femto bacterial quantification kit  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    Femto Bacterial DNA Quantification Kit
    Description:
    The Femto Bacterial DNA Quantification Kit can detect and quantify bacterial DNA with high specificity and sensitivity Bacterial DNA can be reliably quantified in a background of non bacterial DNA such as human fungal animal DNA etc This is essential for downstream applications that require accurate DNA input amounts such as STR analysis The Femto Bacterial DNA Quantification Kit dependably quantifies as little as 20 fg from 1 µl of DNA from purified biological liquids bacterial cultures environmental samples anthropological samples or forensic samples
    Catalog Number:
    e2006
    Price:
    None
    Applications:
    DNA Quantification, PCR
    Size:
    100 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research femto bacterial quantification kit
    Femto Bacterial DNA Quantification Kit
    The Femto Bacterial DNA Quantification Kit can detect and quantify bacterial DNA with high specificity and sensitivity Bacterial DNA can be reliably quantified in a background of non bacterial DNA such as human fungal animal DNA etc This is essential for downstream applications that require accurate DNA input amounts such as STR analysis The Femto Bacterial DNA Quantification Kit dependably quantifies as little as 20 fg from 1 µl of DNA from purified biological liquids bacterial cultures environmental samples anthropological samples or forensic samples
    https://www.bioz.com/result/femto bacterial quantification kit/product/Zymo Research
    Average 94 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    femto bacterial quantification kit - by Bioz Stars, 2020-02
    94/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Does the Urinary Microbiome Play a Role in Urgency Urinary Incontinence and Its Severity?
    Article Snippet: .. RT-qPCR to quantify amount of bacterial DNA in urine Bacterial DNA was amplified by RT-qPCR using the FemtoTM Bacterial DNA Quantification Kit (Zymo Research, USA) which contains primers that target the 16S rRNA gene. ..

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA. .. Amplification was conducted in technical triplicate with a LightCycler 480 II (Roche, Indianapolis, IN, USA).

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA. .. Amplification was conducted in technical triplicate with a LightCycler 480 II (Roche, Indianapolis, IN, USA).

    Article Title: A model of clinical endometritis in Holstein heifers using pathogenic Escherichia coli and Trueperella pyogenes
    Article Snippet: Total 16S rRNA was quantified using the Femto Bacterial DNA Quantification Kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA). .. Thermocycling conditions included initial denaturation at 95°C for 10 min, 40 cycles of amplification consisting of denaturation at 95°C for 30 s, annealing at 50°C for 30 s and extension at 72°C for 1 min, followed by a final extension at 72°C for 7 min. A total of 2 μL of extracted total DNA sample was applied to each PCR reaction.

    Quantitative RT-PCR:

    Article Title: Does the Urinary Microbiome Play a Role in Urgency Urinary Incontinence and Its Severity?
    Article Snippet: .. RT-qPCR to quantify amount of bacterial DNA in urine Bacterial DNA was amplified by RT-qPCR using the FemtoTM Bacterial DNA Quantification Kit (Zymo Research, USA) which contains primers that target the 16S rRNA gene. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Qualitative and Quantitative DNA- and RNA-Based Analysis of the Bacterial Stomach Microbiota in Humans, Mice, and Gerbils
    Article Snippet: .. To determine bacterial loads in human aspirate and mouse stomach samples, metagenomic DNA and cDNA were diluted 1:100 and duplicates of 2 µl used as the template for quantitative PCR with a Femto bacterial DNA quantification kit (Zymo Research), according to the manufacturer’s recommendations. ..

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA. .. Amplification was conducted in technical triplicate with a LightCycler 480 II (Roche, Indianapolis, IN, USA).

    Article Title: Liver macrophage-associated inflammation correlates with SIV burden and is substantially reduced following cART
    Article Snippet: .. Quantification of bacterial 16S DNA in the liver Levels of bacterial 16S DNA in the liver was assessed by qPCR using a Femto Bacterial DNA Quantification Kit (Zymo Research, E2006) per the manufacturer’s instructions. .. Briefly, total DNA was extracted as described above and diluted in nuclease-free water to a final concentration of 100 ng/uL.

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA. .. Amplification was conducted in technical triplicate with a LightCycler 480 II (Roche, Indianapolis, IN, USA).

