distance between the centrosomes (Fig. S1 F) is plotted for control (black) and TPXL-1 depleted ( tpxl-1(RNAi) ; gray) embryos and for embryos expressing TPXL-1 WT (green) or TPXL-1 FD (purple) after endogenous TPXL-1 depletion. n = number of embryos. (D) Confocal images of anaphase embryos expressing TPXL-1 WT ::NG ( n = 10) or TPXL-1 FD ::NG ( n = 11) after endogenous TPXL-1 depletion. To visualize TPXL-1::NG on astral microtubules without saturating the aster centers, a gamma of 2.5 was introduced in Photoshop. (E) Time-lapse series of myosin-depleted rga-3/4Δ embryos expressing mKate2::anillin and TPXL-1 WT ( n = 12) or TPXL-1 FD ( n = 8). Embryos were depleted of HCP-4 along with endogenous TPXL-1 to ensure comparable pole separation. (F) Kymographs of the anterior cortex of the embryos in E beginning 180 s after NEBD. (G) Normalized cortical mKate2::anillin fluorescence at the anterior pole; n = number of linescans. (H) Graph plotting the distance between the anterior aster and anterior pole. n = number of embryos. (I) Model illustrating how the activation of Aurora A by TPXL-1 on astral microtubules could generate a diffusible signal that inhibits the accumulation of contractile ring proteins on the polar cortex. All error bars are SEM. Bars, 5 µm.
    Transgene Construction Gibson Cloning, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 85 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transgene construction gibson cloning/product/New England Biolabs
    Average 99 stars, based on 85 article reviews
    Price from $9.99 to $1999.99
    transgene construction gibson cloning - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs ura3 selection marker gibson assembly cloning kit
    Average <t>URA3</t> mRNA level in four conditions . Analyses were performed on set 2 or set 1 (with or without t HMG1 expression, respectively), in glucose (blue bars) or ethanol (red bars) metabolism. Results were normalized with URA3 signal in strain H for strains from set 1, and with URA3 signal in strain H +H for strains from set 2. Error bars represent 1 SD.
    Ura3 Selection Marker Gibson Assembly Cloning Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ura3 selection marker gibson assembly cloning kit/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ura3 selection marker gibson assembly cloning kit - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Polar clearing requires the ability of TPXL-1 to activate Aurora A. (A) Schematics of the protein products of the WT and Aurora A–binding defective (FD) tpxl-1 transgenes. (B) Immunoblots of control (N2) worms and worms expressing TPXL-1 WT or TPXL-1 FD after depletion of endogenous TPXL-1 by RNAi were probed for TPXL-1 and α-tubulin as a loading control. (C) Spindle length calculated by measuring the distance between the centrosomes (Fig. S1 F) is plotted for control (black) and TPXL-1 depleted ( tpxl-1(RNAi) ; gray) embryos and for embryos expressing TPXL-1 WT (green) or TPXL-1 FD (purple) after endogenous TPXL-1 depletion. n = number of embryos. (D) Confocal images of anaphase embryos expressing TPXL-1 WT ::NG ( n = 10) or TPXL-1 FD ::NG ( n = 11) after endogenous TPXL-1 depletion. To visualize TPXL-1::NG on astral microtubules without saturating the aster centers, a gamma of 2.5 was introduced in Photoshop. (E) Time-lapse series of myosin-depleted rga-3/4Δ embryos expressing mKate2::anillin and TPXL-1 WT ( n = 12) or TPXL-1 FD ( n = 8). Embryos were depleted of HCP-4 along with endogenous TPXL-1 to ensure comparable pole separation. (F) Kymographs of the anterior cortex of the embryos in E beginning 180 s after NEBD. (G) Normalized cortical mKate2::anillin fluorescence at the anterior pole; n = number of linescans. (H) Graph plotting the distance between the anterior aster and anterior pole. n = number of embryos. (I) Model illustrating how the activation of Aurora A by TPXL-1 on astral microtubules could generate a diffusible signal that inhibits the accumulation of contractile ring proteins on the polar cortex. All error bars are SEM. Bars, 5 µm.