    Article Title: Effect of Saccharomyces boulardii and Mode of Delivery on the Early Development of the Gut Microbial Community in Preterm Infants
    Article Snippet: Bacterial DNA detection and quantification For bacterial DNA quantification, the PCR-based Femto Bacterial DNA Quantification Kit (Zymo; Irvine, CA, USA) was used. .. Quantitative PCR (qPCR) reactions were run in triplicate on the 7900HT Real-Time PCR System (Life Technologies; Carlsbad, CA, USA) using the thermocycling parameters and reaction volumes recommended in the manufacturer’s protocol (Zymo; Irvine, CA, USA).

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: For fungal qPCR, each 20 μl reaction contained 1 μL each of the forward ITS1f (CTTGGTCATTTAGAGGAAGTAA) and reverse ITS2 (GCTGCGTTCTTCATCGATGC) primers at 10 μM, 10μl of the mastermix, 6 μl of DNA-free water, and 2 μl of the target DNA extraction. .. A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18.

    Article Title: Liver macrophage-associated inflammation correlates with SIV burden and is substantially reduced following cART
    Article Snippet: .. Levels of bacterial 16S DNA in the liver was assessed by qPCR using a Femto Bacterial DNA Quantification Kit (Zymo Research, E2006) per the manufacturer’s instructions. .. Briefly, total DNA was extracted as described above and diluted in nuclease-free water to a final concentration of 100 ng/uL.

    Incubation:

    Article Title: A model of clinical endometritis in Holstein heifers using pathogenic Escherichia coli and Trueperella pyogenes
    Article Snippet: The mucus was added to guanidine thiocyanate and homogenized with garnet particles using 3 bead beater cycles (30 s at 6,000 × g , 60 s pause, 30 s at 6,000 × g ) with a 5 min incubation on ice between each cycle. .. Total 16S rRNA was quantified using the Femto Bacterial DNA Quantification Kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA).

    Modification:

    Article Title: A model of clinical endometritis in Holstein heifers using pathogenic Escherichia coli and Trueperella pyogenes
    Article Snippet: Total DNA was isolated from vaginal mucus using the DNeasy Power Soil Kit according to the manufacturer’s instructions with modification (Qiagen, Hilden, Germany). .. Total 16S rRNA was quantified using the Femto Bacterial DNA Quantification Kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA).

    Serial Dilution:

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: To determine the copy number of the 16S gene (and therefore the number of organisms per swab), a standard curve was generated using a serial dilution of a plasmid containing the Escherichia coli 16S rRNA gene. .. A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18.

    Generated:

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: To determine the copy number of the 16S gene (and therefore the number of organisms per swab), a standard curve was generated using a serial dilution of a plasmid containing the Escherichia coli 16S rRNA gene. .. A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18.

    DNA Sequencing:

    Article Title: Lactobacillus buchneri Genotyping on the Basis of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Locus Diversity
    Article Snippet: Paragraph title: DNA sequencing of L. buchneri CRISPR-Cas systems. ... After 48 h, the DNA was extracted using a Zymo Fungal/Bacterial DNA purification kit following the special protocol for Gram-positive bacteria.

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: Paragraph title: Quantitative PCR and DNA sequencing ... Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA.

    Polymerase Chain Reaction:

    Article Title: Lactobacillus buchneri Genotyping on the Basis of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Locus Diversity
    Article Snippet: After 48 h, the DNA was extracted using a Zymo Fungal/Bacterial DNA purification kit following the special protocol for Gram-positive bacteria. .. PCR screening for CRISPR was used to determine which CRISPR-Cas system was present in the isolated strains.

    Article Title: A model of clinical endometritis in Holstein heifers using pathogenic Escherichia coli and Trueperella pyogenes
    Article Snippet: Total 16S rRNA was quantified using the Femto Bacterial DNA Quantification Kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA). .. Thermocycling conditions included initial denaturation at 95°C for 10 min, 40 cycles of amplification consisting of denaturation at 95°C for 30 s, annealing at 50°C for 30 s and extension at 72°C for 1 min, followed by a final extension at 72°C for 7 min. A total of 2 μL of extracted total DNA sample was applied to each PCR reaction.