    Journal: The Journal of Cell Biology

    Article Title: TPXL-1 activates Aurora A to clear contractile ring components from the polar cortex during cytokinesis

    doi: 10.1083/jcb.201706021

    Figure Lengend Snippet: Polar clearing requires the ability of TPXL-1 to activate Aurora A. (A) Schematics of the protein products of the WT and Aurora A–binding defective (FD) tpxl-1 transgenes. (B) Immunoblots of control (N2) worms and worms expressing TPXL-1 WT or TPXL-1 FD after depletion of endogenous TPXL-1 by RNAi were probed for TPXL-1 and α-tubulin as a loading control. (C) Spindle length calculated by measuring the distance between the centrosomes (Fig. S1 F) is plotted for control (black) and TPXL-1 depleted ( tpxl-1(RNAi) ; gray) embryos and for embryos expressing TPXL-1 WT (green) or TPXL-1 FD (purple) after endogenous TPXL-1 depletion. n = number of embryos. (D) Confocal images of anaphase embryos expressing TPXL-1 WT ::NG ( n = 10) or TPXL-1 FD ::NG ( n = 11) after endogenous TPXL-1 depletion. To visualize TPXL-1::NG on astral microtubules without saturating the aster centers, a gamma of 2.5 was introduced in Photoshop. (E) Time-lapse series of myosin-depleted rga-3/4Δ embryos expressing mKate2::anillin and TPXL-1 WT ( n = 12) or TPXL-1 FD ( n = 8). Embryos were depleted of HCP-4 along with endogenous TPXL-1 to ensure comparable pole separation. (F) Kymographs of the anterior cortex of the embryos in E beginning 180 s after NEBD. (G) Normalized cortical mKate2::anillin fluorescence at the anterior pole; n = number of linescans. (H) Graph plotting the distance between the anterior aster and anterior pole. n = number of embryos. (I) Model illustrating how the activation of Aurora A by TPXL-1 on astral microtubules could generate a diffusible signal that inhibits the accumulation of contractile ring proteins on the polar cortex. All error bars are SEM. Bars, 5 µm.

    Article Snippet: Transgene construction Gibson cloning (E2611; NEB) was used to construct transgenes encoding WT and mNeonGreen tagged TPXL-1 (isoform A) in pCFJ350.

    Techniques: Binding Assay, Western Blot, Expressing, Fluorescence, Activation Assay

    Use of immunofluorescence microscopy to detect tāpirin proteins displayed on the cell wall of yeast. White light and epifluorescent images for S. cerevisiae EBY100 treated with anti-Calkro_0844 ( A and E ) or anti-Calkro_0845 ( B and F ) antibodies. S. cerevisiae EBY100 expressing Calkro_0844 was observed under white light ( C ) and epifluorescence ( G ) after incubation with anti-Calkro_0844 antibodies. S. cerevisiae EBY100 expressing Calkro_0845 was observed under white light ( D ) and epifluorescence ( H ) after incubation with anti-Calkro_0845 antibodies. Goat anti-rabbit conjugated with DyLight488 was used as a secondary antibody. All images were captured at ×40; scale bar in each image is 50 μm.

    Journal: The Journal of Biological Chemistry

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose *

    doi: 10.1074/jbc.M115.641480

    Figure Lengend Snippet: Use of immunofluorescence microscopy to detect tāpirin proteins displayed on the cell wall of yeast. White light and epifluorescent images for S. cerevisiae EBY100 treated with anti-Calkro_0844 ( A and E ) or anti-Calkro_0845 ( B and F ) antibodies. S. cerevisiae EBY100 expressing Calkro_0844 was observed under white light ( C ) and epifluorescence ( G ) after incubation with anti-Calkro_0844 antibodies. S. cerevisiae EBY100 expressing Calkro_0845 was observed under white light ( D ) and epifluorescence ( H ) after incubation with anti-Calkro_0845 antibodies. Goat anti-rabbit conjugated with DyLight488 was used as a secondary antibody. All images were captured at ×40; scale bar in each image is 50 μm.

    Article Snippet: Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions.

    Techniques: Immunofluorescence, Microscopy, Expressing, Incubation

    SDS-PAGE analysis of tāpirin binding to various plant cell wall components and plant biomass. Tāpirins tested include Csac_1073 (class 1) ( A ), Calkro_0844 (class 1) ( B ), and Calkro_0845 (class 2) ( C ), and thermolysin-digested Calkro_0844 (Calkro_0844_ C ) ( D ). Abbreviations for plant biomass substrates are as follows: aSWG, dilute acid-pretreated switchgrass; aPTD, dilute acid-pretreated P. deltoides × P. trichocarpa ; PTD, P. deltoides × P. trichocarpa. B, bound protein liberated from the substrate after boiling in 1× Laemmli buffer; U, free protein. 40 μg of protein was used in all conditions tested; image is representative of three replicates.

    Journal: The Journal of Biological Chemistry

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose *

    doi: 10.1074/jbc.M115.641480

    Figure Lengend Snippet: SDS-PAGE analysis of tāpirin binding to various plant cell wall components and plant biomass. Tāpirins tested include Csac_1073 (class 1) ( A ), Calkro_0844 (class 1) ( B ), and Calkro_0845 (class 2) ( C ), and thermolysin-digested Calkro_0844 (Calkro_0844_ C ) ( D ). Abbreviations for plant biomass substrates are as follows: aSWG, dilute acid-pretreated switchgrass; aPTD, dilute acid-pretreated P. deltoides × P. trichocarpa ; PTD, P. deltoides × P. trichocarpa. B, bound protein liberated from the substrate after boiling in 1× Laemmli buffer; U, free protein. 40 μg of protein was used in all conditions tested; image is representative of three replicates.

    Article Snippet: Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions.

    Techniques: SDS Page, Binding Assay

    Crystal structure of thermolysin-digested Calkro_0844_ C . A, schematic representation in spectrum colors from blue on the N terminus to red on the C terminus. A single magnesium ion is depicted as a green sphere . Four α-helices are marked as well as first and last residues of the protective loop. B, cartoon representation rotated 90° to illustrate the triangular shape of the β-helix core as well as two exposed and one protected surfaces. C, view from the top onto hydrophobic surface of the β-helix core (semi-transparent surface representation, CPK colors), protective loop (semi-transparent surface, cyan ), and N and C termini (cartoon, blue and red , respectively). The first and last residues of the protective loop are marked. D, view from the top onto hydrophobic surface of the β-helix core with protective loop, N and C termini removed. Exposed aromatic residues are highlighted in green and are labeled.

    Journal: The Journal of Biological Chemistry

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose *

    doi: 10.1074/jbc.M115.641480

    Figure Lengend Snippet: Crystal structure of thermolysin-digested Calkro_0844_ C . A, schematic representation in spectrum colors from blue on the N terminus to red on the C terminus. A single magnesium ion is depicted as a green sphere . Four α-helices are marked as well as first and last residues of the protective loop. B, cartoon representation rotated 90° to illustrate the triangular shape of the β-helix core as well as two exposed and one protected surfaces. C, view from the top onto hydrophobic surface of the β-helix core (semi-transparent surface representation, CPK colors), protective loop (semi-transparent surface, cyan ), and N and C termini (cartoon, blue and red , respectively). The first and last residues of the protective loop are marked. D, view from the top onto hydrophobic surface of the β-helix core with protective loop, N and C termini removed. Exposed aromatic residues are highlighted in green and are labeled.

    Article Snippet: Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions.

    Techniques: Labeling

    CRISPR-based gene replacement of robo3. a Schematic of the robo3 gene showing intron/exon structure and location of gRNA target sites, robo3 TcRobo2/3 homologous donor plasmid, and the final modified robo3 TcRobo2/3 allele. Endogenous robo3 coding exons are shown as purple boxes ; 5′ and 3′ untranslated regions are shown as light gray boxes . The start of transcription is indicated by the bent arrow . Introns and exons are shown to scale, with the exception of the first intron, from which approximately 13 kb has been omitted. Red arrows indicate the location of upstream (gRNA 1) and downstream (gRNA 2) gRNA target sites. Gray brackets demarcate the region to be replaced by sequences from the donor plasmid. Arrows indicate the position and orientation of PCR primers. b Partial DNA sequences of the unmodified robo3 gene and the modified robo3 TcRobo2/3 allele. Black letters indicated endogenous DNA sequence; red letters indicate exogenous sequence. Both DNA strands are illustrated. The gRNA protospacer and PAM sequences are indicated for both gRNAs. The first five base pairs of robo3 exon 2 are unaltered in the robo3 TcRobo2/3 allele, and the robo3 coding sequence beginning with codon H21 is replaced by the HA-tagged TcRobo2/3 cDNA. The endogenous robo3 transcription start site, ATG start codon, and signal peptide are retained in exon 1. The PAM sequences and portions of both protospacers are deleted in the modified allele, ensuring that the robo3 TcRobo2/3 donor plasmid and modified robo3 TcRobo2/3 allele are not targeted by Cas9. UTR untranslated regions, 5 ′ H 5′ homology region, 3′H 3′ homology region, HA hemagglutinin epitope tag, gRNA guide RNA, HDR homology-directed repair, PAM protospacer adjacent motif