    Article Title: Effect of Saccharomyces boulardii and Mode of Delivery on the Early Development of the Gut Microbial Community in Preterm Infants
    Article Snippet: .. Bacterial DNA detection and quantification For bacterial DNA quantification, the PCR-based Femto Bacterial DNA Quantification Kit (Zymo; Irvine, CA, USA) was used. .. Quantitative PCR (qPCR) reactions were run in triplicate on the 7900HT Real-Time PCR System (Life Technologies; Carlsbad, CA, USA) using the thermocycling parameters and reaction volumes recommended in the manufacturer’s protocol (Zymo; Irvine, CA, USA).

    DNA Extraction:

    Article Title: Lactobacillus buchneri Genotyping on the Basis of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Locus Diversity
    Article Snippet: To prepare for DNA extraction, cells were propagated overnight, resuspended in 10 ml of MRS broth, and grown at 37°C in a Coy Laboratories (Grass Lake, MI) anaerobic chamber. .. After 48 h, the DNA was extracted using a Zymo Fungal/Bacterial DNA purification kit following the special protocol for Gram-positive bacteria.

    Article Title: A model of clinical endometritis in Holstein heifers using pathogenic Escherichia coli and Trueperella pyogenes
    Article Snippet: Briefly, samples were thawed on ice and vortexed and 250 mg of vaginal mucus was used for DNA extraction using a bead beater tissue homogenizer (Precellys 24, Bertin Technologies SAS, Montigny-le-Bretonneux, France). .. Total 16S rRNA was quantified using the Femto Bacterial DNA Quantification Kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA).

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: Paragraph title: DNA extraction and sequencing ... A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18.

    Fluorescence:

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: The following thermocycler conditions were used: (1) 95 °C for 5 min, (2) 95 °C for 10 s, (3) 45 °C for 45 s, (4) Measure fluorescence, with steps 2 through 4 repeated 50 times. .. A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18.

    Isolation:

    Article Title: Lactobacillus buchneri Genotyping on the Basis of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Locus Diversity
    Article Snippet: After 48 h, the DNA was extracted using a Zymo Fungal/Bacterial DNA purification kit following the special protocol for Gram-positive bacteria. .. PCR screening for CRISPR was used to determine which CRISPR-Cas system was present in the isolated strains.

    Article Title: A model of clinical endometritis in Holstein heifers using pathogenic Escherichia coli and Trueperella pyogenes
    Article Snippet: Paragraph title: Quantification of Total 16S rRNA Isolated From Vaginal Mucus ... Total 16S rRNA was quantified using the Femto Bacterial DNA Quantification Kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA).

    Sequencing:

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: Paragraph title: DNA extraction and sequencing ... A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18.

    Construct:

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: .. A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18. ..

    CRISPR:

    Article Title: Lactobacillus buchneri Genotyping on the Basis of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Locus Diversity
    Article Snippet: Paragraph title: DNA sequencing of L. buchneri CRISPR-Cas systems. ... After 48 h, the DNA was extracted using a Zymo Fungal/Bacterial DNA purification kit following the special protocol for Gram-positive bacteria.

    Plasmid Preparation:

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: To determine the copy number of the 16S gene (and therefore the number of organisms per swab), a standard curve was generated using a serial dilution of a plasmid containing the Escherichia coli 16S rRNA gene. .. A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18.

    Software:

    Article Title: Microbial and metabolic succession on common building materials under high humidity conditions
    Article Snippet: A standard curve was constructed using the Zymo Femto Kit, which contains serially diluted DNA from Saccharomyces cerevisiae TMY18. .. The sequence identity cutoff was set at 97%, and taxonomy was assigned to the high-quality ( < 1% incorrect bases) candidate OTUs using the parallel_assign_taxonomy_rdp.py script of the QIIME software.

    SYBR Green Assay:

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: To quantify the abundance of Bacteria and Archaea in the snow samples, LightCycler 480 SYBR Green I Master quantitative PCR (qPCR) mix (Roche, Indianapolis, IN, USA) was used in conjunction with 16S rRNA V4-5 region primers ( ; ). .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA.

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: Quantitative PCR and DNA sequencing To quantify the abundance of Bacteria and Archaea in the snow samples, LightCycler 480 SYBR Green I Master quantitative PCR (qPCR) mix (Roche, Indianapolis, IN, USA) was used in conjunction with 16S rRNA V4-5 region primers ( ; ). .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA.

    Negative Control:

    Article Title: Airway bacteria drive a progressive COPD-like phenotype in mice with polymeric immunoglobulin receptor deficiency
    Article Snippet: 16S rRNA quantification Total prokaryotic burden was quantified using the Femto Bacterial DNA Quantification Kit (Zymo Research, Irvine, CA). .. DNase/RNase-free water was used as a negative control.

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA. .. Amplification was conducted in technical triplicate with a LightCycler 480 II (Roche, Indianapolis, IN, USA).

    Article Title: Liver macrophage-associated inflammation correlates with SIV burden and is substantially reduced following cART
    Article Snippet: Quantification of bacterial 16S DNA in the liver Levels of bacterial 16S DNA in the liver was assessed by qPCR using a Femto Bacterial DNA Quantification Kit (Zymo Research, E2006) per the manufacturer’s instructions. .. A ‘No Template’ Negative Control was also conducted to test for any possible contamination of qPCR reagents.

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA. .. Amplification was conducted in technical triplicate with a LightCycler 480 II (Roche, Indianapolis, IN, USA).

    Article Title: Liver macrophage-associated inflammation correlates with SIV burden and is substantially reduced following cART
    Article Snippet: Levels of bacterial 16S DNA in the liver was assessed by qPCR using a Femto Bacterial DNA Quantification Kit (Zymo Research, E2006) per the manufacturer’s instructions. .. A ‘No Template’ Negative Control was also conducted to test for any possible contamination of qPCR reagents.

    Homogenization:

    Article Title: A model of clinical endometritis in Holstein heifers using pathogenic Escherichia coli and Trueperella pyogenes
    Article Snippet: Following homogenization, supernatants were applied to the DNeasy Power Soil spin columns for DNA purification. .. Total 16S rRNA was quantified using the Femto Bacterial DNA Quantification Kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA).

    Concentration Assay:

    Article Title: Liver macrophage-associated inflammation correlates with SIV burden and is substantially reduced following cART
    Article Snippet: Quantification of bacterial 16S DNA in the liver Levels of bacterial 16S DNA in the liver was assessed by qPCR using a Femto Bacterial DNA Quantification Kit (Zymo Research, E2006) per the manufacturer’s instructions. .. Briefly, total DNA was extracted as described above and diluted in nuclease-free water to a final concentration of 100 ng/uL.

    Article Title: Liver macrophage-associated inflammation correlates with SIV burden and is substantially reduced following cART
    Article Snippet: Levels of bacterial 16S DNA in the liver was assessed by qPCR using a Femto Bacterial DNA Quantification Kit (Zymo Research, E2006) per the manufacturer’s instructions. .. Briefly, total DNA was extracted as described above and diluted in nuclease-free water to a final concentration of 100 ng/uL.

    DNA Purification:

    Article Title: Lactobacillus buchneri Genotyping on the Basis of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Locus Diversity
    Article Snippet: .. After 48 h, the DNA was extracted using a Zymo Fungal/Bacterial DNA purification kit following the special protocol for Gram-positive bacteria. .. PCR screening for CRISPR was used to determine which CRISPR-Cas system was present in the isolated strains.

    Article Title: A model of clinical endometritis in Holstein heifers using pathogenic Escherichia coli and Trueperella pyogenes
    Article Snippet: Following homogenization, supernatants were applied to the DNeasy Power Soil spin columns for DNA purification. .. Total 16S rRNA was quantified using the Femto Bacterial DNA Quantification Kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA).

    CTG Assay:

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA. .. Amplification was conducted in technical triplicate with a LightCycler 480 II (Roche, Indianapolis, IN, USA).

    Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA
    Article Snippet: .. Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA. .. Amplification was conducted in technical triplicate with a LightCycler 480 II (Roche, Indianapolis, IN, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Zymo Research femto bacterial quantification kit
    Femto Bacterial Quantification Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 94/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/femto bacterial quantification kit/product/Zymo Research
    Average 94 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    femto bacterial quantification kit - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    Image Search Results