    Journal: EvoDevo

    Article Title: CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3

    doi: 10.1186/s13227-017-0073-y

    Figure Lengend Snippet: CRISPR-based gene replacement of robo3. a Schematic of the robo3 gene showing intron/exon structure and location of gRNA target sites, robo3 TcRobo2/3 homologous donor plasmid, and the final modified robo3 TcRobo2/3 allele. Endogenous robo3 coding exons are shown as purple boxes ; 5′ and 3′ untranslated regions are shown as light gray boxes . The start of transcription is indicated by the bent arrow . Introns and exons are shown to scale, with the exception of the first intron, from which approximately 13 kb has been omitted. Red arrows indicate the location of upstream (gRNA 1) and downstream (gRNA 2) gRNA target sites. Gray brackets demarcate the region to be replaced by sequences from the donor plasmid. Arrows indicate the position and orientation of PCR primers. b Partial DNA sequences of the unmodified robo3 gene and the modified robo3 TcRobo2/3 allele. Black letters indicated endogenous DNA sequence; red letters indicate exogenous sequence. Both DNA strands are illustrated. The gRNA protospacer and PAM sequences are indicated for both gRNAs. The first five base pairs of robo3 exon 2 are unaltered in the robo3 TcRobo2/3 allele, and the robo3 coding sequence beginning with codon H21 is replaced by the HA-tagged TcRobo2/3 cDNA. The endogenous robo3 transcription start site, ATG start codon, and signal peptide are retained in exon 1. The PAM sequences and portions of both protospacers are deleted in the modified allele, ensuring that the robo3 TcRobo2/3 donor plasmid and modified robo3 TcRobo2/3 allele are not targeted by Cas9. UTR untranslated regions, 5 ′ H 5′ homology region, 3′H 3′ homology region, HA hemagglutinin epitope tag, gRNA guide RNA, HDR homology-directed repair, PAM protospacer adjacent motif

    Article Snippet: Construction of robo3TcRobo2/3 donor plasmid The initial robo3 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs E2611).

    Techniques: CRISPR, Plasmid Preparation, Modification, Polymerase Chain Reaction, Sequencing

    Average URA3 mRNA level in four conditions . Analyses were performed on set 2 or set 1 (with or without t HMG1 expression, respectively), in glucose (blue bars) or ethanol (red bars) metabolism. Results were normalized with URA3 signal in strain H for strains from set 1, and with URA3 signal in strain H +H for strains from set 2. Error bars represent 1 SD.

    Journal: Frontiers in Bioengineering and Biotechnology

    Article Title: Transcription Interference and ORF Nature Strongly Affect Promoter Strength in a Reconstituted Metabolic Pathway

    doi: 10.3389/fbioe.2015.00021

    Figure Lengend Snippet: Average URA3 mRNA level in four conditions . Analyses were performed on set 2 or set 1 (with or without t HMG1 expression, respectively), in glucose (blue bars) or ethanol (red bars) metabolism. Results were normalized with URA3 signal in strain H for strains from set 1, and with URA3 signal in strain H +H for strains from set 2. Error bars represent 1 SD.

    Article Snippet: The library of promoter-ORF-terminator associations was subsequently assembled by Gibson cloning method (Gibson et al., ) in a Sac I/Xho I linearized pRS426 (URA3 selection marker) (Gibson Assembly Cloning Kit, NEB, Ipswich, MA, USA).

    Techniques: Expressing